Previous Article | Next Article 
Journal of Virology, December 2001, p. 11583-11593, Vol. 75, No. 23
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.23.11583-11593.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Cell Surface Heparan Sulfate Is a Receptor for Human
Herpesvirus 8 and Interacts with Envelope Glycoprotein K8.1
Alexander
Birkmann,1
Kerstin
Mahr,2
Armin
Ensser,1
Svenja
Ya
ubo
lu,1
Fritz
Titgemeyer,2
Bernhard
Fleckenstein,1 and
Frank
Neipel1,*
Institut für Klinische und Molekulare
Virologie, Universität Erlangen-Nürnberg, D-91054
Erlangen,1 and Lehrstuhl für
Mikrobiologie, Institut für Mikrobiologie, Biochemie und
Genetik, Universität Erlangen-Nürnberg, D-91058
Erlangen,2 Germany
Received 15 March 2001/Accepted 24 August 2001
 |
ABSTRACT |
An immunodominant envelope glycoprotein is encoded by the human
herpesvirus 8 (HHV-8) (also termed Kaposi's sarcoma-associated herpesvirus) K8.1 gene. The functional role of glycoprotein K8.1 is
unknown, and recognizable sequence homology to K8.1 is not detectable
in the genomes of most other closely related
gammaherpesviruses, such as herpesvirus saimiri or Epstein-Barr
virus. In search for a possible function for K8.1, we expressed
the ectodomain of K8.1 fused to the Fc part of human immunoglobulin G1
(K8.1
TMFc). K8.1
TMFc specifically bound to the surface of
cells expressing glycosaminoglycans but not to mutant cell lines
negative for the expression of heparan sulfate proteoglycans. Binding
of K8.1
TMFc to mammalian cells could be blocked by heparin.
Interestingly, the infection of primary human endothelial cells by
HHV-8 could also be blocked by similar concentrations of heparin. The
specificity and affinity of these interactions were then
determined by surface plasmon resonance measurements using immobilized
heparin and soluble K8.1. This revealed that K8.1 binds to heparin
with an affinity comparable to that of glycoproteins B and
C of herpes simplex virus, which are known to be involved in target
cell recognition by binding to cell surface proteoglycans, especially
heparan sulfate. We conclude that cell surface glycosaminoglycans play
a crucial role in HHV-8 target cell recognition and that HHV-8
envelope protein K8.1 is at least one of the proteins involved.
 |
INTRODUCTION |
Human herpesvirus 8 (HHV-8), also
termed Kaposi's sarcoma (KS)-associated herpesvirus, is the most
recently discovered human herpesvirus (11). HHV-8 DNA is
regularly present in all epidemiological forms of KS (2, 4,
7, 12, 15). In addition, HHV-8 DNA is also consistently found in
primary effusion lymphomas (8, 9) and certain forms of
multifocal Castleman's disease (47). A remarkably tight
epidemiological relationship clearly suggests a pathogenetic role of
HHV-8 in these malignant disorders. The nearly complete nucleotide
sequence of this first human rhadinovirus has been determined from both
a primary effusion lymphoma cell line (43) and a KS biopsy
specimen (GenBank accession no. KSU75698). This showed that HHV-8 is a
rhadinovirus or gamma-2 herpesvirus. Several
animal rhadinoviruses are highly pathogenic upon infection of
nonnatural hosts (18). In vivo, HHV-8 has been found in B cells and in KS spindle cells. The latter are derived from endothelial cells. Beyond this, the cell tropism of HHV-8 is not well
characterized, and in cell culture the spectrum of cells that support
lytic replication of HHV-8 appears to be rather limited. It is not
clear whether this is due to restricted entry or to an intracellular
block in replication at later stages of the infectious cycle. The
cellular receptors and their viral ligands involved in target cell
recognition by HHV-8 are unknown.
In terms of target cell recognition, the more distantly related
gammaherpesvirus Epstein-Barr virus (EBV) is a much-better-studied example. Like in other viruses, target cell recognition by EBV can be
separated into two sequential steps. The primary attachment of EBV to B
lymphocytes is mediated by binding of the envelope glycoprotein gp350/220 to complement receptor 2 (CD21)
(39, 52). Although EBV and HHV-8 belong to the same genus
(gammaherpesviruses) and share most structural and many nonstructural
genes, a homologue to the EBV glycoprotein gp350/220 has
not been identified in the HHV-8 genome (37, 43; GenBank
accession no. KSU75698). However, a nonconserved
glycoprotein gene is present in all rhadinovirus genomes sequenced so far; this gene maps to a genomic
position comparable to EBV open reading frame BZLF2 or
BLLF1a/b, encoding glycoproteins gp42 and gp350/220,
respectively. It is termed ORF51 in herpesvirus saimiri
(3) or K8.1 in HHV-8 (40).
The HHV-8 glycoprotein K8.1 exists in two forms, termed
K8.1
and K8.1
(40) or K8.1B and K8.1A
(10), encoded by differentially spliced transcripts, with
the larger one (K8.1
[K8.1A]) being predominant. It has been shown
that the transmembrane glycoprotein K8.1 is part of the
viral envelope (27). K8.1 is highly immunogenic in the
natural host (40) and is frequently used in HHV-8
serologic assays (26, 49, 60). The physiological function
of K8.1 or the other rhadinoviral glycoproteins encoded at
comparable genomic positions has not been identified so far.
Since K8.1 is a nonconserved virion glycoprotein and its
genomic position hints at a distant relationship to
glycoproteins of EBV involved in target cell recognition,
we expressed soluble K8.1 and examined its binding to cultured
mammalian cells. This article provides evidence that K8.1 binds with
high affinity to cell surface heparan sulfate and that infection of
endothelial cells by HHV-8 can be blocked by soluble heparin. In
summary, we show that heparin-like moieties function as a receptor for
HHV-8 and that K8.1 is at least one of the viral envelope proteins
involved in this interaction.
 |
MATERIALS AND METHODS |
Cell lines and virus.
LM(tk
) murine
fibroblasts (referred to here as mouse L cells) were obtained from the
American Type Culture Collection (ATCC CCL-1.3). Mouse L cells are the
parental cells line for mutants gro2C and sog9 (5) and
gro2C-EXT1 and sog9-EXT1 (34), which were kindly provided
by Frank Tufaro (University of British Columbia, Vancouver, Canada).
The adherent mouse L, gro2C, and sog9 cell lines were cultured in
Dulbecco modified Eagle medium supplemented with 10% fetal calf
serum, 350 mg of L-glutamine per ml, and 100 mg
of gentamicin per ml. G418 was added at 700 or 500 µg/ml for the
cultivation of gro2C-EXT1 or HEK 293T cells, respectively. Primary
human dermal microvascular endothelial cells (HMVEC-d) were obtained
from Clonetics Inc. (Walkerville, Md.) and propagated in EGM-2 MV
bullet kit medium (Clonetics Inc.) according to the manufacturer's
instructions. BCBL-1 cells were obtained from the AIDS Research and
Reference Reagent Repository (Bethesda, Md.) and maintained in RPMI
1640 medium supplemented with 10% fetal calf serum, 350 mg of
L-glutamine per ml, 100 µg of gentamicin per ml, 0.05 mM
-mercaptoethanol, and 1 mM sodium pyruvate.
Production of HHV-8 virions from the latently infected BCBL-1 cell line
was induced with 12-O-tetradecanoylphorbol-13-acetate (TPA)
(Sigma Chemical Co., St. Louis, Mo.) (25 ng/ml) and sodium butyrate
(Sigma) for 4 days. Expression of late viral gene products was verified
by indirect immunofluorescence using monoclonal antibody BS555 directed
against the lytic HHV-8 antigen K8.1 (25). After 4 days of
stimulation with TPA and sodium butyrate, cells and debris were removed
by centrifugation for 10 min at 270 × g followed by 30 min at 2,820 × g. The supernatant was then sedimented
at 12,500 × g for 3 h to pellet virions. The
sediment was resuspended in OptiMEM (Gibco BRL, Rockville, Md.) to
obtain a 200-fold concentration relative to the cell culture
supernatant and stored at
80°C.
Construction, expression, and purification of recombinant
proteins.
The pSecTag2/HygroB (Invitrogen Inc.)-based expression
plasmid pAB68 contains sequences coding for the predicted extracellular domain of K8.1
(amino acids 26 to 196) (40) fused to
the carboxy terminus of the 21-amino-acid murine immunoglobulin G kappa
subunit ([IgG(
)] signal peptide (PIR locus KVMS32) and the
amino terminus of the Fc part from human IgG1 (GenBank accession no.
S72664, amino acids 146 to 374). This plasmid was used to express the soluble ectodomain of K8.1 fused to the IgG1 Fc part
(K8.1
TMFc), including a C-terminal Myc epitope. For cloning of the
K8.1 cDNA fragment, RNA was extracted from TPA-induced BCBL-1 cells and reverse transcription-PCR was performed as described previously (40). Primers K8.1-Bg1
(GATCAGATCTTAACCATGAGTTCCACACAGATTC) and K8.1-Bg2
(GATCAGATCTATGGGTCCGTATTTCTGCATTG) were then
used to amplify the sequences coding for the extracellular domains of
K8.1. The abundant K8.1
form was cloned into the vector pVL1392-Fc (kindly provided by C. Ware) (32) via BglII
restriction sites (underlined). The resulting K8.1-Fc fusion product
was reamplified using primers K81rt-5
(CAGTGGATCCAATTGTCCACGTATCGTTC) and Fc-Xh1r (GATCCTCGAGATTTACCCGGAGACAGGGAG) and ligated via
BamHI and XhoI restriction sites into the
pSecTag2/HygroB plasmid (Invitrogen) in frame with the amino-terminal
murine IgG(
) signal peptide and the carboxy-terminal Myc/HIS
epitope, present in the pSecTag2/HygroB vector. Plasmid pAB61 was used
for the eukaryotic expression of the Fc part of human IgG1 fused to the
Myc epitope sequence. To obtain pAB61, a DNA fragment coding for the Fc
part was amplified from pVL1392-Fc using oligonucleotides Fc-N1
(GATCGCGGCCGCTGTGACAAAACTCACACATG) and Fc-Xh1r
and cloned into plasmid pSecTag2/HygroB via NotI and XhoI restriction sites (underlined).
Both constructs were transiently transfected in HEK 293T cells
(American Type Culture Collection) with Lipofectamine PLUS
(Life
Technologies) as recommended by the manufacturer. Cell culture
supernatant was then collected daily for 7 days. Protein expression
was
confirmed by Western blot analysis using antibodies directed
against
the Fc part of human IgG1 (DAKO). After removal of cells
and debris by
centrifugation, K8.1

TMFc and Fc proteins were purified
by affinity
chromatography using HiTrap protein A columns (Pharmacia)
as specified
by the
manufacturer.
IFA and binding studies.
Adherent cells (HMVEC-d, mouse L
cells, and mouse L mutant cell lines) were seeded on glass coverslips
and incubated at 37°C with 5% CO2 until 90%
confluence was reached. Coverslips with adherent cells were washed
twice with phosphate-buffered saline (PBS) and fixed for 30 min in PBS
containing 3% paraformaldehyde. After fixation, cells were washed
three times with PBS. Glycine at 100 mM was added for the second
washing step. Suspension cells (BCBL-1 and BJAB cells) were fixed on
immunofluorescence assay (IFA) slides using a mixture of 75% acetone
and 25% methanol for 10 min at
20°C.
Prior to incubation with Fc fusion proteins or antibodies, fixed cells
were incubated with PBS containing 1% bovine serum
albumin for 30 min
at room temperature. Incubation with the first
antibody was performed
for 30 min at room temperature and was
followed by washing three times
for 5 min each in PBS. As a first
antibody, either mouse monoclonal
antibody BS555 directed against
HHV-8 protein K8.1 (
25) or
monoclonal antibody 9E10 directed
against an epitope of the human
c-
myc proto-oncogene (ATCC CRL-1729)
(
17) was
used. For the detection of mouse monoclonal antibodies,
cells were then
incubated with a sheep anti-mouse IgG-Cy3 conjugate
(Sigma
catalog no. C2181) diluted 1:300 in PBS, followed by three
washing
steps in PBS as described
above.
To detect binding of K8.1

TMFc or Fc proteins alone, adherent cells
were fixed as described above. In addition, cells were
incubated with
Cohn fraction II of human plasma (ICN Biochemicals)
at 2 mg/ml for 30 min at room temperature prior to incubation
with Fc/Fc fusion
proteins to avoid nonspecific binding to cellular
Fc receptor
molecules. Incubation with Fc/Fc fusion proteins purified
from
transfected cells by protein A affinity chromatography was
then
performed for 3 h at 4°C. The purified proteins were used
at a
concentration of 50 µg/ml, followed by three washing steps
at room
temperature for 5 min each. Washing and incubation with
primary
antibody (mouse anti-Myc antibody 9E10; ATCC CRL-1729)
(
17) and secondary antibody (anti-mouse IgG-Cy3
conjugate; Sigma
no. C2181) were then performed as described above. For
competitive
inhibition experiments, purified K8.1

TMFc or Fc proteins
alone
were incubated with heparin (heparin sodium salt from bovine
intestinal
mucosa; Sigma no. H-0777) and/or chondroitin sulfate A
(sodium
salt from bovine trachea; Sigma no. C-9891) at 0.1 or 1 mg/ml
in PBS for 15 min at room temperature prior to incubation with
the
fixed
cells.
Infection assays.
To infect HMVEC-d with HHV-8, the cells
were seeded on glass coverslips in 12-well plates. Adherent cells were
inoculated with 350 µl of 100-fold-concentrated supernatant of TPA-
and butyrate-induced BCBL-1 cells for 30 min at 37°C. The cells were
washed three time in PBS and incubated in the appropriate medium with
5% CO2 at 37°C. Medium was exchanged after
24 h. At 2 days postinfection, cells were harvested and IFA was
performed as described above using monoclonal antibody BS555 directed
against K8.1 (25). For blocking experiments with
glycosaminoglycans, concentrated virus stock was incubated with heparin
or chondroitin sulfate A prior to infection for 30 min at
37°C. For blocking of the infection with purified K8.1
TMFc or Fc
proteins, the cells were incubated with the purified proteins dissolved
in OptiMEM (Gibco Life Technologies) at 25, 50, and 100 µg/ml for 30 min at 37°C prior to infection with concentrated BCBL-1 supernatant.
For quantitation of the infection, the number of K8.1-positive plaques
per view field was counted at a 400-fold magnification. The mean and
standard deviation of the number of plaques per field were calculated
from three fields selected at random in each of three independent assays.
SPR measurement.
Surface plasmon resonance (SPR) experiments
were performed on a BIAcore biosensor system using an SA
(streptavidin-coated) biosensor chip (BIAcore AB). HBS running buffer
consisted of 10 mM HEPES (pH 7.5), 0.15 M NaCl, 3.4 mM EDTA, and
0.005% Tween 20. Heparin was biotinylated and immobilized on the
biosensor surface as described elsewhere (31). Briefly,
heparin (bovine intestinal mucosa; Sigma) was dissolved in PBS at 20 mg/ml and mixed with a threefold molar excess of
D-biotin-N-hydroxylsuccimide (Roche). After
incubation for 60 min at room temperature, free biotin was removed on a
NAP-5 column (Pharmacia). The biotinylated heparin was then coupled to
flow cell 2 (Fc2) of the SA sensor chip by injecting 40 µl of a
25-µg/ml solution in PBS at a flow rate of 5 µl/min. This resulted
in 160 resonance units (RU) of immobilized material. Flow cell 1 (Fc1)
was used as reference to correct for changes in buffer composition and
nonspecific binding to the sensor chip surface. For SPR measurements,
20 µl of either K8.1
TMFc or Fc alone diluted in PBS at various
concentrations (see below) was injected at a flow rate of 4 µl/min. Following injection of the protein solution, the
biosensor was rinsed with running buffer at the same flow rate for
200 s. The flow rate was then increased to 20 µl/min, and 10 µl of a 0.1 M NaOH-0.1% sodium dodecyl sulfate (SDS) solution was
injected to regenerate the chip surface. For competitive binding
assays, proteins (K8.1
TMFc or Fc alone, 25 µg/ml in PBS) were
incubated with soluble glycosaminoglycans prior to injection into the
biosensor chip. SPR data were analyzed with BIAevaluation 3.0 software
(Biacore, Inc.). Briefly, for estimation of
kon, the middle portion of the
association curves (40 to 190 s in Fig. 5B) was used. For
estimation of koff, the first part of
the dissociation phase of the curve (315 to 415 s in Fig. 5B) was
used. These kinetic data were fit most adequately by assuming a simple
bimolecular reaction model for interaction between soluble analyte and
immobilized ligand (Langmuir model). The goodness of fit was estimated
by calculating
2 values and inspecting
residuals (difference between observed and calculated values).
Western blot analysis.
TPA-stimulated and nonstimulated
BCBL-1 and BJAB cells were harvested by centrifugation (10 min,
400 × g), washed twice in PBS, and lysed in 2× SDS
sample buffer (4% SDS, 10%
-mercaptoethanol, 20% glycerol, 2 mM
EDTA, 120 mM Tris-HCl [pH 6.8], 0.1 mg of bromphenol blue/ml). An
equivalent of 105 cells was loaded per lane. Cell
culture supernatant from cells transfected with either pAB68 or pAB61
expression plasmids as well as proteins purified by protein A affinity
chromatography were mixed directly with 5× SDS sample buffer. Proteins
were separated on 10% (wt/vol) discontinuous SDS-polyacrylamide gels
containing methylenebisacrylamide and acrylamide at a ratio of 1:29.
Western blot analyses were carried out as described previously
(38). Briefly, proteins were transferred from 10%
discontinuous SDS-polyacrylamide gels onto nitrocellulose membranes
using the Hoefer SemiPhor TE70 blotting apparatus as described by the
manufacturer (Pharmacia Biotech, Uppsala, Sweden). The membranes were
first blocked for 2 h at 20°C in blocking buffer (10 mM Tris
[pH 7.5], 150 mM NaCl, 0.5% Tween, 5% low-fat milk). Membranes were
then incubated for 2 h with monoclonal antibody BS555
(25) or 9E10 (17), directed against K8.1 or
the Myc epitope, respectively. This was followed by three washes in
TBS-Tween (10 mM Tris [pH 7.5], 150 mM NaCl, 0.5% Tween) and 1 h of incubation with horseradish peroxidase-conjugated anti-mouse
IgG antibody diluted 1:2,000 in PBS (PO447; Dako Diagnostika GmbH, Hamburg, Germany). After washing three times in PBS, peroxidase activity was detected by electrochemiluminescence. For
electrochemiluminescence, 100 ml of solution A (100 mM Tris-HCl [pH
8.6], 25 mg of Luminol [Sigma no. A4685], 31 µl of 30%
H2O2) was mixed with 1%
solution B (1.1 mg of para-hydroxycoumaric acid [Sigma no.
C9008] dissolved in 1 ml of dimethyl sulfoxide) and the solution was
immediately applied to the membranes, followed by exposure for 1 to 2 min. All steps were carried out at room temperature.
 |
RESULTS |
K8.1 binds to the surface of mammalian cells.
In EBV,
glycoproteins gp350/220 and gp42 have been shown to be
involved in binding to receptor molecules on the cell surface. Both
proteins are not conserved in HHV-8 or other rhadinoviruses. Instead,
the glycoprotein K8.1 is encoded at a genomic
position that can be seen as being analogous to that for gp350/220. We therefore started our analysis of HHV-8 proteins involved in receptor binding with the more abundant of two K8.1 variants generated by
alternative splicing, termed K8.1
(40) or K8.1A
(10). The ectodomain domain of K8.1
(amino acids 27 to
196) was expressed fused to the amino terminus of human IgG1 Fc and a
Myc epitope sequence. Without the 21 amino acids of the murine IgG(
)
signal peptide, the resulting protein (K8.1
TMFc) is 425 amino acids in length and has a calculated molecular mass of 47.1 kDa. As can be
seen in Fig. 1, K8.1
TMFc was
efficiently secreted into the supernatant of transfected 293T cells and
could be purified by affinity chromatography with protein A-Sepharose
(Fig. 1B, lane 5). The apparent molecular mass of approximately 70 kDa
as observed in denaturing SDS-polyacrylamide gel electrophoresis is in good agreement with the expected molecular mass, given the high degree of glycosylation observed with the mature protein found in
viral particles (25, 59). Protein preparations like the
one shown in Fig. 1, lanes 5, were used to investigate the binding of
K8.1 on the cell surface. As a control, the Fc part of human IgG was
expressed and purified in the same way. HMVEC-d were used, as these
cells are clearly susceptible to infection by HHV-8 both in KS lesions
and in cell culture (6, 35, 41). The cells were grown on
glass slides and fixed briefly with 3% paraformaldehyde to prevent
internalization of bound proteins. Binding to Fc receptor molecules,
which are known to be expressed on endothelial cells (21),
was prevented by preincubation with Cohn fraction II from human plasma.
Incubation with K8.1
TMFc or Fc alone was done at 4°C for 3 h.
As can be seen in Fig. 2, binding of
K8.1
TMFc (Fig. 2A) but not of the Fc fragment alone (Fig. 2B)
was clearly detectable. An evenly bright staining could be observed
along the plasma membrane of all endothelial cells with the Myc-tagged
K8.1
TMFc. Similar experiments were repeated with a variety of
mammalian cells, including 293 cells, BCBL-1 cells, baby hamster kidney
(BHK-21) cells, rat mesangioma cells, and primary human
fibroblasts. Clear and strong binding of K8.1
TMFc, but not of
Fc alone, could invariably be detected (data not shown).

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 1.
Purification of recombinant K8.1 TMFc fusion protein.
Soluble K8.1 was expressed in a C-terminal fusion to the Fc part of
human IgG1 containing a C-terminal Myc epitope (K8.1 TMFc). Both
K8.1 TMFc and Fc alone (data not shown) were expressed in transiently
transfected 293T cells and purified from the cell culture supernatant
by affinity chromatography on protein A-Sepharose columns. An
SDS-polyacrylamide gel stained with Coomassie brilliant blue (A) and a
Western blot using a monoclonal antibody against K8.1 (BS555)
(25) and a horseradish peroxidase-labeled secondary
antibody against murine IgG (B) are shown. Lanes: 1, supernatant from
293T cells transfected with a negative control plasmid; 2, flowthrough supernatant after adsorption; 3 and 4, washing steps; 5 to 8, elution of K8.1 TMFc; 9, supernatant from 293T cells
transfected with K8.1 TMFc expression plasmid prior to absorption.
|
|

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 2.
Binding of K8.1 on the surface of HMVEC-d. HMVEC-d were
fixed with paraformaldehyde and preincubated with Cohn fraction II to
avoid binding of K8.1 TMFc to cellular Fc receptors. Cells were then
incubated with either K8.1 TMFc (A) or Fc alone (B), followed by
incubation with a monoclonal antibody directed to the C-terminal Myc
epitope. Using an anti-mouse IgG antibody labeled with the
fluorescent dye Cy3, binding of K8.1 TMFc but not of Fc alone could
then be detected.
|
|
K8.1 binds to the surface of cells expressing heparan sulfate.
Obviously, K8.1 was able to bind to a wide spectrum of cells. The broad
spectrum and the strong and relatively even staining pointed to a
molecule with a wide expression pattern. Glycosaminoglycans like
heparan sulfate and chondroitin sulfate are molecules fulfilling these
criteria. They are involved in cell-cell adhesion and play an
important role in the attachment of viruses as diverse as herpes simplex virus (HSV), dengue virus, and vaccinia virus. We thus examined
whether K8.1
TMFc binding to cells lacking the expression of various
glycosaminoglycans was also possible. The cell lines gro2C and sog9 are
mutants of the mouse fibroblast L-cell line. Whereas mouse L cells
express heparan sulfate and chondroitin sulfate, the mutant gro2C cells
lack heparan sulfate expression (22), and neither heparan
sulfate nor chondroitin sulfate is present on the surface of sog9 cells
(5). The absence of heparan sulfate on these cells is
due to a defect in the EXT1 gene resulting in the lack of
D-glucuronic acid transferase activity (33). K8.1
TMFc binding assays on paraformaldehyde-fixed mouse L cells and
their derivates were performed as described above after preincubation with Cohn fraction II. As can be seen in Fig.
3, K8.1
TMFc (Fig. 3A) but not Fc alone
(Fig. 3B) clearly bound to the surface of mouse L cells. In contrast,
none of these proteins could bind to the heparan sulfate-negative
mutant gro2C (Fig. 3C and D). Similar data were obtained with the
glycosaminoglycan-negative mutant cell line sog9 (data not shown). EXT1
is a glycosyltransferase that is required for the biosynthesis of
heparan sulfate (28), and only a truncated, nonfunctional
form of EXT1 is expressed in sog9 cells (33).
Overexpression of EXT1 in gro2C and sog9 cells restores the
biosynthesis of heparan sulfate but does not alter the expression of
chondroitin sulfate (34). As shown in Fig. 3E and F,
binding of K8.1
TMFc but not of the control protein (Fc only) (Fig.
3F) is also restored in gro2C-EXT1 cells. Similar results were obtained
with the EXT1-overexpressing cell line sog9-EXT1. In summary, the
ectodomain of the virion envelope protein K8.1 efficiently bound to a
variety of cells, given that heparan sulfate was expressed. We conclude
that the glycosaminoglycan heparan sulfate, but not chondroitin
sulfate, is required for this interaction.

View larger version (104K):
[in this window]
[in a new window]
|
FIG. 3.
K8.1 TMFc binds on the surface of mouse L cells (A)
but not on the gro2C mutant (C) lacking heparan sulfate. Cells were
fixed with paraformaldehyde and treated with Cohn fraction II derived
from human plasma. Cells were then incubated with K8.1 TMFc (A, C,
and E) or Fc alone (B, D, and F). Binding was detected with a mouse
monoclonal antibody against the Myc epitope which was present at the C
termini of both K8.1 TMFc and Fc, followed by incubation with a Cy3
labeled anti-mouse IgG antibody. Specific binding of K8.1 TMFc (A),
but not of Fc alone (B), could be detected on mouse L cells. In
contrast, K8.1 TMFc could not bind to the gro2C mutant of mouse L
cells (22) lacking heparan sulfate expression (C and D).
However, when cell line gro2C-EXT1, which is a derivative of gro2C with
partially restored expression of heparan sulfate (28), was
used, specific binding of K8.1 TMFc could again be observed (E and
F).
|
|
K8.1 binding to the cell surface is blocked by heparin.
To
further prove the specificity of the interaction of K8.1
with
cell surface heparan sulfate, competitive inhibition
experiments were performed. We used heparin instead of heparan
sulfate, as heparin has regularly been found to be a competitor of
higher activity than heparan sulfate due to a different degree of
acetylation and sulfatation (23). In addition, the
composition of heparan sulfate is variable and depends on the source of
isolation. Mouse L cells grown on glass slides were fixed with 3%
paraformaldehyde, preincubated with Cohn fraction II to block binding
to cell surface Fc receptors, and then incubated with either
K8.1
TMFc (Fig. 4A, C, D, E, and F) or
Fc alone (Fig. 4B). An experiment without competition by heparin
or chondroitin sulfate is shown Fig. 4A and B. Whereas soluble K8.1
clearly bound to mouse L cells (Fig. 4A), cells incubated with Fc only
remained negative (Fig. 4B). However, when the soluble K8.1 was
preincubated with 0.1 or 1.0 mg of heparin per ml, K8.1
TMFc no
longer bound to the surface of mouse L fibroblasts (Fig. 4C and D,
respectively), indicating competitive inhibition of the K8.1
interaction by heparin. When chondroitin sulfate was used instead of
heparin at 0.1 or 1.0 mg/ml, binding of K8.1
TMFc to the mouse L
cells was still possible even at 1.0 mg/ml (Fig. 4E and F,
respectively). These results are in good agreement with the data
described above obtained using mouse L-cell mutants gro2C and sog9:
binding of soluble K8.1 to these cells was not observed but could be
rescued by overexpression of EXT1. The latter partially restores
expression of undersulfated heparan sulfate but not chondroitin sulfate
at the cell surface (34).

View larger version (103K):
[in this window]
[in a new window]
|
FIG. 4.
Binding of K8.1 TMFc to mouse L cells is blocked by
heparin. Mouse L cells were fixed with paraformaldehyde and treated
with Cohn fraction II from human blood. Prior to incubation with the
cells, K8.1 TMFc (A, C, D, E, and F) or soluble Fc (B) was
preincubated with either PBS (A and B), 0.1 mg of heparin per ml (C),
1.0 mg of heparin per ml (D), 0.1 mg of chondroitin sulfate per ml (E),
or 1.0 mg of chondroitin sulfate per ml (F). Whereas heparin at both
0.1 and 1.0 mg/ml efficiently blocks binding of K8.1 TMFc to mouse L
cells (C and D), binding is still possible in the presence of
chondroitin sulfate A at up to 1.0 mg/ml (E and F).
|
|
Kinetics of K8.1 binding to heparin measured by SPR.
We used
an SPR system to further analyze the binding of soluble K8.1 to
glycosaminoglycans and calculate dissociation constants. Biotinylated
heparin was immobilized on the surface of a streptavidin-coated biosensor chip and tested for the binding of soluble K8.1 (K8.1
TMFc) or Fc alone. A typical sensorgram is shown in Fig.
5A. Both proteins were applied at a
concentration of 50 µg/ml with a flow rate of 4 µl/min. The
sensorgram obtained with soluble K8.1 (Fig. 5A, continuous line) can be
separated into three phases. From before the protein solution was
injected at time zero on, the chip was under constant flow with running
buffer. The change from running buffer to protein solution is marked by
a short, sharp peak due to a change in refractory index caused by
differences in buffer composition. The phase of association of K8.1 to
the chip surface then takes place over the next 300 s, marked
by a continuous increase of RU during the first 200 s until a
maximum value of approximately 1,100 RU is reached. After injection of
the protein solution, it was replaced by running buffer at 300 s,
again with a sharp peak due to the change of buffering conditions. This
is followed by a slow dissociation phase of 200 s with a moderate
decrease of K8.1 binding resulting in a value of 800 RU. A completely
different pattern is observed when soluble Fc is used instead of
K8.1
TMFc (Fig. 5A, dotted line). The sharp peaks at 0 and 300 s, which are due to changes in buffer composition, are again visible.
However, after a short initial increase to 180 RU due to increased
refraction of the protein solution, no further increment of resonance
is seen, indicating that the soluble Fc fragment alone does not bind to
the heparin-coated surface. The results of a similar experiment are
shown in Fig. 5B. Again, K8.1
TMFc solution was applied to a
heparin-coated biosensor chip at a flow rate of 4 µg/ml for 300 s and then replaced by running buffer allowing for the dissociation of
K8.1. Affinity constants were calculated from kinetic data (affinity
constant [KD] = koff/kon),
assuming a one-to-one interaction between the immobilized ligand
(heparin) and soluble analyte (K8.1
TMFc). Using Biacore 3.0 evaluation software (see Materials and Methods), association and
dissociation rates were calculated using the data from each of the four
experiments shown in Fig. 5B. The maximum resonance signal increased in
a dose-dependent manner from approximately 330 RU at 6.25 µg/ml to
1,180 RU at 50 µg/ml. For the ectodomain of K8.1
fused to
the Fc part of human IgG1 used here, a mean KD of 4.8 × 10
8 M (range, from 2.3 × 10
8 M at 6.25 µg/ml to 7.7 × 10
8 M at 50 µg/ml) was calculated. The low
2 values (0.118 to 0.168) and small residuals
randomly distributed around zero indicated good agreement between the
data and the Langmuir reaction model assumed here. The
KD value of 4.8 × 10
8 M is well within the range of affinity
constants observed for the binding of other viral ligands to their
respective receptors, e.g., those of HSV type 2 (HSV-2)
glycoprotein B to heparin (56), of HSV-1
glycoprotein D to the entry mediator (57), or
of human immunodeficiency virus gp120 to heparin (36)
(Table 1). Similar to the data obtained
with mouse L cells and various mutants of glycosaminoglycan
biosynthesis pathways, binding of K8.1 to a heparin-coated
biosensor chip was efficiently competed by heparin at 0.1 mg/ml (Fig.
6A) but not by chondroitin sulfate A
(Fig. 6B) or chondroitin sulfate B (data not shown) even at
concentrations as high as 10 mg/ml.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 5.
(A) Binding of soluble K8.1 to a heparin-coated
biosensor measured by SPR. The bindings of K8.1 TMFc (solid line) and
Fc alone (dotted line) to a heparin biosensor are compared. Binding of
K8.1 and Fc is shown as RU versus time in seconds. Both proteins were
used at 50 µg/ml and injected at 4 µl/min onto the heparin-coated
surface. The protein solution was injected for 300 s, followed by
injection of running buffer at 4 µl/min for 250 s. The peak
visible at 300 s is due to the change of the refractory index
caused by replacing the buffer on the sensor chip. Due to the
purification process, the buffer used to apply K8.1 TMFc differed
slightly from the running buffer. (B) Binding of soluble K8.1 at
concentrations of 6.25 to 50 µg/ml to a heparin-coated biosensor
chip. K8.1 TMFc was injected at 4 µl/min for 300 s and reached
a new equilibrium value with each higher concentration. Data from
multiple runs without baseline subtraction are given as RU versus time
in seconds. The peak at 300 s is due to the change of the
refractory index when the protein solution was replaced with running
buffer. The kinetic data shown in this figure were used to calculate
the dissociation constants shown in Table 1.
|
|

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 6.
Competitive inhibition of K8.1 TMFc binding to a
heparin-coated biosensor surface by heparin (A) or chondroitin sulfate
A (CsA) (B). Soluble heparin at concentrations of 0 to 1.0 mg/ml (A) or
soluble chondroitin sulfate A at concentrations of 0 to 10.0 mg/ml (B)
was mixed with soluble K8.1 before application to the heparin-coated
biosensor chip. Whereas heparin efficiently blocked K8.1 binding at
concentrations as low as 0.1 mg/ml, hardly any effect was seen with
chondroitin sulfate A even at the highest concentration.
|
|
Inhibition of HHV-8 infection by heparin.
Having shown that
the virion envelope protein K8.1
specifically binds to cell surface
heparan sulfate with high affinity, we did experiments to evaluate the
relevance of interaction with cell surface glycosaminoglycans for HHV-8
infection. Primary endothelial cells have been shown to be susceptible
to HHV-8 infection. HMVEC-d were inoculated with HHV-8 concentrated
from the supernatant of BCBL-1 cells induced with TPA and sodium
butyrate. As can be seen in Fig. 7B and
C, this resulted in lytic infection as evident from plaque
formation (Fig. 7B, left) or from expression of the late viral
protein(s) detected by immunofluorescence using a monoclonal antibody
against K8.1 (Fig. 7B, right) (25). Recently, latent infection and spindle cell conversion in HMVEC-d upon infection with
HHV-8 virions have been described (13). Although we used essentially the same type of HMVEC-d and the same culture conditions, we never observed this type of latent infection and associated morphological changes. In contrast, expression of lytic proteins was
predominant in our hands.

View larger version (81K):
[in this window]
[in a new window]
|
FIG. 7.
HHV-8 infection of human endothelial cells is blocked by
heparin. Concentrated supernatant (200-fold) from BCBL-1 cells
stimulated with TPA was used to infect HMVEC-d. Prior to
application on the HMVEC-d, the concentrated supernatant was mixed with
PBS (B), 0.2 mg of heparin per ml (C), 2.0 mg of heparin per ml (D),
0.2 mg of chondroitin sulfate A per ml (E), or 2.0 mg of chondroitin
sulfate A per ml (F). Uninfected cells are shown in panel A. Cells were
fixed with paraformaldehyde at 2 days postinfection, and IFA was
performed using a mouse monoclonal antibody against K8.1 and a
Cy3-labeled secondary antibody against mouse immunoglobulin.
Immunofluorescence pictures are shown on the left, and phase-contrast
pictures of the same cells are shown on the right. Expression of the
lytic K8.1 protein and a typical cytopathogenic effect were seen when
the inoculum was treated with PBS (B) or chondroitin sulfate (E and F)
prior to infection. However, when preincubation was done with heparin
at either 0.2 mg/ml (C) or 2.0 mg/ml (D), the number and size of the
plaques were clearly reduced.
|
|
However, when the inoculum was preincubated with heparin at 0.1 or 1.0 mg/ml, a marked decrease of plaque formation, by 69
and 87%,
respectively, was observed by both phase-contrast microscopy
(Fig.
7C
[0.1 mg/ml] and D [1.0 mg/ml], left panels) and immunofluorescence
using a monoclonal antibody against the lytically expressed K8.1
protein (Fig.
7C and D, right panels; Table
2). Formation of
plaques was almost
completely inhibited by heparin at 1.0 mg/ml.
The specificity of this
effect was again shown by using chondroitin
sulfate A instead of
heparin. At 0.1 mg/ml, no significant inhibition
of plaque formation by
chondroitin sulfate A was seen (Fig.
7E;
Table
2). Even preincubation
of the virus with chondroitin sulfate
A at concentrations as high as 1 mg/ml resulted in only a moderate
reduction of the number of plaques
(Fig.
7F). Thus, at a concentration
of 0.1 mg/ml, both infection of
endothelial cells and binding
of the virion envelope protein K8.1 are
inhibited by heparin but
not by chondroitin sulfate A. This points to a
role of K8.1 in
binding or entry of HHV-8 in the target cell. We thus
examined
whether infection of HMVEC-d by HHV-8 can also be blocked by
soluble
K8.1. When HMVEC-d were incubated with K8.1

TMFc at
concentrations
of 25, 50, and 100 µg/ml, no inhibition of the
subsequent infection
by HHV-8 could be seen even at the highest
concentration of K8.1

TMFc
(Table
2). Protein concentrations of above
100 µg/ml were not
used, as nonspecific reduction of plaque formation
by bovine serum
albumin when used at higher concentrations has been
observed for
HHV-1 (
51).
 |
DISCUSSION |
Although in theory many different cell surface molecules could
serve as viral receptors, the viral receptors identified so far appear
to belong to only a few families (for a review, see reference
19).These include several members of the immunoglobulin superfamily, integrins, complement receptors, and cell surface glycosaminoglycans. Thus, unrelated viruses may use closely related or
even identical receptors. On the other hand, closely related viruses
may also use unrelated receptors to infect the same type of cell.
Examples of the latter are HHV-6 and HHV-7. While HHV-7, like human
immunodeficiency virus, employs the CD4 receptor to infect T
lymphocytes (30), the closely related HHV-6 does not use
this protein (29) but instead binds to the complement
regulatory protein CD46 (44), which also serves as
receptor for measles virus (16). Thus, one cannot infer
the cellular receptor used by a virus from family relationships.
Binding of a virion protein to cell surface glycosaminoglycans is part
of the target cell recognition process of many viruses of different
families, with the best-examined example being heparan sulfate and its
role in target cell recognition by HSVs (45, 48, 58).
Several other viruses have also been found to interact with
glycosaminoglycans. These include the Picornaviridae
(foot-and-mouth disease virus), Togaviridae (Sindbis virus
and dengue virus), Parvoviridae (adeno-associated virus 2),
and Poxviridae (vaccinia virus). More recently, gp120 of
human immunodeficiency virus has also been shown to bind to cell
surface heparan sulfate, which enhances infectivity (36).
HHV-8 infects endothelial cells (6, 20) as well as B
lymphocytes in vivo and in cell culture (42). There are
only a few studies that deal with the identification of the full
spectrum of cells which can be infected by HHV-8 (41). The
cellular receptors and viral ligands involved in target cell
recognition by HHV-8 are completely unknown.
In this report we clearly demonstrate that virus binding to
heparin-like moieties on the cell surface is required for HHV-8 replication in susceptible HMVEC-d. We could efficiently block infection of these cells with heparin but not with chondroitin sulfate
A, a related glycosaminoglycan. In addition, we show that the viral
glycoprotein K8.1 is involved in this step, as (i) soluble K8.1 which was expressed in fusion to the Fc part of human IgG1 binds
to a wide variety of mammalian cells, including mouse L cells, a murine
fibroblast cell line; (ii) as described above for infection of
endothelial cells, this interaction could be competitively inhibited by
heparin but not by chondroitin sulfate A; (iii) K8.1 binding was not
observed on a mouse L mutant cell line termed gro2C lacking heparan
sulfate expression, but when gro2C cells were partially reconstituted
for heparan sulfate expression by overexpression of the EXT1 tumor
suppressor gene (34), binding of the K8.1 ectodomain
could again be observed; and (iv) the affinity constant for
binding of soluble K8.1 to heparin is well within the range observed
for other viral glycoproteins binding to their receptors
(Table 1), e.g., HSV-2 gB binding to glycosaminoglycans (56) or HSV-1 gD binding to the herpesvirus entry mediator
(57).
Very little is known about the mechanisms of target cell recognition in
any rhadinovirus. It has been shown for bovine herpesvirus 4 that
interaction of glycoprotein 8, also termed gp135k, with heparin-like moieties on the cell surface is involved in attachment (54). However, the gene encoding gp8/gp135k has not yet
been identified. EBV is the virus most closely related to HHV-8 for which some of the cellular receptors and their viral ligands have been
identified. The EBV glycoproteins involved in attachment (gp350/220) and entry (gp42) by binding to CD21 (39) or
the HLA DR
-chain (50), respectively, are not conserved
in the HHV-8 genome. Moreover, heparan sulfate binding has not been
shown to be of importance for EBV.
However, due to its genomic position, the gene encoding the
immunogenic HHV-8 K8.1 (40) may be seen as distantly
related to these two envelope proteins of EBV. A nonconserved
transmembrane glycoprotein gene is present at an equivalent
genomic position in all rhadinovirus genomes sequenced so far.
A typical serine-threonine-rich stretch is present in the ectodomains
of all of these glycoproteins, and this remote similarity
is also found in the gp350/220 protein of EBV, pointing to a possible
functional relationship. The evidence that binding of K8.1 to heparan
sulfate is involved in target cell recognition by HHV-8 is also
supported by the finding that a fully glycosylated form of K8.1 has
been shown to be part of the virion envelope (27).
Although we were able to show that K8.1 clearly binds to heparan
sulfate and heparan sulfate binding by HHV-8 is important for efficient
infection, it remains an open question at which step of the infection
process this interaction is important. Generally, infection of a cell
by a virus can be divided into two steps. A first interaction of viral
proteins with cellular receptors mediates attachment. Usually, this
juxtaposes viral proteins and cellular coreceptors, enabling
binding of the viral protein to the coreceptors, which mediates entry
through membrane fusion or triggers release of the nucleic acid. In
most cases, the interaction of a virus with glycosaminoglycans is
important for the first step, termed attachment. This holds true for
the interaction of HSV glycoproteins C and B with heparan
sulfate. In the case of HSVs, membrane fusion is subsequently enabled
by interaction of glycoprotein D with one of several
herpesvirus entry mediators that belong to the family of nectins, such
as the tumor necrosis factor receptors (14, 55). It should
be noted in this context that glycoproteins C and D of HSVs
are not conserved in HHV-8 or other gammaherpesviruses. Additional
viral glycoproteins, especially gH and gL, are then
required to initiate membrane fusion (53). However, it has
also been shown that binding of gD to 3-O-sulfated heparan sulfate is
able to mediate entry of HSV-1 (46). The efficient binding
of K8.1 to cell surface glycosaminoglycans, its localization in the
virion envelope, and the ability of heparin to block both binding of
K8.1 to the cell surface and infection of endothelial cells by HHV-8
make it very likely that K8.1 mediates HHV-8 attachment. This does not
imply that K8.1 is required for the attachment step. Our finding that
infection of endothelial cells by HHV-8 cannot be blocked by soluble
K8.1 indicates that K8.1 may not be essential for this step. Even at
the highest concentration of K8.1 used, no reduction in plaque
formation could be observed, and antibody BS555 directed against K8.1
was not able to inhibit infection. This is surprising only at first
sight. A similar situation is observed in HSV, where binding to heparan
sulfate greatly enhances infection. Notably, whereas soluble gC could
compete with attachment of HSV-1, plaque formation was not be inhibited
by gC when used at concentrations of up to 100 µg/ml
(51). This is most likely due to the fact that HSV has
evolved redundant mechanisms for the initial attachment step. Both
glycoproteins B and C of HSV are able to bind to
glycosaminoglycans, and gC of HSV is thus not essential for this first
step (24). Indeed, preliminary data from this laboratory
indicate that glycoprotein H when expressed in a soluble
form is also able to bind to cell surface glycosaminoglycans (unpublished data), and a recent study indicated that HHV-8
glycoprotein B may bind to heparan sulfate
(1). In summary, we show that cell surface heparan sulfate
is required for efficient infection by HHV-8. The data presented
indicate that the virion envelope protein K8.1 plays a role in the
viral life cycle that is comparable to the function of HSV
glycoprotein C.
 |
ACKNOWLEDGMENTS |
This work was supported by grant SFB466 from the German Research
Foundation on Lymphoproliferation and Viral Immunodeficiency, by the
Ria-Freifrau-von-Fritsch Foundation, and by the European Union
Concerted Action on AIDS-Associated Kaposi's Sarcoma.
We thank Matthias Peipp for helpful hints and critical discussion.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institut
für Klinische und Molekulare Virologie, Universität
Erlangen-Nürnberg, Schlossgarten 4, D-91054 Erlangen, Germany.
Phone: (49)-9131-8526483. Fax: (49)-9131-8526599. E-mail:
neipel{at}viro.med.uni-erlangen.de.
 |
REFERENCES |
| 1.
|
Akula, S. M.,
N. P. Pramod,
F. Z. Wang, and B. Chandran.
2001.
Human herpesvirus 8 envelope-associated glycoprotein B interacts with heparan sulfate-like moieties.
Virology
284:235-249[CrossRef][Medline].
|
| 2.
|
Albini, A.,
M. G. Aluigi,
R. Benelli,
E. Berti,
P. Biberfeld,
C. Blasig,
M. L. Calabro,
F. Calvo,
L. Chieco-Bianchi,
M. Corbellino,
A. Del Mistro,
M. Ekman,
A. Favero,
P. H. Hofschneider,
E. Kaaya,
C. Lebbe,
P. Morel,
F. Neipel,
D. M. Noonan,
C. Parravicini,
L. Repetto,
M. Schalling,
M. Stürzl, and E. Tschachler.
1996.
Oncogenesis in HIV-infection: KSHV and Kaposi's sarcoma.
Int. J. Oncol.
9:5-8.
|
| 3.
|
Albrecht, J. C.,
J. Nicholas,
D. Biller,
K. R. Cameron,
B. Biesinger,
C. Newman,
S. Wittmann,
M. A. Craxton,
H. Coleman,
B. Fleckenstein, and R. W. Honess.
1992.
Primary structure of the herpesvirus saimiri genome.
J. Virol.
66:5047-5058[Abstract/Free Full Text].
|
| 4.
|
Ambroziak, J. A.,
D. J. Blackbourn,
B. G. Herndier,
R. G. Glogau,
J. H. Gullett,
A. R. McDonald,
E. T. Lennette, and J. A. Levy.
1995.
Herpes-like sequences in HIV-infected and uninfected Kaposi's sarcoma patients.
Science
268:582-583[Free Full Text].
|
| 5.
|
Banfield, B. W.,
Y. Leduc,
L. Esford,
K. Schubert, and F. Tufaro.
1995.
Sequential isolation of proteoglycan synthesis mutants by using herpes simplex virus as a selective agent: evidence for a proteoglycan-independent virus entry pathway.
J. Virol.
69:3290-3298[Abstract].
|
| 6.
|
Boshoff, C.,
T. F. Schulz,
M. M. Kennedy,
A. K. Graham,
C. Fisher,
A. Thomas,
J. O. McGee,
R. A. Weiss, and J. J. O'Leary.
1995.
Kaposi's sarcoma-associated herpesvirus infects endothelial and spindle cells.
Nat. Med.
1:1274-1278[CrossRef][Medline].
|
| 7.
|
Boshoff, C.,
D. Whitby,
T. Hatziioannou,
C. Fisher,
J. van-der Walt,
A. Hatzakis,
R. Weiss, and T. Schulz.
1995.
Kaposi's-sarcoma-associated herpesvirus in HIV-negative Kaposi's sarcoma.
Lancet
345:1043-1044[Medline].
|
| 8.
|
Cesarman, E.,
Y. Chang,
P. S. Moore,
J. W. Said, and D. M. Knowles.
1995.
Kaposi's sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas.
N. Engl. J. Med.
332:1186-1191[Abstract/Free Full Text].
|
| 9.
|
Cesarman, E.,
P. S. Moore,
P. H. Rao,
G. Inghirami,
D. M. Knowles, and Y. Chang.
1995.
In vitro establishment and characterization of two acquired immunodeficiency syndrome-related lymphoma cell lines (BC-1 and BC-2) containing Kaposi's sarcoma-associated herpesvirus-like (KSHV) DNA sequences.
Blood
86:2708-2714[Abstract/Free Full Text].
|
| 10.
|
Chandran, B.,
C. Bloomer,
S. R. Chan,
L. Zhu,
E. Goldstein, and R. Horvat.
1998.
Human herpesvirus-8 ORF K8.1 gene encodes immunogenic glycoproteins generated by spliced transcripts.
Virology
249:140-149[CrossRef][Medline].
|
| 11.
|
Chang, Y.,
E. Cesarman,
M. S. Pessin,
F. Lee,
J. Culpepper,
D. M. Knowles, and P. S. Moore.
1994.
Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma.
Science
266:1865-1869[Abstract/Free Full Text].
|
| 12.
|
Chang, Y.,
J. Ziegler,
H. Wabinga,
E. Katangole Mbidde,
C. Boshoff,
T. Schulz,
D. Whitby,
D. Maddalena,
H. W. Jaffe,
R. A. Weiss, and P. S. Moore.
1996.
Kaposi's sarcoma-associated herpesvirus and Kaposi's sarcoma in Africa.
Uganda Kaposi's Sarcoma Study Group. Arch. Intern. Med.
156:202-204.
|
| 13.
|
Ciufo, D. M.,
J. S. Cannon,
L. J. Poole,
F. Y. Wu,
P. Murray,
R. F. Ambinder, and G. S. Hayward.
2001.
Spindle cell conversion by Kaposi's sarcoma-associated herpesvirus: formation of colonies and plaques with mixed lytic and latent gene expression in infected primary dermal microvascular endothelial cell cultures.
J. Virol.
75:5614-5626[Abstract/Free Full Text].
|
| 14.
|
Connolly, S. A.,
J. C. Whitbeck,
A. H. Rux,
C. Krummenacher,
S. Drunen Littel-van den Hurk,
G. H. Cohen, and R. J. Eisenberg.
2001.
Glycoprotein D homologs in herpes simplex virus type 1, pseudorabies virus, and bovine herpes virus type 1 bind directly to human HveC (nectin-1) with different affinities.
Virology
280:7-18[CrossRef][Medline].
|
| 15.
|
de Lellis, L.,
M. Fabris,
E. Cassai,
A. Corallini,
G. Giraldo,
C. Feo, and P. Monini.
1995.
Herpesvirus-like DNA sequences in non-AIDS Kaposi's sarcoma.
J. Infect. Dis.
172:1605-1607[Medline].
|
| 16.
|
Dörig, R. E.,
A. Marcil,
A. Chopra, and C. D. Richardson.
1993.
The human CD46 molecule is a receptor for measles virus (Edmonston strain).
Cell
75:295-305[CrossRef][Medline].
|
| 17.
|
Evan, G. I.,
G. K. Lewis,
G. Ramsay, and J. M. Bishop.
1985.
Isolation of monoclonal antibodies specific for human c-myc proto-oncogene product.
Mol. Cell Biol.
5:3610-3616[Abstract/Free Full Text].
|
| 18.
|
Fleckenstein, B., and R. C. Desrosiers.
1982.
Herpesvirus saimiri and Herpesvirus ateles, p. 253-331.
In
B. Roizman (ed.), The herpesviruses. Plenum Press, New York, N.Y.
|
| 19.
|
Flint, S. J.,
L. W. Enquist,
R. M. Krug,
V. R. Racaniello, and A. M. Skalka.
2000.
Virus attachment to host cells, p. 100-131.
In
J. S. Flint, L. W. Enquist, R. M. Krug, V. R. Racaniello, and A. M. Skalka (ed.), Principles of virology. ASM Press, Washington, D.C.
|
| 20.
|
Flore, O.,
S. Rafii,
S. Ely,
J. J. O'Leary,
E. M. Hyjek, and E. Cesarman.
1998.
Transformation of primary human endothelial cells by Kaposi's sarcoma-associated herpesvirus.
Nature
394:588-592[CrossRef][Medline].
|
| 21.
|
Groger, M.,
G. Sarmay,
E. Fiebiger,
K. Wolff, and P. Petzelbauer.
1996.
Dermal microvascular endothelial cells express CD32 receptors in vivo and in vitro.
J. Immunol.
156:1549-1556[Abstract].
|
| 22.
|
Gruenheid, S.,
L. Gatzke,
H. Meadows, and F. Tufaro.
1993.
Herpes simplex virus infection and propagation in a mouse L cell mutant lacking heparan sulfate proteoglycans.
J. Virol.
67:93-100[Abstract/Free Full Text].
|
| 23.
|
Hallak, L. K.,
P. L. Collins,
W. Knudson, and M. E. Peeples.
2000.
Iduronic acid-containing glycosaminoglycans on target cells are required for efficient respiratory syncytial virus infection.
Virology
271:264-275[CrossRef][Medline].
|
| 24.
|
Herold, B. C.,
D. WuDunn,
N. Soltys, and P. G. Spear.
1991.
Glycoprotein C of herpes simplex virus type 1 plays a principal role in the adsorption of virus to cells and in infectivity.
J. Virol.
65:1090-1098[Abstract/Free Full Text].
|
| 25.
|
Lang, D.,
A. Birkmann,
F. Neipel,
W. Hinderer,
M. Rothe,
M. Ernst, and H. H. Sonneborn.
2000.
Generation of monoclonal antibodies directed against the immunogenic glycoprotein K8.1 of human herpesvirus 8.
Hybridoma
19:287-295[CrossRef][Medline].
|
| 26.
|
Lang, D.,
W. Hinderer,
M. Rothe,
H. H. Sonneborn,
F. Neipel,
M. S. Raab,
H. Rabenau,
B. Masquelier, and H. Fleury.
1999.
Comparison of the immunoglobulin-G-specific seroreactivity of different recombinant antigens of the human herpesvirus 8.
Virology
260:47-54[CrossRef][Medline].
|
| 27.
|
Li, M.,
J. MacKey,
S. C. Czajak,
R. C. Desrosiers,
A. A. Lackner, and J. U. Jung.
1999.
Identification and characterization of Kaposi's sarcoma-associated herpesvirus K8.1 virion glycoprotein.
J. Virol.
73:1341-1349[Abstract/Free Full Text].
|
| 28.
|
Lind, T.,
F. Tufaro,
C. McCormick,
U. Lindahl, and K. Lidholt.
1998.
The putative tumor suppressors EXT1 and EXT2 are glycosyltransferases required for the biosynthesis of heparan sulfate.
J. Biol. Chem.
273:26265-26268[Abstract/Free Full Text].
|
| 29.
|
Lusso, P.,
R. C. Gallo,
S. E. DeRocco, and P. D. Markham.
1989.
CD4 is not the membrane receptor for HHV-6.
Lancet
1:730. (Letter.)
|
| 30.
|
Lusso, P.,
P. Secchiero,
R. W. Crowley,
A. Garzino Demo,
Z. N. Berneman, and R. C. Gallo.
1994.
CD4 is a critical component of the receptor for human herpesvirus 7: interference with human immunodeficiency virus.
Proc. Natl. Acad. Sci. USA
91:3872-3876[Abstract/Free Full Text].
|
| 31.
|
Mach, H.,
D. B. Volkin,
C. J. Burke,
C. R. Middaugh,
R. J. Linhardt,
J. R. Fromm,
D. Loganathan, and L. Mattsson.
1993.
Nature of the interaction of heparin with acidic fibroblast growth factor.
Biochemistry
32:5480-5489[CrossRef][Medline].
|
| 32.
|
Mauri, D. N.,
R. Ebner,
R. I. Montgomery,
K. D. Kochel,
T. C. Cheung,
G. L. Yu,
S. Ruben,
M. Murphy,
R. J. Eisenberg,
G. H. Cohen,
P. G. Spear, and C. F. Ware.
1998.
LIGHT, a new member of the TNF superfamily, and lymphotoxin alpha are ligands for herpesvirus entry mediator.
Immunity
8:21-30[CrossRef][Medline].
|
| 33.
|
McCormick, C.,
G. Duncan,
K. T. Goutsos, and F. Tufaro.
2000.
The putative tumor suppressors EXT1 and EXT2 form a stable complex that accumulates in the Golgi apparatus and catalyzes the synthesis of heparan sulfate.
Proc. Natl. Acad. Sci. USA
97:668-673[Abstract/Free Full Text].
|
| 34.
|
McCormick, C.,
Y. Leduc,
D. Martindale,
K. Mattison,
L. E. Esford,
A. P. Dyer, and F. Tufaro.
1998.
The putative tumour suppressor EXT1 alters the expression of cell-surface heparan sulfate.
Nat. Genet.
19:158-161[CrossRef][Medline].
|
| 35.
|
Moses, A. V.,
K. N. Fish,
R. Ruhl,
P. P. Smith,
J. G. Strussenberg,
L. Zhu,
B. Chandran, and J. A. Nelson.
1999.
Long-term infection and transformation of dermal microvascular endothelial cells by human herpesvirus 8.
J. Virol.
73:6892-6902[Abstract/Free Full Text].
|
| 36.
|
Moulard, M.,
H. Lortat-Jacob,
I. Mondor,
G. Roca,
R. Wyatt,
J. Sodroski,
L. Zhao,
W. Olson,
P. D. Kwong, and Q. J. Sattentau.
2000.
Selective interactions of polyanions with basic surfaces on human immunodeficiency virus type 1 gp120.
J. Virol.
74:1948-1960[Abstract/Free Full Text].
|
| 37.
|
Neipel, F.,
J. C. Albrecht, and B. Fleckenstein.
1997.
Cell-homologous genes in the Kaposi's sarcoma-associated rhadinovirus human herpesvirus 8: determinants of its pathogenicity?
J. Virol.
71:4187-4192[Medline].
|
| 38.
|
Neipel, F.,
K. Ellinger, and B. Fleckenstein.
1992.
Gene for the major antigenic structural protein (p100) of human herpesvirus type 6.
J. Virol.
66:3918-3924[Abstract/Free Full Text].
|
| 39.
|
Nemerow, G. R.,
C. Mold,
V. K. Schwend,
V. Tollefson, and N. R. Cooper.
1987.
Identification of gp350 as the viral glycoprotein mediating attachment of Epstein-Barr virus (EBV) to the EBV/C3d receptor of B cells: sequence homology of gp350 and C3 complement fragment C3d.
J. Virol.
61:1416-1420[Abstract/Free Full Text].
|
| 40.
|
Raab, M. S.,
J. C. Albrecht,
A. Birkmann,
S. Yaguboglu,
D. Lang,
B. Fleckenstein, and F. Neipel.
1998.
The immunogenic glycoprotein gp35-37 of human herpesvirus 8 is encoded by open reading frame K8.1.
J. Virol.
72:6725-6731[Abstract/Free Full Text].
|
| 41.
|
Renne, R.,
D. Blackbourn,
D. Whitby,
J. Levy, and D. Ganem.
1998.
Limited transmission of Kaposi's sarcoma-associated herpesvirus in cultured cells.
J. Virol.
72:5182-5188[Abstract/Free Full Text].
|
| 42.
|
Renne, R.,
W. Zhong,
B. Herndier,
M. S. McGrath,
N. Abbey,
D. H. Kedes, and D. E. Ganem.
1996.
Lytic growth of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) in culture.
Nat. Med.
2:342-346[CrossRef][Medline].
|
| 43.
|
Russo, J. J.,
R. A. Bohenzky,
M. C. Chen,
J. Chen,
M. Yan,
D. Maddalena,
J. P. Parry,
D. Peruzzi,
I. S. Edelman,
Y. Chang, and P. S. Moore.
1996.
Nucleotide sequence of the Kaposi's sarcoma-associated herpesvirus (HHV8).
Proc. Natl. Acad. Sci. USA
93:14862-14867[Abstract/Free Full Text].
|
| 44.
|
Santoro, F.,
P. E. Kennedy,
G. Locatelli,
M. S. Malnati,
E. A. Berger, and P. Lusso.
1999.
CD46 is a cellular receptor for human herpesvirus 6.
Cell
99:817-827[CrossRef][Medline].
|
| 45.
|
Shieh, M. T.,
D. WuDunn,
R. I. Montgomery,
J. D. Esko, and P. G. Spear.
1992.
Cell surface receptors for herpes simplex virus are heparan sulfate proteoglycans.
J. Cell Biol.
116:1273-1281[Abstract/Free Full Text].
|
| 46.
|
Shukla, D.,
J. Liu,
P. Blaiklock,
N. W. Shworak,
X. Bai,
J. D. Esko,
G. H. Cohen,
R. J. Eisenberg,
R. D. Rosenberg, and P. G. Spear.
1999.
A novel role for 3-O-sulfated heparan sulfate in herpes simplex virus 1 entry.
Cell
99:13-22[CrossRef][Medline].
|
| 47.
|
Soulier, J.,
L. Grollet,
E. Oksenhendler,
P. Cacoub,
D. Cazals Hatem,
P. Babinet,
M. F. d'Agay,
J. P. Clauvel,
M. Raphael,
L. Degos, et al.
1995.
Kaposi's sarcoma-associated herpesvirus-like DNA sequences in multicentric Castleman's disease.
Blood
86:1276-1280[Abstract/Free Full Text].
|
| 48.
|
Spear, P. G.,
M. T. Shieh,
B. C. Herold,
D. WuDunn, and T. I. Koshy.
1992.
Heparan sulfate glycosaminoglycans as primary cell surface receptors for herpes simplex virus.
Adv. Exp. Med. Biol.
313:341-353[Medline].
|
| 49.
|
Spira, T. J.,
L. Lam,
S. C. Dollard,
Y. X. Meng,
C. P. Pau,
J. B. Black,
D. Burns,
B. Cooper,
M. Hamid,
J. Huong,
K. Kite-Powell, and P. E. Pellett.
2000.
Comparison of serologic assays and PCR for diagnosis of human herpesvirus 8 infection.
J. Clin. Microbiol.
38:2174-2180[Abstract/Free Full Text].
|
| 50.
|
Spriggs, M. K.,
R. J. Armitage,
M. R. Comeau,
L. Strockbine,
T. Farrah,
B. Macduff,
D. Ulrich,
M. R. Alderson,
J. Mullberg, and J. I. Cohen.
1996.
The extracellular domain of the Epstein-Barr virus BZLF2 protein binds the HLA-DR beta chain and inhibits antigen presentation.
J. Virol.
70:5557-5563[Abstract/Free Full Text].
|
| 51.
|
Tal-Singer, R.,
C. Peng,
D. L. Ponce,
W. R. Abrams,
B. W. Banfield,
F. Tufaro,
G. H. Cohen, and R. J. Eisenberg.
1995.
Interaction of herpes simplex virus glycoprotein gC with mammalian cell surface molecules.
J. Virol.
69:4471-4483[Abstract].
|
| 52.
|
Tanner, J.,
J. Weis,
D. Fearon,
Y. Whang, and E. Kieff.
1987.
Epstein-Barr virus gp350/220 binding to the B lymphocyte C3d receptor mediates adsorption, capping, and endocytosis.
Cell
50:203-213[CrossRef][Medline].
|
| 53.
|
Turner, A.,
B. Bruun,
T. Minson, and H. Browne.
1998.
Glycoproteins gB, gD, and gHgL of herpes simplex virus type 1 are necessary and sufficient to mediate membrane fusion in a Cos cell transfection system.
J. Virol.
72:873-875[Abstract/Free Full Text].
|
| 54.
|
Vanderplasschen, A.,
M. Bublot,
J. Dubuisson,
P. P. Pastoret, and E. Thiry.
1993.
Attachment of the gammaherpesvirus bovine herpesvirus 4 is mediated by the interaction of gp8 glycoprotein with heparinlike moieties on the cell surface.
Virology
196:232-240[CrossRef][Medline].
|
| 55.
|
Whitbeck, J. C.,
S. A. Connolly,
S. H. Willis,
W. Hou,
C. Krummenacher,
D. L. Ponce,
H. Lou,
I. Baribaud,
R. J. Eisenberg, and G. H. Cohen.
2001.
Localization of the gD-binding region of the human herpes simplex virus receptor, HveA.
J. Virol.
75:171-180[Abstract/Free Full Text].
|
| 56.
|
Williams, R. K., and S. E. Straus.
1997.
Specificity and affinity of binding of herpes simplex virus type 2 glycoprotein B to glycosaminoglycans.
J. Virol.
71:1375-1380[Abstract].
|
| 57.
|
Willis, S. H.,
A. H. Rux,
C. Peng,
J. C. Whitbeck,
A. V. Nicola,
H. Lou,
W. Hou,
L. Salvador,
R. J. Eisenberg, and G. H. Cohen.
1998.
Examination of the kinetics of herpes simplex virus glycoprotein D binding to the herpesvirus entry mediator, using surface plasmon resonance.
J. Virol.
72:5937-5947[Abstract/Free Full Text].
|
| 58.
|
WuDunn, D., and P. G. Spear.
1989.
Initial interaction of herpes simplex virus with cells binding to heparan sulfate.
J. Virol.
63:52-58[Abstract/Free Full Text].
|
| 59.
|
Zhu, L.,
V. Puri, and B. Chandran.
1999.
Characterization of human herpesvirus-8 K8.1A/B glycoproteins by monoclonal antibodies.
Virology
262:237-249[CrossRef][Medline].
|
| 60.
|
Zhu, L.,
R. Wang,
A. Sweat,
E. Goldstein,
R. Horvat, and B. Chandran.
1999.
Comparison of human sera reactivities in immunoblots with recombinant human herpesvirus (HHV)-8 proteins associated with the latent (ORF73) and lytic (ORFs 65, K8.1A, and K8.1B) replicative cycles and in immunofluorescence assays with HHV-8-infected BCBL-1 cells.
Virology
256:381-392[CrossRef][Medline].
|
Journal of Virology, December 2001, p. 11583-11593, Vol. 75, No. 23
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.23.11583-11593.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Wies, E., Hahn, A. S., Schmidt, K., Viebahn, C., Rohland, N., Lux, A., Schellhorn, T., Holzer, A., Jung, J. U., Neipel, F.
(2009). The Kaposi's Sarcoma-associated Herpesvirus-encoded vIRF-3 Inhibits Cellular IRF-5. J. Biol. Chem.
284: 8525-8538
[Abstract]
[Full Text]
-
Gillet, L., May, J. S., Stevenson, P. G.
(2009). In vivo importance of heparan sulfate-binding glycoproteins for murid herpesvirus-4 infection. J. Gen. Virol.
90: 602-613
[Abstract]
[Full Text]
-
Hahn, A., Birkmann, A., Wies, E., Dorer, D., Mahr, K., Sturzl, M., Titgemeyer, F., Neipel, F.
(2009). Kaposi's Sarcoma-Associated Herpesvirus gH/gL: Glycoprotein Export and Interaction with Cellular Receptors. J. Virol.
83: 396-407
[Abstract]
[Full Text]
-
Veettil, M. V., Sadagopan, S., Sharma-Walia, N., Wang, F.-Z., Raghu, H., Varga, L., Chandran, B.
(2008). Kaposi's Sarcoma-Associated Herpesvirus Forms a Multimolecular Complex of Integrins ({alpha}V{beta}5, {alpha}V{beta}3, and {alpha}3{beta}1) and CD98-xCT during Infection of Human Dermal Microvascular Endothelial Cells, and CD98-xCT Is Essential for the Postentry Stage of Infection. J. Virol.
82: 12126-12144
[Abstract]
[Full Text]
-
Jarousse, N., Chandran, B., Coscoy, L.
(2008). Lack of Heparan Sulfate Expression in B-Cell Lines: Implications for Kaposi's Sarcoma-Associated Herpesvirus and Murine Gammaherpesvirus 68 Infections. J. Virol.
82: 12591-12597
[Abstract]
[Full Text]
-
Qian, L.-W., Greene, W., Ye, F., Gao, S.-J.
(2008). Kaposi's Sarcoma-Associated Herpesvirus Disrupts Adherens Junctions and Increases Endothelial Permeability by Inducing Degradation of VE-Cadherin. J. Virol.
82: 11902-11912
[Abstract]
[Full Text]
-
Mark, L., Spiller, O. B., Okroj, M., Chanas, S., Aitken, J. A., Wong, S. W., Damania, B., Blom, A. M., Blackbourn, D. J.
(2007). Molecular Characterization of the Rhesus Rhadinovirus (RRV) ORF4 Gene and the RRV Complement Control Protein It Encodes. J. Virol.
81: 4166-4176
[Abstract]
[Full Text]
-
Hart, J., Ackermann, M., Jayawardane, G., Russell, G., Haig, D. M., Reid, H., Stewart, J. P.
(2007). Complete sequence and analysis of the ovine herpesvirus 2 genome. J. Gen. Virol.
88: 28-39
[Abstract]
[Full Text]
-
Barth, H., Schnober, E. K., Zhang, F., Linhardt, R. J., Depla, E., Boson, B., Cosset, F.-L., Patel, A. H., Blum, H. E., Baumert, T. F.
(2006). Viral and Cellular Determinants of the Hepatitis C Virus Envelope-Heparan Sulfate Interaction. J. Virol.
80: 10579-10590
[Abstract]
[Full Text]
-
Hofmann, H., Simmons, G., Rennekamp, A. J., Chaipan, C., Gramberg, T., Heck, E., Geier, M., Wegele, A., Marzi, A., Bates, P., Pohlmann, S.
(2006). Highly Conserved Regions within the Spike Proteins of Human Coronaviruses 229E and NL63 Determine Recognition of Their Respective Cellular Receptors.. J. Virol.
80: 8639-8652
[Abstract]
[Full Text]
-
Spiller, O. B., Mark, L., Blue, C. E., Proctor, D. G., Aitken, J. A., Blom, A. M., Blackbourn, D. J.
(2006). Dissecting the Regions of Virion-Associated Kaposi's Sarcoma-Associated Herpesvirus Complement Control Protein Required for Complement Regulation and Cell Binding.. J. Virol.
80: 4068-4078
[Abstract]
[Full Text]
-
Kaleeba, J. A. R., Berger, E. A.
(2006). Kaposi's sarcoma-associated herpesvirus fusion-entry receptor: cystine transporter xCT.. Science
311: 1921-1924
[Abstract]
[Full Text]
-
Rappocciolo, G., Jenkins, F. J., Hensler, H. R., Piazza, P., Jais, M., Borowski, L., Watkins, S. C., Rinaldo, C. R. Jr
(2006). DC-SIGN Is a Receptor for Human Herpesvirus 8 on Dendritic Cells and Macrophages. J. Immunol.
176: 1741-1749
[Abstract]
[Full Text]
-
Krishnan, H. H., Sharma-Walia, N., Zeng, L., Gao, S.-J., Chandran, B.
(2005). Envelope Glycoprotein gB of Kaposi's Sarcoma-Associated Herpesvirus Is Essential for Egress from Infected Cells. J. Virol.
79: 10952-10967
[Abstract]
[Full Text]
-
Sharma-Walia, N., Krishnan, H. H., Naranatt, P. P., Zeng, L., Smith, M. S., Chandran, B.
(2005). ERK1/2 and MEK1/2 Induced by Kaposi's Sarcoma-Associated Herpesvirus (Human Herpesvirus 8) Early during Infection of Target Cells Are Essential for Expression of Viral Genes and for Establishment of Infection. J. Virol.
79: 10308-10329
[Abstract]
[Full Text]
-
Hofmann, H., Pyrc, K., van der Hoek, L., Geier, M., Berkhout, B., Pohlmann, S.
(2005). Human coronavirus NL63 employs the severe acute respiratory syndrome coronavirus receptor for cellular entry. Proc. Natl. Acad. Sci. USA
102: 7988-7993
[Abstract]
[Full Text]
-
Stewart, J. P., Silvia, O. J., Atkin, I. M. D., Hughes, D. J., Ebrahimi, B., Adler, H.
(2004). In Vivo Function of a Gammaherpesvirus Virion Glycoprotein: Influence on B-Cell Infection and Mononucleosis. J. Virol.
78: 10449-10459
[Abstract]
[Full Text]
-
Luna, R. E., Zhou, F., Baghian, A., Chouljenko, V., Forghani, B., Gao, S.-J., Kousoulas, K. G.
(2004). Kaposi's Sarcoma-Associated Herpesvirus Glycoprotein K8.1 Is Dispensable for Virus Entry. J. Virol.
78: 6389-6398
[Abstract]
[Full Text]
-
de Lima, B. D., May, J. S., Stevenson, P. G.
(2004). Murine Gammaherpesvirus 68 Lacking gp150 Shows Defective Virion Release but Establishes Normal Latency In Vivo. J. Virol.
78: 5103-5112
[Abstract]
[Full Text]
-
Sharma-Walia, N., Naranatt, P. P., Krishnan, H. H., Zeng, L., Chandran, B.
(2004). Kaposi's Sarcoma-Associated Herpesvirus/Human Herpesvirus 8 Envelope Glycoprotein gB Induces the Integrin-Dependent Focal Adhesion Kinase-Src-Phosphatidylinositol 3-Kinase-Rho GTPase Signal Pathways and Cytoskeletal Rearrangements. J. Virol.
78: 4207-4223
[Abstract]
[Full Text]
-
Barth, H., Schafer, C., Adah, M. I., Zhang, F., Linhardt, R. J., Toyoda, H., Kinoshita-Toyoda, A., Toida, T., van Kuppevelt, T. H., Depla, E., von Weizsacker, F., Blum, H. E., Baumert, T. F.
(2003). Cellular Binding of Hepatitis C Virus Envelope Glycoprotein E2 Requires Cell Surface Heparan Sulfate. J. Biol. Chem.
278: 41003-41012
[Abstract]
[Full Text]
-
Spear, P. G., Longnecker, R.
(2003). Herpesvirus Entry: an Update. J. Virol.
77: 10179-10185
[Full Text]
-
Zhang, Y., Rassa, J. C., deObaldia, M. E., Albritton, L. M., Ross, S. R.
(2003). Identification of the Receptor Binding Domain of the Mouse Mammary Tumor Virus Envelope Protein. J. Virol.
77: 10468-10478
[Abstract]
[Full Text]
-
Akula, S. M., Naranatt, P. P., Walia, N.-S., Wang, F.-Z., Fegley, B., Chandran, B.
(2003). Kaposi's Sarcoma-Associated Herpesvirus (Human Herpesvirus 8) Infection of Human Fibroblast Cells Occurs through Endocytosis. J. Virol.
77: 7978-7990
[Abstract]
[Full Text]
-
Inoue, N., Winter, J., Lal, R. B., Offermann, M. K., Koyano, S.
(2003). Characterization of Entry Mechanisms of Human Herpesvirus 8 by Using an Rta-Dependent Reporter Cell Line. J. Virol.
77: 8147-8152
[Abstract]
[Full Text]
-
Dourmishev, L. A., Dourmishev, A. L., Palmeri, D., Schwartz, R. A., Lukac, D. M.
(2003). Molecular Genetics of Kaposi's Sarcoma-Associated Herpesvirus (Human Herpesvirus 8) Epidemiology and Pathogenesis. Microbiol. Mol. Biol. Rev.
67: 175-212
[Abstract]
[Full Text]
-
Wang, F.-Z., Akula, S. M., Sharma-Walia, N., Zeng, L., Chandran, B.
(2003). Human Herpesvirus 8 Envelope Glycoprotein B Mediates Cell Adhesion via Its RGD Sequence. J. Virol.
77: 3131-3147
[Abstract]
[Full Text]
-
Dezube, B. J., Zambela, M., Sage, D. R., Wang, J.-F., Fingeroth, J. D.
(2002). Characterization of Kaposi sarcoma-associated herpesvirus/human herpesvirus-8 infection of human vascular endothelial cells: early events. Blood
100: 888-896
[Abstract]
[Full Text]
-
Ablashi, D. V., Chatlynne, L. G., Whitman, J. E. Jr., Cesarman, E.
(2002). Spectrum of Kaposi's Sarcoma-Associated Herpesvirus, or Human Herpesvirus 8, Diseases. Clin. Microbiol. Rev.
15: 439-464
[Abstract]
[Full Text]
-
Pertel, P. E.
(2002). Human Herpesvirus 8 Glycoprotein B (gB), gH, and gL Can Mediate Cell Fusion. J. Virol.
76: 4390-4400
[Abstract]
[Full Text]