Previous Article | Next Article 
Journal of Virology, December 2001, p. 11863-11867, Vol. 75, No. 23
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.23.11863-11867.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
The Pattern of Tegument-Capsid Interaction in the
Herpes Simplex Virus Type 1 Virion Is Not Influenced by the Small
Hexon-Associated Protein VP26
Dong-Hua
Chen,1
Joanita
Jakana,1
David
McNab,2
Joyce
Mitchell,2
Z. Hong
Zhou,3
Matthew
Dougherty,1
Wah
Chiu,1 and
Frazer J.
Rixon2,*
Verna and Marrs McLean Department of
Biochemistry, Baylor College of Medicine,1 and
Department of Pathology and Laboratory Medicine, University of
Texas-Houston Medical School,3 Houston, Texas
77030, and MRC Virology Unit, Institute of Virology, Glasgow
G11 5JR, United Kingdom2
Received 7 June 2001/Accepted 10 July 2001
 |
ABSTRACT |
Examination of the three-dimensional structure of intact herpes
simplex virus type 1 (HSV-1) virions had revealed that the icosahedrally symmetrical interaction between the tegument and capsid
involves the pentons but not the hexons (Z. H. Zhou, D. H. Chen, J. Jakana, F. J. Rixon, and W. Chiu, J. Virol.
73:3210-3218, 1999). To account for this, we postulated that the
presence of the small capsid protein, VP26, on top of the hexons was
masking potential binding sites and preventing tegument attachment. We have now tested this hypothesis by determining the structure of virions
lacking VP26. Apart from the obvious absence of VP26 from the capsids,
the structures of the VP26 minus and wild-type virions were essentially
identical. Notably, they showed the same tegument attachment patterns,
thereby demonstrating that VP26 is not responsible for the divergent
tegument binding properties of pentons and hexons.
| |
TEXT |
Herpesvirus virions have complex and
characteristic multilayered structures in which the capsid is separated
from the envelope by a thick layer of protein called the tegument
(7, 12). The 125-nm-diameter capsid has the form of a T=16
icosahedron with 12 pentons occupying the icosahedral vertices and 150 hexons forming the faces and edges (11, 18, 23). In herpes
simplex virus type 1 (HSV-1), the pentons and hexons contain five and six copies, respectively, of the 150-kDa major capsid protein, VP5
(6, 23). They are surrounded and connected by 320 triplexes, which are heterotrimers formed from two copies of a 34-kDa
protein (VP23) and a single copy of a 50-kDa protein (VP19C) (6,
9, 21). Six copies of a 12-kDa protein (VP26) occupy the top of each hexon (16, 22). Although the structure of the capsid is increasingly well understood, little is known about the organization of the tegument and how it interacts with the other components of the
virion. Recently, we published the first structural analysis of the
intact HSV-1 virion using electron cryomicroscopy and three-dimensional (3D) reconstruction (20). The majority of the tegument
mass was not icosahedrally ordered and was not resolved. However, some density attributable to the tegument was seen in close contact with the
capsid. The contacts between the capsid and tegument were of limited
extent and were confined to the vicinities of the 12 vertices, where
they extended from near the tip of the penton to the upper surfaces of
the Ta and Tc triplexes. The reason why tegument contacts are
restricted to these particular subunits when apparently similar
potential contact sites are present on other capsomeres and triplexes
was not obvious. A possible reason suggested is that the corresponding
binding site near the tip of the penton is occupied in the hexon by
VP26, making it unavailable to the tegument. To test this possibility
we analyzed the pattern of tegument-capsid interactions in virions that
lack VP26.
Generation of VP26 minus virus.
VP26 is encoded by gene UL35
(8). Sequences downstream from the UL35 ORF were amplified
using the primers GACAGGATCCTGAGGCCCGGGGAGTTCCTTCTGG and GACAAAGCTTCAGACCCTGTATGTCTCTGACG. The
PCR product was digested with BamHI and
HindIII, using the sites built into the primers (underlined), and ligated into
BamHI/HindIII-digested pCMV10
(13) to give pUL35construct1. The open reading frame
(ORF) for the green fluorescent protein (GFP) was isolated from plasmid
pGFPemd-b [R] basic (Packard Bioscience) by digestion with
KpnI and BamHI and ligated into
KpnI/BamHI-digested pUL35construct1 to give
pUL35construct2. Sequences upstream of the UL35 ORF were
amplified by PCR using the primers
GACAGAATTCCCGAGCAGGCTATTACCCGTCGC and
GACAGGTACCATGGGGATCCGAGGTCGGGAAGCGATATGGGGGTGTCG. The PCR product was digested with EcoRI and
NcoI, using the sites built into the primers (unlabelled),
and ligated into EcoRI/NcoI-digested ppUL35construct2 to give pUL35construct3. pUL35construct3 contains HSV-1 sequences from 70186 to 71385 (5) with an internal
deletion from 70557 to 70901 that removes the entire UL35 ORF and
replaces it with the GFP ORF. BHK cells were transfected with
pUL35construct3 and superinfected 5 h later with 1 PFU of HSV-1
strain 17 per cell. After incubation at 37°C for 48 h, the
infected-cell medium was harvested and the virus was titrated and grown
in medium containing 1% carboxymethyl cellulose. Plaques were examined
using a Nikon Microphot-SA fluorescence microscope. Fluorescing plaques
were picked and subjected to three further rounds of purification. A
single plaque isolate was selected and designated dmVP26-minus. To
confirm that the VP26 protein was missing, wild-type and
dmVP26-minus capsids and virions were prepared as described
previously (14, 23) and their protein contents were
analyzed by electrophoresis through a polyacrylamide gel (Fig.
1a). In both capsids and virions, the
12-kDa VP26 protein is absent from the dmVP26-minus profile.
View larger version (115K):
[in this window]
[in a new window]
|
FIG. 1.
(a) Sodium dodecyl sulfate-polyacrylamide gel of
purified wild-type B capsids (lane 2) and virions (lane 4),
dmVP26-minus capsids (lane 3) and virions (lane 5), and standard size
markers (lane 1). The locations of the capsid proteins in the capsid
and virion profiles are indicated (*) to the left of lane 2 and to
the right of lane 5, respectively. The arrowheads indicate the expected
position of the missing VP26 protein in lanes 3 and 5. (b) Electron
cryomicroscopy (400 kV) images of ice-embedded dmVP26-minus virions.
|
|
Icosahedral reconstruction.
dmVP26-minus virions were purified
through Ficoll gradients (14). The purified virions were
embedded in vitreous ice suspended across holes in holey carbon grids
(10) (Fig. 1b). Electron microscopy, digitizing of the
images, 3D reconstruction, and correction of the contrast transfer
function were carried out as described previously (20). A
3D reconstruction to an effective resolution of 17 Å was obtained by
merging 918 particles selected from 33 micrographs. The structures
shown here are truncated to a lower resolution of 20 Å in order
to allow direct comparison with the previously published wild-type
HSV-1 virion reconstruction (20).
As had been found earlier for the wild-type virions, the bulk of the
envelope and tegument material has no icosahedral symmetry
and appeared
as unconnected masses surrounding the capsid (data
not shown). At a
density threshold of 1.2
these unconnected masses
disappear,
exposing the underlying capsid (Fig.
2).
As was seen
previously with wild-type virions (
20),
detectable tegument
material is confined to the vicinities of the
icosahedral fivefold
vertices and there is no suggestion of additional
sites of tegument
binding. The only obvious difference between the
wild-type and
dmVP26-minus capsids was seen at the top of each hexon,
where
a ring of density, corresponding to the six copies of VP26, is
missing from the dmVP26-minus map (Fig.
3). Apart from this, the
hexons appear to
be unchanged, and comparison of the pentons revealed
virtual identity
between the wild-type and dmVP26-minus structures.
In both cases the
attached tegument material is in the form of
five convoluted ribbons of
density, each extending radially outwards
from the upper domains of
neighboring penton subunits and making
contact with the peripentonal
triplex (Ta), the P hexon, and triplex
Tc (Fig.
3). Another feature
distinguishing virion capsids and
B capsids noted previously is the
closure of the penton channel,
and this is also a feature of the
dmVP26-minus reconstruction
(Fig.
3).
View larger version (145K):
[in this window]
[in a new window]
|
FIG. 2.
Visualization of icosahedrally ordered tegument in
dmVP26-minus virions. The dmVP26-minus virion reconstruction is
displayed at 1.2 standard deviations above mean density. At this
density threshold, only the icosahedrally ordered tegument densities
are visible. To generate this map, the five copies of tegument density
around one penton were first computationally isolated. These densities
were then replicated and rotated around the icosahedral symmetry axes
to the positions of the 11 other vertices to obtain a map containing
only tegument densities (blue). This map was then superimposed back
onto the dmVP26-minus virion reconstruction (gray). The unique
structural components of the capsid are labeled 5 (penton), P, C, E,
and Ta-Tf (icosahedrally unrelated hexons and triplexes,
respectively).
|
|
View larger version (122K):
[in this window]
[in a new window]
|
FIG. 3.
(a) Stereo pair of a computationally isolated portion of
the dmVP26-minus map shown in Fig. 2 that includes the penton (red), P
hexons (blue), triplexes Ta and Tc (green), and the icosahedrally
ordered tegument densities (yellow). (b) Stereo pair of the equivalent
portion of the wild-type HSV-1 map of Zhou et al. (20).
The arrowhead points to one of the six horn-shaped VP26 densities on
the top of each hexon. These densities are missing from the equivalent
positions on the dmVP26-minus map.
|
|
Role of VP26 in capsid-tegument interaction.
In an earlier
paper (20), it was suggested that the presence of VP26 in
the hexons might explain why tegument binds only to the vicinity of the
penton despite the presence elsewhere in the capsid of superficially
similar arrangements of capsomeres and triplexes. This suggestion was
based on the observation that the region of VP5, to which the tegument
binds on the penton, is already occupied on the hexons by VP26. The
near identity described here between the patterns of tegument-capsid
interaction seen in the presence or absence of VP26 clearly eliminates
the possibility that accessibility of the binding site is controlling
tegument attachment. The most likely explanation now seems to lie in
inherent differences in the nature of the upper domains of the penton
and hexon subunits, as evidenced by the differential binding patterns of certain monoclonal antibodies (17). Interestingly, the
3D structure of human cytomegalovirus (HCMV) virions has recently been
determined and shows a very different pattern of tegument-capsid interaction, with tegument binding extending to all of the hexons and
triplexes as well as the pentons (3). A similar pattern was described previously for simian cytomegalovirus (SCMV) cytoplasmic B capsids (15).
The tegument proteins involved in these interactions have not yet been
positively identified for HSV-1, HCMV, or SCMV. Comparisons
between the
protein profiles and 3D structures of SCMV nuclear
and cytoplasmic B
capsids led Trus et al. (
15) to propose the
119-kDa basic
phosphoprotein and the 69-kDa upper matrix protein
as possible
candidates. Neither of these two proteins has a counterpart
in HSV-1
(
2). However, the SCMV cytoplasmic B capsid protein
profile also contained the 205-kDa high-molecular-size protein,
which
is the SCMV counterpart of VP1-3 in HSV-1 (
15).
Previously,
we speculated that VP1-3 was the most likely candidate for
the
HSV-1 penton-associated tegument protein (
20). This
raises the
intriguing possibility that the association between tegument
and
penton is mediated through homologous proteins in HSV-1 (VP1-3)
and CMV (the high-molecular-weight protein), while that between
tegument and hexon, seen only in HCMV and SCMV, represents an
unrelated
association (presumably involving basic phosphoprotein
and upper matrix
protein) that has not been conserved between
the two virus subfamilies.
It has recently been demonstrated that
in HCMV the small capsid protein
is essential for virus growth
(
1), unlike its counterpart
(VP26) in HSV-1 (this paper and
reference
4). This led to
the suggestion that the small capsid
protein is involved in the
interaction between the tegument and
hexon (
1). If true,
this would support the conjecture by Wingfield
et al. (
19)
that the differential interaction of the small capsid
protein with
hexons and pentons might serve to expand the range
of functional
binding sites on the capsid surface. Further information
on the nature
of these various interactions and their roles in
the virus life cycle
awaits the accurate identification of the
proteins
involved.
| |
ACKNOWLEDGMENTS |
This research was supported by NIH grants (RO1AI38469 and P41RR02250).
| |
FOOTNOTES |
*
Corresponding author. Mailing address: MRC Virology
Unit, Institute of Virology, Church Street, Glasgow, United Kingdom,
G11 5JR. Phone: 44141 330 4025. Fax: 44141 337 2236. E-mail:
f.rixon{at}vir.gla.ac.uk.
| |
REFERENCES |
| 1.
|
Borst, E. M.,
S. Mathys,
M. Wagner,
W. Muranyi, and M. Messerle.
2001.
Genetic evidence of an essential role for cytomegalovirus small capsid protein in viral growth.
J. Virol.
75:1450-1458[Abstract/Free Full Text].
|
| 2.
|
Chee, M. S.,
A. T. Bankier,
S. Beck,
R. Bohni,
C. M. Brown,
R. Cerny,
T. Horsnell,
C. A. Hutchison,
T. Kouzarides,
J. A. Martignetti,
E. Preddie,
S. C. Satchwell,
P. Tomlinson,
K. M. Weston, and B. G. Barrell.
1990.
Analysis of the protein-coding content of the sequence of human cytomegalovirus strain AD169.
Curr. Top. Microbiol. Immunol.
154:125-169[Medline].
|
| 3.
|
Chen, D. H.,
H. Jiang,
M. Lee,
F. Y. Liu, and Z. H. Zhou.
1999.
Three-dimensional visualization of tegument/capsid interactions in the intact human cytomegalovirus.
Virology
260:10-16[CrossRef][Medline].
|
| 4.
|
Desai, P.,
N. A. DeLuca, and S. Person.
1998.
Herpes simplex virus type 1 VP26 is not essential for replication in cell culture but influences production of infectious virus in the nervous system of infected mice.
Virology
247:115-124[CrossRef][Medline].
|
| 5.
|
McGeoch, D. J.,
M. A. Dalrymple,
A. J. Davison,
A. Dolan,
M. C. Frame,
D. McNab,
L. J. Perry,
J. E. Scott, and P. Taylor.
1988.
The complete DNA sequence of the long unique region in the genome of herpes simplex virus type 1.
J. Gen. Virol.
69:1531-1574[Abstract/Free Full Text].
|
| 6.
|
Newcomb, W. W.,
B. L. Trus,
F. P. Booy,
A. C. Steven,
J. S. Wall, and J. C. Brown.
1993.
Structure of the herpes simplex virus capsid: molecular composition of the pentons and the triplexes.
J. Mol. Biol.
232:499-511[CrossRef][Medline].
|
| 7.
|
Rixon, F. J.
1993.
Structure and assembly of herpesviruses.
Semin. Virol.
4:135-144.
|
| 8.
|
Rixon, F. J.,
M. D. Davison, and A. J. Davison.
1990.
Identification of the genes encoding two capsid proteins of herpes simplex virus type 1 by direct amino acid sequencing.
J. Gen. Virol.
71:1211-1214[Abstract/Free Full Text].
|
| 9.
|
Saad, A.,
Z. H. Zhou,
J. Jakana,
W. Chiu, and F. J. Rixon.
1999.
Roles of triplex and scaffolding proteins in herpes simplex virus type 1 capsid formation suggested by structures of recombinant particles.
J. Virol.
73:6821-6830[Abstract/Free Full Text].
|
| 10.
|
Schrag, J. D.,
B. V. V. Prasad,
F. J. Rixon, and W. Chiu.
1989.
Three-dimensional structure of the HSV-1 nucleocapsid.
Cell
56:651-660[CrossRef][Medline].
|
| 11.
|
Steven, A. C.,
C. R. Roberts,
J. Hay,
M. E. Bisher,
T. Pun, and B. L. Trus.
1986.
Hexavalent capsomers of herpes simplex virus type-2: symmetry, shape, dimensions, and oligomeric status.
J. Virol.
57:578-584[Abstract/Free Full Text].
|
| 12.
|
Steven, A. C., and P. G. Spear.
1997.
Herpesvirus capsid assembly and envelopment, p. 312-351.
In
W. Chiu, R. M. Burnett, and R. Garcea (ed.), Structural biology of viruses. Oxford University Press, New York, N.Y.
|
| 13.
|
Stow, N. D.,
O. Hammarsten,
M. I. Arbuckle, and P. Elias.
1993.
Inhibition of herpes-simplex virus type-1 DNA-replication by mutant forms of the origin-binding protein.
Virology
196:413-418[CrossRef][Medline].
|
| 14.
|
Szilagyi, J. F., and C. Cunningham.
1991.
Identification and characterization of a novel non-infectious herpes simplex virus-related particle.
J. Gen. Virol.
72:661-668[Abstract/Free Full Text].
|
| 15.
|
Trus, B. L.,
W. Gibson,
N. Q. Cheng, and A. C. Steven.
1999.
Capsid structure of simian cytomegalovirus from cryoelectron microscopy: evidence for tegument attachment sites.
J. Virol.
73:2181-2192[Abstract/Free Full Text].
|
| 16.
|
Trus, B. L.,
F. L. Homa,
F. P. Booy,
W. W. Newcomb,
D. R. Thomsen,
N. Cheng,
J. C. Brown, and A. C. Steven.
1995.
Herpes simplex virus capsids assembled in insect cells infected with recombinant baculoviruses: structural authenticity and localization of VP26.
J. Virol.
69:7362-7366[Abstract].
|
| 17.
|
Trus, B. L.,
W. W. Newcomb,
F. P. Booy,
J. C. Brown, and A. C. Steven.
1992.
Distinct monoclonal antibodies separately label the hexons or the pentons of herpes simplex virus capsid.
Proc. Natl. Acad. Sci. USA
89:11508-11512[Abstract/Free Full Text].
|
| 18.
|
Wildy, P.,
W. C. Russell, and R. W. Horne.
1960.
The morphology of herpes virus.
Virology
12:204-222[CrossRef][Medline].
|
| 19.
|
Wingfield, P. T.,
S. J. Stahl,
D. R. Thomsen,
F. L. Homa,
F. P. Booy,
B. L. Trus, and A. C. Steven.
1997.
Hexon-only binding of VP26 reflects differences between the hexon and penton conformations of VP5, the major capsid protein of herpes simplex virus.
J. Virol.
71:8955-8961[Abstract].
|
| 20.
|
Zhou, Z. H.,
D. H. Chen,
J. Jakana,
F. J. Rixon, and W. Chiu.
1999.
Visualization of tegument-capsid interactions and DNA in intact herpes simplex virus type 1 virions.
J. Virol.
73:3210-3218[Abstract/Free Full Text].
|
| 21.
|
Zhou, Z. H.,
M. Dougherty,
J. Jakana,
J. He,
F. J. Rixon, and W. Chiu.
2000.
Seeing the herpesvirus capsid at 8.5 Å.
Science
288:877-880[Abstract/Free Full Text].
|
| 22.
|
Zhou, Z. H.,
J. He,
J. Jakana,
J. D. Tatman,
F. J. Rixon, and W. Chiu.
1995.
Assembly of VP26 in herpes simplex virus-1 inferred from structures of wild-type and recombinant capsids.
Nat. Struct. Biol.
2:1026-1030[CrossRef][Medline].
|
| 23.
|
Zhou, Z. H.,
B. V. V. Prasad,
J. Jakana,
F. J. Rixon, and W. Chiu.
1994.
Protein subunit structures in the herpes simplex virus A-capsid determined from 400 kV spot-scan electron cryomicroscopy.
J. Mol. Biol.
242:456-469[CrossRef][Medline].
|
Journal of Virology, December 2001, p. 11863-11867, Vol. 75, No. 23
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.23.11863-11867.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Newcomb, W. W., Brown, J. C.
(2009). Time-Dependent Transformation of the Herpesvirus Tegument. J. Virol.
83: 8082-8089
[Abstract]
[Full Text]
-
Perkins, E. M., Anacker, D., Davis, A., Sankar, V., Ambinder, R. F., Desai, P.
(2008). Small Capsid Protein pORF65 Is Essential for Assembly of Kaposi's Sarcoma-Associated Herpesvirus Capsids. J. Virol.
82: 7201-7211
[Abstract]
[Full Text]
-
Yu, X., Shah, S., Atanasov, I., Lo, P., Liu, F., Britt, W. J., Zhou, Z. H.
(2005). Three-Dimensional Localization of the Smallest Capsid Protein in the Human Cytomegalovirus Capsid. J. Virol.
79: 1327-1332
[Abstract]
[Full Text]
-
Douglas, M. W., Diefenbach, R. J., Homa, F. L., Miranda-Saksena, M., Rixon, F. J., Vittone, V., Byth, K., Cunningham, A. L.
(2004). Herpes Simplex Virus Type 1 Capsid Protein VP26 Interacts with Dynein Light Chains RP3 and Tctex1 and Plays a Role in Retrograde Cellular Transport. J. Biol. Chem.
279: 28522-28530
[Abstract]
[Full Text]
-
Yu, X.-K., O'Connor, C. M., Atanasov, I., Damania, B., Kedes, D. H., Zhou, Z. H.
(2003). Three-Dimensional Structures of the A, B, and C Capsids of Rhesus Monkey Rhadinovirus: Insights into Gammaherpesvirus Capsid Assembly, Maturation, and DNA Packaging. J. Virol.
77: 13182-13193
[Abstract]
[Full Text]
-
Lo, P., Yu, X., Atanasov, I., Chandran, B., Zhou, Z. H.
(2003). Three-Dimensional Localization of pORF65 in Kaposi's Sarcoma-Associated Herpesvirus Capsid. J. Virol.
77: 4291-4297
[Abstract]
[Full Text]
-
Lai, L., Britt, W. J.
(2003). The Interaction between the Major Capsid Protein and the Smallest Capsid Protein of Human Cytomegalovirus Is Dependent on Two Linear Sequences in the Smallest Capsid Protein. J. Virol.
77: 2730-2735
[Abstract]
[Full Text]
-
Cheng, N., Trus, B. L., Belnap, D. M., Newcomb, W. W., Brown, J. C., Steven, A. C.
(2002). Handedness of the Herpes Simplex Virus Capsid and Procapsid. J. Virol.
76: 7855-7859
[Abstract]
[Full Text]
Top
Abstract
Text
