Previous Article | Next Article 
Journal of Virology, December 2001, p. 11651-11663, Vol. 75, No. 23
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.23.11651-11663.2001
Vaccinia Virus Intracellular Movement Is Associated
with Microtubules and Independent of Actin Tails
Brian M.
Ward and
Bernard
Moss*
Laboratory of Viral Diseases, National
Institute of Allergy and Infectious Diseases, National Institutes
of Health, Bethesda, Maryland 20892-0445
Received 24 July 2001/Accepted 29 August 2001
 |
ABSTRACT |
Two mechanisms have been proposed for the intracellular movement of
enveloped vaccinia virus virions: rapid actin polymerization and
microtubule association. The first mechanism is used by the intracellular pathogens Listeria and
Shigella, and the second is used by cellular vesicles
transiting from the Golgi network to the plasma membrane. To
distinguish between these models, two recombinant vaccinia viruses that
express the B5R membrane protein fused to enhanced green fluorescent
protein (GFP) were constructed. One had Tyr112 and
Tyr132 of the A36R membrane protein, which are required for
phosphorylation and the nucleation of actin tails, conservatively
changed to Phe residues; the other had the A36R open reading frame
deleted. Although the Tyr mutant was impaired in Tyr phosphorylation
and actin tail formation, digital video and time-lapse confocal
microscopy demonstrated that virion movement from the juxtanuclear
region to the periphery was saltatory with maximal speeds of >2 µm/s
and was inhibited by the microtubule-depolymerizing drug nocodazole.
Moreover, this actin tail-independent movement was indistinguishable
from that of a control virus with an unmutated A36R gene and closely
resembled the movement of vesicles on microtubules. However, in the
absence of actin tails, the Tyr mutant did not induce the formation of
motile, virus-tipped microvilli and had a reduced ability to spread
from cell to cell. The deletion mutant was more severely impaired,
suggesting that the A36R protein has additional roles. Optical sections
of unpermeabilized, B5R antibody-stained cells that expressed GFP-actin
and were infected with wild-type vaccinia virus revealed that all actin
tails were associated with virions on the cell surface. We concluded
that the intracellular movement of intracellular enveloped virions
occurs on microtubules and that the motile actin tails enhance
extracellular virus spread to neighboring cells.
 |
INTRODUCTION |
The infectious forms of some
enveloped viruses are assembled at the plasma membrane, providing
direct access to the extracellular environment. Other viruses, however,
are assembled in the nucleus or internal regions of the cytoplasm and
require locomotion to reach the periphery of the cell. Such movement is
likely to involve the actin or microtubule cytoskeleton
(28). Infectious intracellular mature vaccinia virus
virions (IMV) form in juxtanuclear factory regions of the cytoplasm
(5, 19) and are wrapped by a double membrane derived from
trans-Golgi or endosomal cisternae to become intracellular enveloped
virions (IEV), which are then translocated to the periphery of the cell
where the outer IEV and plasma membranes fuse (12, 15, 19, 26,
31). The plasma membrane adherent and the released extracellular
virions are called cell-associated enveloped virions (CEV) and
extracellular enveloped virions (EEV), respectively. The association of
actin filaments with CEV at the tips of specialized microvilli has been
appreciated since the early electron and immunofluorescence microscopic
studies of Stokes (29) and Hiller et al.
(13). Using video microscopy, Cudmore et al.
(3) reported that IEV were propelled through the cytoplasm on the tips of actin tails, much like the intracellular pathogens Listeria, Shigella, and Rickettsia
(2). In a series of elegant experiments, Way and coworkers
(9, 18) identified viral and cellular proteins involved in
actin nucleation. Nevertheless, actin tail formation cannot entirely
account for the movement of IEV, since deletion of any one of three IEV
membrane proteins (A33R, A34R, or A36R) prevented the formation of
actin tails and specialized microvilli but did not block the formation
of extracellular virions (22, 24, 36, 38). Moreover, by
visualizing the movement of a recombinant vaccinia virus (vB5R-GFP)
that expressed the IEV membrane protein B5R fused to enhanced green
fluorescent protein (GFP), we provided evidence that IEV were
transported from the juxtanuclear region to the periphery via
microtubules (34). This conclusion was based on the
maximal speed (2.5 µm/s) and saltatory motion of the IEV, which was
reversibly halted by the microtubule-depolymerizing drug nocodazole.
The present study was designed to directly visualize IEV movement under
conditions in which actin tails could not form. Because actin filaments
are intimately involved with microtubule function (11), we
avoided the use of drugs, which might have broad effects. Instead, we
constructed a novel vaccinia virus mutant with a specific block in
actin tail nucleation. The target of the mutation was the A36R gene,
which encodes a type Ib integral membrane protein component of the
outer IEV membrane that is required for actin tails (20, 23, 24,
32, 38, 39). Transfection and in vitro binding studies indicated
that nucleation of actin is regulated by phosphorylation of
Tyr112 alone or in conjunction with
Tyr132 located in the cytoplasmic domain of the
A36R protein (9). We therefore constructed two vaccinia
virus mutants, both of which expressed B5R-GFP to visualize IEV
movement. In one mutant (vB5R-GFP/A36R-YdF), the codons for
Tyr112 and Tyr132 of A36R
were both conservatively changed to Phe. The other mutant
(vB5R-GFP/
A36R) had a deletion of nearly the entire A36R gene. Both
mutants were characterized with regard to A36R expression, Tyr
phosphorylation, virus assembly, intracellular movement, and
cell-to-cell spread. Despite the absence of Tyr phosphorylation and an
inability to form actin tails or specialized microvilli, confocal and
digital video microscopy revealed that the intracellular movement of
vB5R-GFP/A36R-YdF was unimpaired. Nevertheless, the plaques formed by
vB5R-GFP/A36R-YdF were smaller than those of vB5R-GFP. These results,
and our demonstration that virions associated with actin tails and
microvilli are external to the plasma membrane, support the idea that
the primary role of actin tails is to facilitate virus spread.
vB5R-GFP/
A36R exhibited a more impaired phenotype than
vB5R-GFP/A36R-YdF, suggesting that the A36R protein may have an
additional structural or functional role.
 |
MATERIALS AND METHODS |
Construction of B5R-GFP viruses.
Construction of vaccinia
viruses vB5R-GFP and v
A36R and the plasmid pB5R-GFP, containing the
B5R open reading frame (ORF) fused to GFP sequences and approximately
500 bp of flanking sequence on each side, have been previously
described (20, 33, 34). pB5R-GFP was transfected with
Lipofectamine (Invitrogen) into HeLa cells that had been infected with
v
A36R (35). Recombinant viruses that formed green
fluorescent foci were plaque purified three times. Proper insertion of
the ORF for B5R-GFP into the final recombinant (vB5R-GFP/
A36R) was
confirmed by PCR.
The primers TGTCGACTAACGTACGCCGCCATG and
TAAGCTTGAATACAGACAACGGCAAA were used to amplify
the A36R ORF plus 500 bp of flanking sequence on each side and to add a
HindIII site and a SalI site (underlined).
The amplified product was cloned into pGEM-T to yield pBMW-32T and
sequenced. The coding sequence of A36R was changed so that Phe instead
of Tyr residues were encoded at residues 112 and 132, using two-stage
PCR with plasmid pBMW32-T as the template. The following primer pairs
were used to amplify three overlapping fragments:
CAACTGAGTCAAAAATGTGTTCTGTGCTAGG and M13 reverse (Promega),
CATTTTTGACTCAGTTGCTGGAAGCACGCTG and
GTTCTGGAAAATAGTCTGTTCATTACGATC, and
CAGACTATTTTCCAGAAACACTACAGTAGTAA and M13 forward (Promega). The resulting amplified products were purified and joined together by a
fourth amplification, and the resulting product was cloned into pGEM-T
and sequenced. Subsequently, the mutated A36R coding sequence plus 500 bp of flanking sequence was excised from pGEM-T by digestion with
HindIII-SalI and ligated into similarly
cleaved pBSgptgus (16) to yield pBMW33-BSgptgus.
Recombination was used to insert the mutated A36R-coding sequence into
the deleted A36R site of vB5R-GFP/
A36R, and the new recombinant
virus was isolated by transient dominant selection, essentially as
described previously (16). HeLa cells were infected at a
multiplicity of 0.05 with vB5R-GFP/
A36R and transfected 2 h
later with pBMW33-Bsgptgus as described previously (35).
After 2 days, cells were harvested, frozen and thawed three times, and
used to infect BS-C-1 cells that were treated with mycophenolic acid
(MPA), xanthine, and hypoxanthine at concentrations of 25, 250, and 15 µg per ml, respectively. Recombinant viruses that resulted from a
single crossover would have the entire plasmid integrated into the
viral genome and consequently would be resistant to MPA and positive
for
-glucuronidase (GUS). MPA-resistant and GUS-positive viruses
were plaque purified twice in the presence of MPA before three more
plaque purifications in the absence of MPA to obtain the desired
double-crossover mutant. X-Gluc
(5-bromo-4-chloro-3-indolyl-
-D-glucuronic
acid) staining was used to confirm the absence of the gus
gene, and PCR amplification and sequencing were used to confirm the
insertion of the mutated A36R ORF.
Cells.
HeLa and BS-C-1 cell monolayers were grown in
Dulbecco's modified Eagle's medium (DMEM) and Earle's minimum
essential medium (Quality Biologicals), respectively, supplemented with
10% fetal bovine serum. HeLa cells were transfected with pEGFP-actin
(Clontech) and Lipofectamine and selected with Geneticin (Invitrogen)
as suggested by the manufacturer. Isolated green fluorescent colonies were screened by staining with rhodamine-phalloidin to determine the
levels of GFP-actin expression. Stable cell lines were maintained in
DMEM supplemented with 10% fetal bovine serum and 50 µg of Geneticin
per ml.
Virus replication and plaque assay.
All recombinant viruses
were derived from the WR strain. Virus was propagated in HeLa cells,
and plaque assays were carried out in BS-C-1 cells using standard
procedures. Images were obtained at 3 days after infection using a
Leica DMIRBE inverted fluorescence microscope with a cooled
charged-coupled device (Princeton Instruments) that was controlled
using Image Pro software. After imaging, cells were stained with
crystal violet, rinsed with water, and allowed to air dry. Stained
plates were imaged with a Kodak Image Station 440cf using Kodak 1D
Image Analysis software (Kodak Digital Science), and the areas of at
least 140 well-separated plaques for each virus were measured in square
pixels using the same software. Average plaque sizes and standard
deviations were calculated using Microsoft Excel.
To measure virus replication and spread, BS-C-1 cells were inoculated
at a multiplicity of 0.01 for 2 h and then washed twice with fresh
growth medium to remove unabsorbed virus. At various times after
infection, the medium was removed from each well and clarified by
low-speed centrifugation to remove detached cells and debris. The
adherent cells were scraped into 1 ml of fresh medium and combined with
the cell pellet from the clarified medium. The cells were suspended by
vortexing, frozen and thawed three times, and then sonicated to release
virus. Titers of virus in the cell lysate and the medium were
determined in duplicate by plaque assay on BS-C-1 cells.
Virus purification.
For radioactive labeling and CsCl
purification of virus, monolayers of RK13 cells
were infected at a multiplicity of 10. After 2 h, the inoculum was
removed and replaced with normal medium. At 4 h after infection,
the medium was replaced with methionine- and cysteine-free DMEM
(Invitrogen) to which 2.5% dialyzed fetal bovine serum (Invitrogen)
and 500 µCi of a mixture of [35S]methionine
and [35S]cysteine (Easy Tag; Amersham) had been
added. At 18 h after infection, the medium was harvested and cells
and large debris were removed by low-speed centrifugation. Cells were
dislodged by scraping, collected by low-speed centrifugation,
resuspended in swelling buffer (10 mM Tris, pH 10), incubated on ice
for 10 min, disrupted by Dounce homogenization, and clarified by
low-speed centrifugation. Virus from the cell lysate and from the
medium was centrifuged through a 36% sucrose cushion, resuspended in swelling buffer with sonication, and banded on a preformed CsCl step
gradient as previously described (7). Gradients were
fractionated from the bottom of the tube, and the amount of radiation
present in each fraction was determined by scintillation counting.
Syncytium formation.
HeLa cells were infected at a
multiplicity of 10. After 15 h, the cells were washed with pH 7.4 phosphate-buffered saline (PBS) and then incubated for 2 min in either
fusion buffer [PBS with 10 mM
2-(N-morpholino)ethanesulfonic acid and 10 mM HEPES at pH
5.5] or control buffer (PBS at pH 7.4). The buffers were replaced with
DMEM growth medium and incubated for 3 h before analysis with a
Leica DMIRBE inverted fluorescence microscope as described above.
Electron microscopy.
For immunoelectron microscopy,
RK13 cells were grown in 60-mm-diameter dishes
and infected with vaccinia virus at a multiplicity of 10. After 24 h, the cells were prepared for freezing as previously described
(37) except that the final fixation step was in 8% paraformaldehyde (37). Ultrathin sections were cut,
collected, immunostained, and viewed as previously described
(4). The GFP polyclonal antibody (Clontech) was used at a
dilution of 1:75.
For scanning electron microscopy, RK13 cells were
grown on coverslips and infected at a multiplicity of 10 overnight
before being fixed with 2% glutaraldehyde in 0.1 M sodium cacodylate (pH 7.4). Fixed cells were washed in cacodylate buffer, postfixed with
1% osmium tetroxide, and dehydrated in ethanol. After dehydration, samples were critical point dried, mounted on stubs, coated with gold-palladium alloy, and viewed on a Hitachi S-4700 field emission scanning electron microscope at an accelerating voltage of 3 kV.
Western blotting.
HeLa cells were infected with 5 PFU of
virus per cell and incubated overnight. At 18 h after infection,
cells were harvested by replacing the medium with lysis buffer (100 mM
Tris [pH 8.0], 2% sodium dodecyl sulfate [SDS], 0.4 mM sodium
orthovanadate, and 0.2 mM phenylmethylsulfonyl fluoride) followed by
several passages through a syringe to shear DNA. Lysates were mixed
with protein loading buffer, resolved by electrophoresis on an SDS-10 to 20% polyacrylamide gel (Invitrogen), and transferred to a
nitrocellulose membrane. Membranes were incubated with anti-P-Tyr
monoclonal antibody (MAb) clone 4G10 (Upstate Biotechnology) followed
by horseradish peroxidase-conjugated sheep anti-mouse antibody
(Amersham). Bound antibodies were detected with chemiluminescence
reagents (Pierce) as directed by the manufacturer. Following detection, the blot was stripped with 10 mM 2-mercaptoethanol-2% SDS in 62.5 mM
Tris (pH 6.9), blocked, and incubated with polyclonal antibody to the
A36R protein followed by horseradish peroxidase-conjugated donkey
anti-rabbit antibody (Amersham). Bound antibodies were detected as
described above.
Fluorescence microscopy of fixed cells.
HeLa cells were
grown to confluence on coverslips and infected at a multiplicity of 1. Infected cells were fixed with 4% paraformaldehyde and permeabilized
with Triton X-100, both in PBS. Actin filaments were stained with
rhodamine-conjugated phalloidin (Molecular Probes), and coverslips were
mounted in mowoil which contained 1 µg of 4',6-diamidino-2-phenylindole dihydrochloride (DAPI) (Molecular Probes)
per ml to visualize DNA in the nucleus and viral factories. Images were
collected on a Leica TCS-NT/SP inverted confocal microscope system with
an attached argon ion laser (Coherent Inc.). Images were overlaid using
Adobe PhotoShop version 6.0. In order to determine the percentage of
cells containing actin tails, at least 200 infected cells from each of
four separate experiments were scored for the presence of one or more
actin tails.
For analysis of the association of vaccinia virus with actin tails,
HeLa cells stably expressing GFP-actin were infected and fixed as
described above but without permeabilization. Fixed cells were stained
with anti-B5R MAb 19C2 (26) followed by indodicarbocyanine (Cy5)-conjugated goat anti-rat secondary antibody (Jackson
ImmunoResearch Laboratories). Hoechst dye was included in the first of
three washes with PBS before mounting coverslips and sealing with
rubber cement. Cells were imaged by confocal microscopy as described above, and Z-series were processed using Imaris 3.0.2 (Bitplane AG) and
Adobe Photoshop.
Fluorescence microscopy of live cells.
HeLa cells were
plated at
80% confluence onto
TC3 dishes (Bioptechs, Inc.), and
on the next day they were infected with 0.2 PFU of virus per cell. On
the following day, cells were imaged by digital video microscopy using
a Hammumatsu C5985 camera and controller that was attached to a Leica
DMIRBE inverted fluorescence microscope. Images were digitized using an
ICPCI video capture card controlled by Image Pro Plus software. During
imaging, cells were maintained on a heated
TC3 stage (Bioptechs)
with the temperature set at 35°C. Fresh medium supplemented with
2.5% fetal calf serum and 25 mM HEPES was perfused onto the dish at a
rate of 0.1 ml/min throughout the experiment using a P720 peristaltic
pump (Instech Laboratories). Velocities of virion movement were
calculated using the public-domain software NIH Image 1.62 developed at
the National Institutes of Health (available at
http://rsb.info.nih.gov/nih-image/).
 |
RESULTS |
Construction of recombinant vaccinia viruses, with a deleted or
mutated A36R gene, that express B5R-GFP.
We constructed two new
A36R vaccinia virus mutants, both of which expressed B5R-GFP. Having
shown that B5R-GFP could functionally replace the endogenous copy of
B5R (34), we similarly modified a previously characterized
A36R deletion mutant (v
A36R) (20, 24, 38). HeLa cells
were infected with the v
A36R virus and transfected with a plasmid
containing B5R-GFP and B5R flanking sequences including the natural B5R
promoter. Recombinant viruses forming green fluorescent plaques were
easily identified using an inverted fluorescence microscope without the
need for selection. Individual recombinants were further plaque
purified and screened by PCR to confirm the presence of the ORF
encoding the B5R fusion protein and the absence of the wild-type B5R
ORF (data not shown). The resulting virus was named vB5R-GFP/
A36R.
Transient dominant selection (8) was used to insert the
mutated A36R ORF with Phe codons substituted for
Tyr112 and Tyr132 codons
into the A36R deletion site of vB5R-GFP/
A36R. There were several
advantages to this approach. Starting with a small-plaque-forming A36R
deletion mutant was preferable to starting with one that formed large
plaques, which might obscure those of the new mutant. In addition,
because the selection and marker genes used for transient dominant
selection were not stably integrated into the viral genome, the final
recombinant virus had the mutated A36R gene in its usual position under
the regulation of its natural promoter with no adjacent reporter genes.
HeLa cells were infected with vB5R-GFP/
A36R and then transfected
with pBMW33-BSgptgus, which contained the gpt and
gus genes under the control of vaccinia virus promoters adjacent to the mutated A36R ORF and flanking sequences. Plaques were
picked in the presence of MPA to select for single-crossover MPA-resistant, GUS-positive recombinant viruses and then in the absence
of MPA to isolate viruses that had lost the marker genes by a second
recombination event. GUS-negative recombinant viruses were screened by
PCR for the presence of the mutated A36R-coding sequence, and one,
vB5R-GFP/A36R-YdF, was amplified and further characterized.
Plaque phenotypes of mutant viruses.
Plaques of vaccinia virus
strains WR, v
A36R, vB5R-GFP, vB5R-GFP/
A36R, and vB5R-GFP/A36R-YdF
were compared using a methylcellulose overlay to prevent the formation
of satellites. Under these conditions, plaque size is determined by
direct cell-to-cell spread. As previously shown (34),
standard vaccinia virus strain WR and vB5R-GFP plaques were of similar
size and appearance, consistent with the normal function of the B5R-GFP
fusion protein (Fig. 1). Likewise, the recombinant vB5R-GFP/
A36R formed tiny plaques like those of the parental v
A36R (Fig. 1). The vB5R-GFP/A36R-YdF plaques, however, were intermediate between those containing an intact A36R ORF and those
with A36R deleted (Fig. 1). These differences were quantified by
measuring the areas of at least 140 plaques formed by each of the five
different viruses. The vB5R-GFP/A36R-YdF plaques were about one-third
of the size of those formed by viruses having an intact A36R ORF but
were sevenfold larger than those formed by the A36R deletion mutant
(Fig. 1). The larger plaque size of the Tyr mutant relative to the
deletion mutant indicated a greater impairment of virus lacking the
entire A36R ORF. As expected, the plaques of the three recombinant
viruses expressing B5R-GFP were fluorescent (Fig. 1).

View larger version (101K):
[in this window]
[in a new window]
|
FIG. 1.
Plaque phenotypes. The indicated viruses were plated on
monolayers of BS-C-1 cells. After 3 days, plaques were imaged using
light and fluorescence microscopy and then stained with crystal violet.
Areas of at least 140 individual plaques for each of the five viruses
were determined, and the averages and standard deviations (in
parentheses) were calculated. BF, bright field.
|
|
Effects of A36R mutations on low-pH-induced syncytium
formation.
The ability of vaccinia virus-infected cells to undergo
fusion by a brief exposure to low pH is due to the presence of virions on the cell surface and frequently correlates with plaque size (1, 6, 10, 35). We tested the ability of the three
recombinant B5R-GFP viruses to mediate the induction of low-pH-induced
fusion. HeLa cells were infected for 15 h and then incubated for 2 min at either pH 5.5 or 7.4 and for an additional 3 h in standard medium. Uninfected cells and infected cells treated with pH 7.4 buffer
showed no signs of cell fusion (Fig. 2).
In contrast, cells infected with either vB5R-GFP or vB5R-GFP/A36R-YdF
showed extensive cell fusion and formed large syncytia when treated
with pH 5.5 buffer (Fig. 2). Cells infected with vB5R-GFP/
A36R,
however, showed less extensive fusion with few or no large
polykaryons (Fig. 2), in agreement with previous analyses of an A36R
deletion mutant without the B5R-GFP gene (24, 38). Thus,
the difference in plaque sizes of vB5R-GFP/
A36R and
vB5R-GFP/A36R-YdF correlated with their efficiency in forming syncytia.

View larger version (141K):
[in this window]
[in a new window]
|
FIG. 2.
Induction of syncytia. Uninfected or infected HeLa cells
were incubated for 15 h, briefly treated with buffer at pH 7.4 or
5.5, and then incubated in regular medium for 3 h. The cells were
examined by phase-contrast microscopy. Recombinant viruses used for
infection are indicated on the left.
|
|
Replication of recombinant viruses.
Replication of the mutant
viruses was compared over a 5-day period following a low-multiplicity
infection chosen to emphasize virus spread. As is typical of viruses
derived from the WR strain, much of the infectivity remained cell
associated even after the long period. As seen in the log plots,
vB5R-GFP/
A36R replicated much more slowly than the others, while
vB5R-GFP/A36R-YdF lagged slightly behind vB5R-GFP under these
conditions (Fig. 3).

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 3.
Virus replication. BS-C-1 cells were infected with 0.01 PFU of the indicated viruses per cell. Virus titers in the medium (A)
and cell lysates (B) were determined by plaque assay.
|
|
To further examine particle formation, cells infected with recombinant
viruses were incubated in medium containing
[35S]methionine and
[35S]cysteine from 4 h on, when host
protein synthesis is largely inhibited. Particles present in the medium
and extracted from lysed cells were analyzed by CsCl density gradient
centrifugation to distinguish IMV from wrapped virions (IEV,
CEV, or EEV). When vB5R-GFP and vB5R-GFP/A36R-YdF were
compared, there was little difference between the ratios of IMV to
wrapped virus extracted from cells (Fig.
4). In contrast, there was much less
wrapped vB5R-GFP/
A36R (Fig. 4). Virtually no IMV and relatively
small numbers of wrapped virus particles were detected in the medium, with those from vB5R-GFP being the most abundant (Fig. 4).

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 4.
Isolation of IMV and wrapped viruses. RK13
cells were infected at a multiplicity of 10 with the indicated
recombinant viruses. From 4 to 18 h after infection, the cells
were labeled with 500 µCi of a mixture of
[35S]methionine and [35S]cysteine.
Particles in the medium and cell lysates were concentrated by
sedimentation through a sucrose cushion, applied to CsCl density
gradients, and centrifuged. The amounts of radioactive material in the
fractions were determined by scintillation counting.
|
|
Effects of A36R mutations on the formation of virus particles
determined by transmission and scanning electron microcopy.
Cells
infected with recombinant viruses were examined by transmission
electron microscopy to determine the effects of the mutations on the
intracellular forms of virus. All stages of virus assembly were
detected in each case, although there were noticeably fewer IEV with
vB5R-GFP/
A36R. The IEV membranes were specifically labeled using an
antibody to GFP followed by protein A-conjugated gold particles, which
demonstrated the presence of the B5R-GFP fusion protein in these
membranes (Fig. 5).

View larger version (72K):
[in this window]
[in a new window]
|
FIG. 5.
Immunoelectron microscopy of infected cells.
RK13 cells were infected with 10 PFU of vB5R-GFP (A),
vB5R-GFP/ A36R (B), or vB5R-GFP/A36R-YdF (C) per cell. After 24 h, the cells were fixed, cryosectioned, and incubated successively with
polyclonal anti-GFP antibody and 10-nm-diameter gold particles
conjugated to protein A. Bar, 500 nm.
|
|
Cells infected with vaccinia virus produce thick specialized microvilli
projecting from their cell surface (13, 29). These projections are tipped with virions and can be visualized by scanning electron microscopy. Using this technique, virus-tipped projections of
about 0.3 µm in diameter were seen on the surfaces of cells infected
with vB5R-GFP (Fig. 6A). In contrast,
only slender microvilli of about 0.1 µm were present on the surfaces
of uninfected cells or cells infected with vB5R-GFP/
A36R or
vB5R-GFP/A36R-YdF (Fig. 6B, C, and D). Nevertheless, the surfaces of
cells infected with each of the viruses contained brick-shaped virions,
which were absent from the uninfected cells. Thus, both
vB5R-GFP/
A36R and vB5R-GFP/A36R-YdF exhibited a specific defect in
the formation of specialized microvilli.

View larger version (124K):
[in this window]
[in a new window]
|
FIG. 6.
Scanning electron microscopy of infected cells.
RK13 cells were infected with 10 PFU of vB5R-GFP (A),
vB5R-GFP/ A36R (B), or vB5R-GFP/A36R-YdF (C) per cell or were
uninfected (D). After 16 h, the cells were fixed, coated with
gold-palladium alloy, and viewed with an Hitachi S-4700 field emission
scanning electron microscope at an accelerating voltage of 3 kV. Thick
arrows, virus-tipped specialized microvilli; thin arrows, slender
cellular microvilli; arrowheads, virions on the cell surface. Bar, 1 µm.
|
|
A36R Tyr phosphorylation.
Tyr112 and
Tyr132 were identified as the phosphorylation
sites of the A36R protein by transfection experiments (9).
The generation of a mutant vaccinia virus with these two Tyr residues mutated allowed us to investigate phosphorylation under more natural infection conditions. Proteins from lysates of uninfected cells or
cells infected with recombinant viruses were resolved by
SDS-polyacrylamide gel electrophoresis, blotted onto nitrocellulose,
and probed with an antibody against P-Tyr. In addition to
high-molecular-weight and other bands common to all samples, a
prominent band below the 46-kDa marker was unique to cells infected
with vB5R-GFP, the only virus with an intact, unmutated A36R gene (Fig.
7). To confirm that the unique P-Tyr band
corresponded to A36R and that vB5R-GFP/A36R-YdF expressed the A36R
protein, the blot was stripped and reprobed with anti-A36R antibody
(Fig. 7). A background band was present at the position of the 46-kDa
marker in all lanes. However, the A36R protein corresponding in
position to the unique P-Tyr band was found in the lane containing the
vB5R-GFP extract. The mutated A36R protein migrated slightly faster
than wild-type A36R but was expressed at a similar level. These data
indicated that mutation of Tyr112 and
Tyr132 of the A36R protein prevented Tyr
phosphorylation of the residues recognized by the 4G10 antibody.

View larger version (80K):
[in this window]
[in a new window]
|
FIG. 7.
Tyrosine phosphorylation of the A36R protein. Infected
or mock-infected HeLa cells were incubated for 18 h, harvested,
and analyzed by SDS-polyacrylamide gel electrophoresis and Western
blotting with a P-Tyr-specific MAb ( P-Tyr). After detection of
P-Tyr, the blot was stripped and reprobed with polyclonal antibody to
the A36R protein ( A36R). The arrow marks the position of the
Tyr-phosphorylated A36R protein. Positions and masses (in kilodaltons)
of marker proteins are shown on the left.
|
|
Effects of A36R mutations on formation of actin tails.
Evidence that Tyr phosphorylation was required to nucleate actin tails
had previously been obtained by a complementation experiment in which
plasmids containing wild-type or mutated A36R ORFs were transfected
into cells infected with an A36R deletion mutant and then the fixed
cells were stained with phalloidin (9). We confirmed those
results by carrying out similar transfection-infection experiments in a
cell line that stably expressed GFP-actin. Videos showing formation and
movement of actin tails when a plasmid containing the intact A36R ORF
was transfected but not after transfection with a plasmid containing a
mutated A36R ORF, with Phe substituted for Tyr112
and Tyr132, are provided as Supplemental
Material no. 1 at
http://www.niaid.nih.gov/dir/labs/lvd/moss.htm. In Fig.
8, we show results obtained by infecting
cells with vB5R-GFP, vB5R-GFP/
A36R, or vB5R-GFP/A36R-YdF and
staining with rhodamine-phalloidin in order to visualize actin tails.
The infected cells were also stained with DAPI to discern nuclei and
DNA-containing viral factory areas. Examination of cells infected with
vB5R-GFP revealed numerous red actin tails attached to green
fluorescent particles (Fig. 8A). In contrast, actin tails were not seen
in cells infected with vB5R-GFP/
A36R (Fig. 8B) and were rare in
cells infected with vB5R-GFP/A36R-YdF (Fig. 8C). These data were
quantified by determining the percentage of infected cells that
contained one or more actin tails (Fig. 8D). Therefore, mutation of
Tyr112 and Tyr132 of A36R
was sufficient to inhibit actin tail formation by vB5R-GFP/A36R-YdF.

View larger version (86K):
[in this window]
[in a new window]
|
FIG. 8.
Visualization of actin tails by confocal microscopy. (A
to C) HeLa cells were infected with vB5R-GFP (A), vB5R-GFP/ A36R (B),
or vB5R-GFP/A36R-YdF (C) and stained with rhodamine-phalloidin (red)
and DAPI (blue) to visualize F-actin and DNA, respectively. Green is
GFP fluorescence. The boxed area in the lower left of panel A is
enlarged in the upper right in order to more clearly see actin tails.
(D) The percentages of infected cells that contained one or more actin
tails were determined.
|
|
We also noted that in addition to the GFP staining in the juxtanuclear
region and individual particles in the cytoplasm, there was intense GFP
staining at the cell vertices. The latter staining, which appears
to represent dense collections of IEV, was prominent only in cells
infected with vB5R-GFP and vB5R-GFP/A36R-YdF (Fig. 8A and C). The
reduction in this staining in cells infected with vB5R-GFP/
A36R
(Fig. 8B) was consistent with the lower density of IEV seen by electron microscopy.
Intracellular movement of vB5R-GFP/A36R-YdF.
Having
established that vB5R-GFP/A36R-YdF was specifically defective in the
formation of actin tails, we compared the intracellular movement of
this mutant with that previously described for vB5R-GFP. As with
vB5R-GFP, the overall IEV movement in vB5R-GFP/A36R-YdF-infected cells
was directional from the juxtanuclear region to the periphery. The net
movement was parallel to the long axis of the cell, leading to the
accumulation of IEV at the position expected for the plus ends of
microtubules (Fig. 9). The accumulation
of the fluorescent particles in the cell vertices of cells infected
with either vB5R-GFP or vB5R-GFP/A36R-YdF was also seen in Fig. 8A and
C and was a general feature of such infections. A movie showing
movement of the particles seen in Fig. 9 is provided as Supplemental
Material no. 2 at http://www.niaid.nih.gov/dir/labs /lvd/moss.htm.
By capturing images at one frame per second, the speeds of individual
IEV were determined. Although not shown, occasional virions displayed
short intervals of movement toward the center of the cell during their progression to the periphery. The saltatory nature of the movement as
well as maximal speeds of greater than 2 µm per s (Table
1) were similar to those previously
reported for vB5R-GFP (34) and for microtubule-associated
post-Golgi vesicles (14). Also, as previously reported for
vB5R-GFP (34), vB5R-GFP/A36R-YdF movement was arrested by
the microtubule-depolymerizing drug nocodazole (data not shown). Thus,
intracellular IEV movement had the characteristics of microtubule
association and was unaffected by the absence of actin tails.

View larger version (110K):
[in this window]
[in a new window]
|
FIG. 9.
Visualization of IEV by digital video microscopy. HeLa
cells were infected with 0.2 PFU of vB5R-GFP/A36R-YdF per cell. After
12 h, images were collected at one frame per second. Selected
frames are shown, with the cumulative time elapsed (in seconds)
indicated in the upper left corner. The lettered arrows in each frame
point to the same IEV particles moving downwards in subsequent frames.
Note the intense fluorescence, at the bottom of each panel, where IEV
accumulate at the vertex of the cell. Bar, 5 µm. The entire
time-lapse video is provided as Supplemental Material no. 2 at
http://www.niaid.nih.gov/dir/labs/lvd/moss.htm.
|
|
Actin tails are associated with extracellular virions.
Our
finding that actin tails have no role in intracellular movement
appeared to conflict with images that appear to show actin tails
associated with intracellular virions (see, e.g., Fig. 8A). However,
such virions could be on the cell surface rather than in the cytoplasm.
In previous studies, it was not possible to distinguish between intra-
and extracellular virions because either the virions were labeled with
GFP or the infected cells were permeabilized prior to antibody
labeling. To overcome this technical problem, a HeLa cell line that
stably expresses GFP-actin was constructed and then infected with
wild-type vaccinia virus. The unpermeabilized cells were then stained
with a MAb to the B5R membrane protein and examined by confocal
microscopy. The absence of juxtanuclear staining, which is intense in
permeabilized cells, provided evidence that only extracellular virions
could be labeled with antibody under these conditions.
Maximum-intensity projections for consecutive portions of a single
Z-stack from a representative cell are shown in Fig.
10. By
reconstructing the Z-series, we determined that all of the actin tails
were associated with labeled virions on the cell surface. A movie
showing rotation of a three-dimensional reconstruction is
available as Supplemental Material no. 4 at http://www.niaid.nih.gov/dir/labs/lvd/moss.htm. This result was consistent with the formation of actin tails following fusion of the
IEV with the plasma membrane and has important implications regarding
the mechanism of virus spread and the potential susceptibility of these
virions to neutralization with antibody.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 10.
Association of extracellular virus with actin tails.
HeLa cells, which stably express GFP-actin (green), were infected with
wild-type vaccinia virus. Unpermeabilized cells were stained with MAb
19C2 to the B5R membrane protein followed by Cy5-conjugated donkey
anti-rat antibody (red) and Hoechst dye to stain DNA (blue). Entire
cells were imaged by confocal microscopy as a series of optical
sections. Starting from the bottom of one cell, every four sequential
sections (1 to 4, 5 to 8, 9 to 12, and 13 to 16) were summed, and the
set of four maximum-intensity projections is shown. The extracellular
virions appear red at the tips of green actin tails and yellow if
overlying an actin tail.
|
|
 |
DISCUSSION |
Following wrapping with trans-Golgi or endosomal cisternae,
vaccinia virus virions must travel from the interior of the cell to the
plasma membrane. In a recent review, Sodeik (28) pointed out that molecular crowding due to the presence of organelles, cytoskeleton, and high protein concentrations effectively restricts free diffusion of molecules larger than 500 kDa. For IEV, she calculated that it would take 5.7 h to travel 10 µm. A possible transport mechanism, used by a number of intracellular pathogens, involves rapid actin polymerization (2). Indeed, an actin
polymerization mechanism to explain vaccinia virus virion movement was
proposed by Cudmore et al. (3) based on video microscopic
studies. However, our video microscopy experiments carried out with a
recombinant vaccinia virus expressing GFP fused to the B5R membrane
protein revealed movement that was similar to vesicle transport along microtubules and which could be inhibited by a
microtubule-depolymerizing agent (34). Because
interpretations based on drug inhibition are always risky, we have now
extended these observations by specifically preventing the nucleation
of actin tails on vaccinia virus particles. To accomplish this, we used
data of Frischknecht et al. (9) indicating that actin
nucleation occurs by phosphorylation of the A36R protein on
Tyr112 alone or with
Tyr132. These residues had been identified by
transcomplementation, rather than by constructing a vaccinia virus
mutant with point mutations of the Tyr residues. Thus, our objectives
were to construct and use recombinant vaccinia viruses to (i) confirm
the site of A36R tyrosine phosphorylation, (ii) confirm the role of
A36R Tyr112 and Tyr132 in
actin nucleation, (iii) analyze the effects of the Tyr mutations on the
assembly and movement of IEV and cell-to-cell virus spread, (iv)
compare the phenotype of the A36R Tyr mutant with that of an A36R
deletion mutant, and (v) determine whether intra- or extracellular
virions are associated with actin tails.
The recombinant viruses containing a deleted or mutated A36R gene
expressed B5R-GFP in place of the normal B5R IEV membrane protein in
order to visualize virion movement. As previously shown (34) and further validated here, fusion of GFP was without
discernible effect on B5R function so that the plaque size of vB5R-GFP
was the same as that of standard vaccinia virus. Results obtained with
vB5R-GFP/A36R-YdF, which contains conservative Phe substitutions for
Tyr112 and Tyr132, will be
discussed first. Even though the mutated A36R was synthesized and still
had four remaining Tyr residues, Tyr phosphorylation was not detected
and both actin tail and specialized microvillus formation failed to
occur. Thus, the conclusions regarding the regulatory role of Tyr
phosphorylation in actin nucleation were corroborated. In addition, we
found that the mutant exhibited no discernible defect in wrapping as
determined by electron microscopy and that the outer membranes of the
abundant IEV reacted with antibody to GFP that was fused to the B5R
protein. Therefore, vB5R-GFP/A36R-YdF was ideal for assessing the
putative role of actin tails in intracellular IEV movement. The
directional, saltatory movement with maximal speeds of >2 µm per s,
first demonstrated with vB5R-GFP, was reproduced with
vB5R-GFP/A36R-YdF, even though actin tail formation was prevented. A
movie demonstrating this movement is available as Supplemental Material
no. 2 at http://www.niaid.nih.gov/dir/labs/lvd/moss.htm. These results
should eliminate from further consideration any significant role for
actin tails in intracellular movement of IEV. The type of movement
exhibited by IEV was similar to that of vesicles moving along
microtubules arranged parallel to the long axis of the cell
(14). Moreover, the movement was inhibited by the
microtubule-depolymerizing drug nocodazole. Although nocodazole has
also been reported to prevent movement of IMV and the formation of IEV
(21, 25), we previously showed that the effect on IEV movement was rapid and reversible (34). Microtubules also
may be involved in early postentry stages of vaccinia virus replication (21) and in transport of other viruses (17, 27, 28,
30).
Previous studies had not clearly defined whether virions associated
with actin tails are intra- or extracellular. To resolve this issue, a
cell line that expressed GFP-actin was infected with vaccinia
virus and the unpermeabilized cells were stained with a MAb to the B5R
membrane protein. By examination of Z-sections by confocal microscopy,
we could find an association of all actin tails with virions on the
cell surface. The surface location fits well with evidence, obtained by
following the movement of individual GFP-labeled virions, that actin
tails form at or near the plasma membrane (34). In
addition, van Eijl et al. (32) suggested that Tyr
phosphorylation of A36R occurred after fusion of the IEV and plasma
membranes. Moreover, this model fits with evidence that Tyr
phosphorylation of A36R occurs by a Src family kinase (9),
which is presumably plasma membrane associated.
Since actin tails are not involved in the intracellular transport of
vaccinia virions, unlike the situation with Listeria and
Shigella, what is their role? Actin tails are unnecessary for virions to exit the cell, as the presence of vB5R-GFP/A36R-YdF virions on the cell surface was demonstrated by low-pH-induced cell-to-cell fusion and by scanning electron microscopy. Nevertheless, the mutant plaques were one-third of the size of those formed by
viruses with an intact A36R gene, and a lag in virus production occurred following a low-multiplicity spreading infection. These data
are consistent with a primary role for actin tails in producing long
motile microvilli that promote efficient cell-to-cell virus spread. A
movie showing movement of virus-induced actin tails protruding from
cells stably expressing GFP-actin is provided as Supplemental Material
no. 4 at http://www.niaid.nih.gov/dir/labs/lvd/moss.htm. The
extracellular location of virions at the ends of actin tails means that
they are unlikely to entirely escape the immune system during
cell-to-cell spread.
The mutant vB5R-GFP/
A36R, with a deleted A36R ORF, also failed to
make actin tails. However, this mutant was much more severely impaired
than vB5R-GFP/A36R-YdF. Compared to vB5R-GFP/A36R-YdF, the following
were all reduced: plaque size, virus replication and spread,
low-pH-induced cell fusion (an indicator of virus on the cell surface),
wrapped virus isolated by CsCl centrifugation, and IEV seen by
transmission electron microscopy. Although previous studies with an
A36R deletion mutant had attributed the severe restriction on virus
spread to the failure of actin tail formation (24, 38),
our data suggested that the deletion mutant has additional defects.
Since the A36R protein has been shown to interact with other IEV
membrane proteins (23, 39), its absence may adversely
affect the structure of the protein complex forming the wrapping
membrane. Although some virion movement was detected in cells infected
with vB5R-GFP/
A36R, it was extremely infrequent and therefore could
not be characterized in detail. Thus, the mutant containing the
specific Tyr substitutions was superior to the deletion mutant for
studying actin tail-independent IEV movement and virus spread.
A scheme depicting directional IEV movement along microtubules and
actin tail formation at the plasma membrane is shown in Fig.
11. Because microtubules tend to be
arranged parallel to the long axis of the cell, the IEV accumulate at
the plus ends near the plasma membrane. The direction of IEV movement
could be explained by interaction with a kinesin family microtubule
motor, either directly or through additional cell protein adapters.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 11.
Diagram representing the movement of enveloped virions.
After wrapping of IMV in the juxtanuclear region (JNR), IEV move out to
the cell periphery along microtubules (MT). Actin polymerization occurs
at the plasma membrane, forming motile CEV-tipped microvilli.
|
|
 |
ACKNOWLEDGMENTS |
We thank members of the Laboratory of Viral Diseases, especially
Andrea Weisberg for electron microscopy and Norman Cooper for tissue
culture cells, and Tim Maugel at the Laboratory for Biological
Ultrastructure at the University of Maryland for help with the scanning
electron microscopy. Some of the work was carried out in the NIAID
imaging facility with the guidance of Owen Schwartz.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: 4 Center Dr.,
MSC 0445, NIH, Bethesda, MD 20892-0445. Phone: (301) 496-9869. Fax:
(301) 480-1147. E-mail: bmoss{at}nih.gov.
 |
REFERENCES |
| 1.
|
Blasco, R., and B. Moss.
1991.
Extracellular vaccinia virus formation and cell-to-cell virus transmission are prevented by deletion of the gene encoding the 37,000-dalton outer envelope protein.
J. Virol.
65:5910-5920[Abstract/Free Full Text].
|
| 2.
|
Cossart, P.
2000.
Actin-based motility of pathogens: the Arp2/3 complex is a central player.
Cell Microbiol.
2:195-205[CrossRef][Medline].
|
| 3.
|
Cudmore, S.,
P. Cossart,
G. Griffiths, and M. Way.
1995.
Actin-based motility of vaccinia virus.
Nature
378:636-638[CrossRef][Medline].
|
| 4.
|
da Fonseca, F. G.,
E. J. Wolffe,
A. Weisberg, and B. Moss.
2000.
Characterization of the vaccinia virus H3L envelope protein: topology and posttranslational membrane insertion via the C-terminal hydrophobic tail.
J. Virol.
74:7508-7517[Abstract/Free Full Text].
|
| 5.
|
Dales, S., and L. Siminovitch.
1961.
The development of vaccinia virus in Earle's L strain cells as examined by electron microscopy.
J. Biophys. Biochem. Cytol.
10:475-503[Abstract/Free Full Text].
|
| 6.
|
Doms, R. W.,
R. Blumenthal, and B. Moss.
1990.
Fusion of intra- and extracellular forms of vaccinia virus with the cell membrane.
J. Virol.
64:4884-4892[Abstract/Free Full Text].
|
| 7.
|
Engelstad, M., and G. L. Smith.
1993.
The vaccinia virus 42-kDa envelope protein is required for the envelopment and egress of extracellular virus and for virus virulence.
Virology
194:627-637[CrossRef][Medline].
|
| 8.
|
Falkner, F. G., and B. Moss.
1990.
Transient dominant selection of recombinant vaccinia viruses.
J. Virol.
64:3108-3111[Abstract/Free Full Text].
|
| 9.
|
Frischknecht, F.,
V. Moreau,
S. Rottger,
S. Gonfloni,
I. Reckmann,
G. Superti-Furga, and M. Way.
1999.
Actin-based motility of vaccinia virus mimics receptor tyrosine kinase signalling.
Nature
401:926-929[CrossRef][Medline].
|
| 10.
|
Gong, S. C.,
C. F. Lai, and M. Esteban.
1990.
Vaccinia virus induces cell fusion at acid pH and this activity is mediated by the N-terminus of the 14-kDa virus envelope protein.
Virology
178:81-91[CrossRef][Medline].
|
| 11.
|
Goode, B. L.,
D. G. Drubin, and G. Barnes.
2000.
Functional cooperation between the microtubule and actin cytoskeletons.
Curr. Opin. Cell Biol.
12:63-71[CrossRef][Medline].
|
| 12.
|
Hiller, G., and K. Weber.
1985.
Golgi-derived membranes that contain an acylated viral polypeptide are used for vaccinia virus envelopment.
J. Virol.
55:651-659[Abstract/Free Full Text].
|
| 13.
|
Hiller, G.,
K. Weber,
L. Schneider,
C. Parajsz, and C. Jungwirth.
1979.
Interaction of assembled progeny pox viruses with the cellular cytoskeleton.
Virology
98:142-153[CrossRef][Medline].
|
| 14.
|
Hirschberg, K.,
C. M. Miller,
J. Ellenberg,
J. F. Presley,
E. D. Siggia,
R. D. Phair, and J. Lippincott-Schwartz.
1998.
Kinetic analysis of secretory protein traffic and characterization of golgi to plasma membrane transport intermediates in living cells.
J. Cell Biol.
143:1485-1503[Abstract/Free Full Text].
|
| 15.
|
Ichihashi, Y.,
S. Matsumoto, and S. Dales.
1971.
Biogenesis of poxviruses: role of A-type inclusions and host cell membranes in virus dissemination.
Virology
46:507-532[CrossRef][Medline].
|
| 16.
|
Ishii, K., and B. Moss.
2001.
Role of vaccinia virus A20R protein in DNA replication: construction and characterization of temperature-sensitive mutants.
J. Virol.
75:1656-1663[Abstract/Free Full Text].
|
| 17.
|
Liu, W. J.,
Y. M. Qi,
K. N. Zhao,
Y. H. Liu,
X. S. Liu, and I. H. Frazer.
2001.
Association of bovine papillomavirus type 1 with microtubules.
Virology
282:237-244[CrossRef][Medline].
|
| 18.
|
Moreau, V.,
F. Frischknecht,
I. Reckmann,
R. Vincentelli,
G. Rabut,
D. Stewart, and M. Way.
2000.
A complex of N-WASP and WIP integrates signalling cascades that lead to actin polymerization.
Nat. Cell Biol.
2:441-448[CrossRef][Medline].
|
| 19.
|
Morgan, C.
1976.
Vaccinia virus reexamined: development and release.
Virology
73:43-58[CrossRef][Medline].
|
| 20.
|
Parkinson, J. E., and G. L. Smith.
1994.
Vaccinia virus gene A36R encodes a M(r) 43-50 K protein on the surface of extracellular enveloped virus.
Virology
204:376-390[CrossRef][Medline].
|
| 21.
|
Ploubidou, A.,
V. Moreau,
K. Ashman,
I. Reckmann,
C. Gonzalez, and M. Way.
2000.
Vaccinia virus infection disrupts microtubule organization and centrosome function.
EMBO J.
19:3932-3944[CrossRef][Medline].
|
| 22.
|
Roper, R. L.,
E. J. Wolffe,
A. Weisberg, and B. Moss.
1998.
The envelope protein encoded by the A33R gene is required for formation of actin-containing microvilli and efficient cell-to-cell spread of vaccinia virus.
J. Virol.
72:4192-4204[Abstract/Free Full Text].
|
| 23.
|
Rottger, S.,
F. Frischknecht,
I. Reckmann,
G. L. Smith, and M. Way.
1999.
Interactions between vaccinia virus IEV membrane proteins and their roles in IEV assembly and actin tail formation.
J. Virol.
73:2863-2875[Abstract/Free Full Text].
|
| 24.
|
Sanderson, C. M.,
F. Frischknecht,
M. Way,
M. Hollinshead, and G. L. Smith.
1998.
Roles of vaccinia virus EEV-specific proteins in intracellular actin tail formation and low pH-induced cell-cell fusion.
J. Gen. Virol.
79:1415-1425[Abstract].
|
| 25.
|
Sanderson, C. M.,
M. Hollinshead, and G. L. Smith.
2000.
The vaccinia virus A27L protein is needed for the microtubule-dependent transport of intracellular mature virus particles.
J. Gen. Virol.
81:47-58[Abstract/Free Full Text].
|
| 26.
|
Schmelz, M.,
B. Sodeik,
M. Ericsson,
E. J. Wolffe,
H. Shida,
G. Hiller, and G. Griffiths.
1994.
Assembly of vaccinia virus: the second wrapping cisterna is derived from the trans Golgi network.
J. Virol.
68:130-147[Abstract/Free Full Text].
|
| 27.
|
Smith, G. A.,
S. P. Gross, and L. W. Enquist.
2001.
Herpesviruses use bidirectional fast-axonal transport to spread in sensory neurons.
Proc. Natl. Acad. Sci. USA
98:3466-3470[Abstract/Free Full Text].
|
| 28.
|
Sodeik, B.
2000.
Mechanisms of viral transport in the cytoplasm.
Trends Microbiol.
8:465-472[CrossRef][Medline].
|
| 29.
|
Stokes, G. V.
1976.
High-voltage electron microscope study of the release of vaccinia virus from whole cells.
J. Virol.
18:636-643[Abstract/Free Full Text].
|
| 30.
|
Suomalainen, M.,
M. Y. Nakano,
S. Keller,
K. Boucke,
R. P. Stidwill, and U. F. Greber.
1999.
Microtubule-dependent plus- and minus end-directed motilities are competing processes for nuclear targeting of adenovirus.
J. Cell Biol.
144:657-672[Abstract/Free Full Text].
|
| 31.
|
Tooze, J.,
M. Hollinshead,
B. Reis,
K. Radsak, and H. Kern.
1993.
Progeny vaccinia and human cytomegalovirus particles utilize early endosomal cisternae for their envelopes.
Eur. J. Cell Biol.
60:163-178[Medline].
|
| 32.
|
van Eijl, H.,
M. Hollinshead, and G. L. Smith.
2000.
The vaccinia virus A36R protein is a type Ib membrane protein present on intracellular but not extracellular enveloped virus particles.
Virology
271:26-36[CrossRef][Medline].
|
| 33.
|
Ward, B. M., and B. Moss.
2000.
Golgi network targeting and plasma membrane internalization signals in vaccinia virus B5R envelope protein.
J. Virol.
74:3771-3780[Abstract/Free Full Text].
|
| 34.
|
Ward, B. M., and B. Moss.
2001.
Visualization of intracellular movement of vaccinia virus virions containing a green fluorescent protein-B5R membrane protein chimera.
J. Virol.
75:4802-4813[Abstract/Free Full Text].
|
| 35.
|
Wolffe, E. J.,
S. N. Isaacs, and B. Moss.
1993.
Deletion of the vaccinia virus B5R gene encoding a 42-kilodalton membrane glycoprotein inhibits extracellular virus envelope formation and dissemination.
J. Virol.
67:4732-4741[Abstract/Free Full Text].
|
| 36.
|
Wolffe, E. J.,
E. Katz,
A. Weisberg, and B. Moss.
1997.
The A34R glycoprotein gene is required for induction of specialized actin-containing microvilli and efficient cell-to-cell transmission of vaccinia virus.
J. Virol.
71:3904-3915[Abstract].
|
| 37.
|
Wolffe, E. J.,
S. Vijaya, and B. Moss.
1995.
A myristylated membrane protein encoded by the vaccinia virus L1R open reading frame is the target of potent neutralizing monoclonal antibodies.
Virology
211:53-63[CrossRef][Medline].
|
| 38.
|
Wolffe, E. J.,
A. S. Weisberg, and B. Moss.
1998.
Role for the vaccinia virus A36R outer envelope protein in the formation of virus-tipped actin-containing microvilli and cell-to-cell virus spread.
Virology
244:20-26[CrossRef][Medline].
|
| 39.
|
Wolffe, E. J.,
A. S. Weisberg, and B. Moss.
2001.
The vaccinia virusA33R protein provides a chaperone function for viral membrane localization and tyrosine phosphorylation of the A36R protein.
J. Virol.
75:303-310[Abstract/Free Full Text].
|
Journal of Virology, December 2001, p. 11651-11663, Vol. 75, No. 23
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.23.11651-11663.2001
This article has been cited by other articles:
-
Domi, A., Weisberg, A. S., Moss, B.
(2008). Vaccinia Virus E2L Null Mutants Exhibit a Major Reduction in Extracellular Virion Formation and Virus Spread. J. Virol.
82: 4215-4226
[Abstract]
[Full Text]
-
Earley, A. K., Chan, W. M., Ward, B. M.
(2008). The Vaccinia Virus B5 Protein Requires A34 for Efficient Intracellular Trafficking from the Endoplasmic Reticulum to the Site of Wrapping and Incorporation into Progeny Virions. J. Virol.
82: 2161-2169
[Abstract]
[Full Text]
-
Perdiguero, B., Lorenzo, M. M., Blasco, R.
(2008). Vaccinia Virus A34 Glycoprotein Determines the Protein Composition of the Extracellular Virus Envelope. J. Virol.
82: 2150-2160
[Abstract]
[Full Text]
-
Munter, S., Way, M., Frischknecht, F.
(2006). Signaling During Pathogen Infection. Sci Signal
2006: re5-re5
[Abstract]
[Full Text]
-
Luxton, G. W. G., Lee, J. I-H., Haverlock-Moyns, S., Schober, J. M., Smith, G. A.
(2006). The Pseudorabies Virus VP1/2 Tegument Protein Is Required for Intracellular Capsid Transport. J. Virol.
80: 201-209
[Abstract]
[Full Text]
-
Roper, R. L.
(2006). Characterization of the Vaccinia Virus A35R Protein and Its Role in Virulence. J. Virol.
80: 306-313
[Abstract]
[Full Text]
-
Herrero-Martinez, E., Roberts, K. L., Hollinshead, M., Smith, G. L.
(2005). Vaccinia virus intracellular enveloped virions move to the cell periphery on microtubules in the absence of the A36R protein. J. Gen. Virol.
86: 2961-2968
[Abstract]
[Full Text]
-
Ward, B. M.
(2005). Visualization and Characterization of the Intracellular Movement of Vaccinia Virus Intracellular Mature Virions. J. Virol.
79: 4755-4763
[Abstract]
[Full Text]
-
Husain, M., Moss, B.
(2005). Role of Receptor-Mediated Endocytosis in the Formation of Vaccinia Virus Extracellular Enveloped Particles. J. Virol.
79: 4080-4089
[Abstract]
[Full Text]
-
Newsome, T. P., Scaplehorn, N., Way, M.
(2004). Src Mediates a Switch from Microtubule- to Actin-Based Motility of Vaccinia Virus. Science
306: 124-129
[Abstract]
[Full Text]
-
Jouvenet, N., Monaghan, P., Way, M., Wileman, T.
(2004). Transport of African Swine Fever Virus from Assembly Sites to the Plasma Membrane Is Dependent on Microtubules and Conventional Kinesin. J. Virol.
78: 7990-8001
[Abstract]
[Full Text]
-
Senkevich, T. G., Ward, B. M., Moss, B.
(2004). Vaccinia Virus Entry into Cells Is Dependent on a Virion Surface Protein Encoded by the A28L Gene. J. Virol.
78: 2357-2366
[Abstract]
[Full Text]
-
Ward, B. M., Moss, B.
(2004). Vaccinia Virus A36R Membrane Protein Provides a Direct Link between Intracellular Enveloped Virions and the Microtubule Motor Kinesin. J. Virol.
78: 2486-2493
[Abstract]
[Full Text]
-
Katz, E., Ward, B. M., Weisberg, A. S., Moss, B.
(2003). Mutations in the Vaccinia Virus A33R and B5R Envelope Proteins That Enhance Release of Extracellular Virions and Eliminate Formation of Actin-Containing Microvilli without Preventing Tyrosine Phosphorylation of the A36R Protein. J. Virol.
77: 12266-12275
[Abstract]
[Full Text]
-
Carter, G. C., Rodger, G., Murphy, B. J., Law, M., Krauss, O., Hollinshead, M., Smith, G. L.
(2003). Vaccinia virus cores are transported on microtubules. J. Gen. Virol.
84: 2443-2458
[Abstract]
[Full Text]
-
Pires de Miranda, M., Reading, P. C., Tscharke, D. C., Murphy, B. J., Smith, G. L.
(2003). The vaccinia virus kelch-like protein C2L affects calcium-independent adhesion to the extracellular matrix and inflammation in a murine intradermal model. J. Gen. Virol.
84: 2459-2471
[Abstract]
[Full Text]
-
Mercer, J., Traktman, P.
(2003). Investigation of Structural and Functional Motifs within the Vaccinia Virus A14 Phosphoprotein, an Essential Component of the Virion Membrane. J. Virol.
77: 8857-8871
[Abstract]
[Full Text]
-
Castro, A. P. V., Carvalho, T. M. U., Moussatche, N., Damaso, C. R. A.
(2003). Redistribution of Cyclophilin A to Viral Factories during Vaccinia Virus Infection and Its Incorporation into Mature Particles. J. Virol.
77: 9052-9068
[Abstract]
[Full Text]
-
Petit, C., Giron, M.-L., Tobaly-Tapiero, J., Bittoun, P., Real, E., Jacob, Y., Tordo, N., de The, H., Saib, A.
(2003). Targeting of incoming retroviral Gag to the centrosome involves a direct interaction with the dynein light chain 8. J. Cell Sci.
116: 3433-3442
[Abstract]
[Full Text]
-
Ward, B. M., Weisberg, A. S., Moss, B.
(2003). Mapping and Functional Analysis of Interaction Sites within the Cytoplasmic Domains of the Vaccinia Virus A33R and A36R Envelope Proteins. J. Virol.
77: 4113-4126
[Abstract]
[Full Text]
-
Szajner, P., Jaffe, H., Weisberg, A. S., Moss, B.
(2003). Vaccinia Virus G7L Protein Interacts with the A30L Protein and Is Required for Association of Viral Membranes with Dense Viroplasm To Form Immature Virions. J. Virol.
77: 3418-3429
[Abstract]
[Full Text]
-
Katz, E., Wolffe, E., Moss, B.
(2002). Identification of Second-Site Mutations That Enhance Release and Spread of Vaccinia Virus. J. Virol.
76: 11637-11644
[Abstract]
[Full Text]
-
Chiu, W.-L., Chang, W.
(2002). Vaccinia Virus J1R Protein: a Viral Membrane Protein That Is Essential for Virion Morphogenesis. J. Virol.
76: 9575-9587
[Abstract]
[Full Text]
-
Husain, M., Moss, B.
(2002). Similarities in the Induction of Post-Golgi Vesicles by the Vaccinia Virus F13L Protein and Phospholipase D. J. Virol.
76: 7777-7789
[Abstract]
[Full Text]
-
Pelkmans, L., Puntener, D., Helenius, A.
(2002). Local Actin Polymerization and Dynamin Recruitment in SV40-Induced Internalization of Caveolae. Science
296: 535-539
[Abstract]
[Full Text]