This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shi, Z.
Right arrow Articles by Tang, D.-C. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shi, Z.
Right arrow Articles by Tang, D.-C. C.

 Previous Article  |  Next Article 

Journal of Virology, December 2001, p. 11474-11482, Vol. 75, No. 23
0022-538X/01/$04.00+0   DOI: 10.1128/JVI.75.23.11474-11482.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.

Protection against Tetanus by Needle-Free Inoculation of Adenovirus-Vectored Nasal and Epicutaneous Vaccines

Zhongkai Shi,1 Mingtao Zeng,2 Guang Yang,1 Felix Siegel,1 Laura J. Cain,1 Kent R. van Kampen,1 Craig A. Elmets,2 and De-Chu C. Tang1,2,3,*

Vaxin, Inc.,1 Department of Dermatology,2 and Gene Therapy Center,3 University of Alabama at Birmingham, Birmingham, Alabama

Received 30 April 2001/Accepted 30 August 2001


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The effectiveness of vaccination programs would be enhanced greatly through the availability of vaccines that can be administered simply and, preferably, painlessly without the need for timed booster injections. Tetanus is a prime example of a disease that is readily preventable by vaccination but remains a major threat to public health due to the problems associated with administration of the present vaccine. Here we show that a protective immune response against live Clostridium tetani infection in mice can be elicited by an adenovirus vector encoding the tetanus toxin C fragment when administered as a nasal or epicutaneous vaccine. The results suggest that these vaccination modalities would be effective needle-free alternatives. This is the first demonstration that absorption of a small number of vectored vaccines into the skin following topical application of a patch can provide protection against live bacteria in a disease setting.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Tetanus continues to be a threat to public health with more than half a million fatalities each year being associated with infection with Clostridium tetani (23). Due to the ubiquitous distribution of the causal agent, vaccination is the most effective medical intervention for protection of the public against this deadly disease. The effectiveness of the vaccine is due, at least in part, to the fact that the sequences of the neurotoxin molecules are conserved among different strains of C. tetani, which permits elicitation of a protective immune response against all C. tetani strains through the use of a single vaccine (23). The effectiveness of the vaccine is limited, however, by the needle-based delivery method currently in use. Effective protection requires injection of three consecutive doses of the tetanus toxoid vaccine (16). Moreover, booster injections must be administered periodically during adulthood to compensate for the age-related decline in antitoxin levels (16). In developing countries, vaccine coverage against this disease is generally low due to failure to follow up as well as a lack of the trained medical personnel and facilities required for administration of the vaccine. In developed countries, although vaccine coverage in childhood is high, there is a general lack of compliance of adults with recommended schedules for booster injections (16). These factors have led to the realization that tetanus vaccination programs would be improved significantly worldwide through the development of low-cost, needle-free vaccines.

Needle-free vaccination requires the development of novel vaccines that can be administered safely and effectively. Several routes of administration are being considered. Both nasal and oral immunizations have been shown to be effective in eliciting an immune response against a number of pathogens. An alternative new modality is noninvasive vaccination onto the skin (NIVS) by topical application of epicutaneous vaccines (8, 10, 11, 17, 18, 22), which would offer a greater safety margin and eliminate the discomfort associated with injections. Prior to our studies, it had not been demonstrated that topical application of epicutaneous vaccines could protect recipients against live pathogenic bacteria in a disease setting. This study was undertaken to determine if administration of a vaccine consisting of an adenovirus (Ad) recombinant (AdCMV-tetC) encoding the immunogenic but atoxic tetanus toxin C fragment (TetC) (16), when inoculated either intranasally or by an epicutaneous patch, can protect animals against a lethal challenge of live C. tetani. We report that administration of a single dose of this vaccine intranasally was 100% protective against intramuscular injection of a lethal amount of C. tetani cells and that administration of a single dose topically was protective in 80% of the mice with the protection rising to 100% when two booster applications were administered consecutively using a patch.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Construction of expression vectors. The TetC fragment was amplified by PCR from plasmid pTET-nir (2) (provided by J. VanCott and J. McGhee, University of Alabama at Birmingham) using the primers 5tetC (5'CGCGGATCCACCATGGAAAATCTGGATTGTTGGGTTG3') and 3tetC (5'CGCGGATCCATCATTTGTCCATCCTTCATC3'). These DNA primers created unique BamHI sites at the ends of the 1.35-kb TetC fragment with a synthetic eukaryotic ribosomal binding site (13) inserted in frame. The PCR-amplified fragment was subsequently cloned into the BamHI site of the pACCMV.PLPA shuttle plasmid (12) under the transcriptional control of the human cytomegalovirus (CMV) early promoter to create the plasmid pAC-tetC. A replication-incompetent E1/E3-defective human Ad serotype 5-derived vector encoding TetC was constructed by homologous recombination between cotransfected pAC-tetC and pJM17 in human 293 cells as described (12). High-titer Ad stocks were prepared by ultracentrifugation over a cesium chloride gradient as described (20). A plasmid expression vector encoding TetC (pCMV-tetC) was constructed by cloning the same TetC fragment into the BamHI site of the plasmid pVR1012 (provided by Vical, Inc., San Diego, Calif.) in the correct orientation under transcriptional control of the human CMV early promoter. The AdCMV-PR8.ha vector encoding the influenza A/PR/8/34 hemagglutinin (HA) was constructed as a control by excising the 1.8-kb BamHI fragment containing the entire coding sequence of HA from the plasmid pDP122B (American Type Culture Collection [ATCC], Manassas, Va.), followed by cloning the HA gene into the BamHI site of pACCMV.PLPA and subsequent homologous recombination with pJM17 in human 293 cells.

Immunization of mice. Young (2 to 3 months old) female BALB/c mice (Jackson Laboratory, Bar Harbor, Maine) were immunized by intranasal inoculation, topical application, intradermal injection, and intramuscular injection of vaccines (Ad-vectored or DNA-based).

NIVS was carried out by pipetting 107 to 1010 particles (the number of particles was determined by quantitative PCR as described below; 1010 particles were equivalent to approximately 108 PFU) of a recombinant Ad vector or 100 µg of pCMV-tetC DNA as a thin film onto the preshaved abdominal skin of a mouse followed by coverage with a piece of the Tegaderm patch (3M). The skin was prepared by depilation with an electric trimmer in conjunction with gentle brushing using a soft-bristle brush without inducing erythema (Draize scores [15] of <= 1). Unabsorbed vectors were washed away after 1 h. The possibility of nasal or oral immunization through grooming was eliminated as described (18). Moreover, we have also demonstrated that the patch failed to immunize mice when vectors were removed from the skin a few seconds after topical application. The incompetence of a brief contact with respect to eliciting an immune response provides firm evidence that the immunization was mediated by skin transduction rather than inhalation of airborne vectors.

Intranasal inoculation was performed by pipetting 106 to 109 particles of a recombinant Ad vector, 109 particles of Ad5 (wild-type adenovirus serotype 5, ATCC number VR-5; ATCC), or 100 µg of pCMV-tetC DNA into one of the nostrils of an anesthetized mouse. DNA-based vaccines (100 µg of pCMV-tetC DNA) and AdCMV-tetC particles were inoculated by intramuscular injection into the hind-leg quadriceps as described (24). AdCMV-tetC particles were also injected intradermally into the abdominal skin of mice. Animals in some groups were given booster doses at weeks 3 and 6 after the primary immunization, whereas others were immunized only once. All experiments in mice were performed according to institutional guidelines.

Quantitative PCR. Two PCR primer sets were designed to selectively amplify subfragments of the Ad serotype 5 fiber gene. The primers Fb5.3 (5'GCATTGACTTGAAAGAGCCC3') and Fb3.3 (5'AGGAACCATAGCCTTGTTTG) encompass a 560-bp fragment of the fiber gene, whereas the primers Fb5.4 (5'GTAGCAGGAGGACTAAGGAT3') and Fb3.4 (5'TATCCAAGTTGTGGGCTGAG3') encompass a 139-bp subfragment within the 560-bp fragment. The sensitivity of a nested PCR procedure was determined as follows. A PCR mix containing 1 µg of genomic DNA extracted from the abdominal skin of a naïve mouse was spiked with dilutions of purified AdCMV-tetC vector DNA ranging from 1 to 10,000 copies, followed by 40 cycles of amplification with the Fb5.3/Fb3.3 primer pair. After purifying the PCR products with the QIAquick PCR purification kit (Qiagen, Inc., Valencia, Calif.), DNA was subjected to another 40 cycles of amplification with the Fb5.4/Fb3.4 primer pair. Naïve mouse skin DNA without the addition of Ad DNA templates was amplified with identical primer sets as a negative control. Following this amplification protocol, we consistently detected 10 or more copies 100% of the time in several independent experiments. It was therefore concluded that the sensitivity of the assay was 10 copies or less.

To quantitatively determine the number of vectors that were absorbed by the skin following topical application of an Ad-vectored vaccine, total DNA was extracted from the skin tissue underneath the patch at 1 and 24 h postimmunization. The skin was washed under tap water and blotted dry to remove any unbound vectors before resection. Purified DNA was diluted in 10-fold increments and subjected to amplification with the nested PCR protocol. The amount of DNA per PCR was kept constant by adding naïve mouse skin DNA to a final quantity of 1 µg. The highest dilution of a DNA sample that generated a detectable signal should contain the AdCMV-tetC vector in the range of 10 particles, under the assumption that each vector contains a single copy of the fiber gene. DNA was extracted using the DNAZOL solution (Life Technologies, Rockville, Md.) and amplified at an optimized annealing temperature (54°C) in a thermal cycler. Amplified DNA fragments were fractionated on a 1.5% agarose gel and visualized as described (28). Samples were scored as positive if the diagnostic band was detected.

ELISA. Titers of anti-TetC immunoglobulin G (IgG) were determined by enzyme-linked immunosorbent assay (ELISA) as described (18) using purified TetC protein (CalBiochem, San Diego, Calif.) as the capture antigen. Briefly, serum samples and peroxidase-conjugated goat anti-mouse IgG (Promega Corp., Madison, Wis.) were incubated sequentially on the plates with extensive washing between incubations. The endpoint was calculated as the dilution of serum producing the same optical density at 490 nm as a 1/100 dilution of preimmune serum. Sera negative at the lowest dilution tested were assigned endpoint titers of 1.

Challenge by live C. tetani. Mice were challenged by footpad injection of 6 × 103 (50% lethal dose [LD50], 12.5) or 6 × 104 (LD50, 125) C. tetani cells in a volume of 50 µl. Distortion of the backbone due to paralysis was taken as the disease end point. The LD50 was defined as the number of C. tetani cells capable of distorting the backbone of 50% of the mice in a group of 10 animals within a week following footpad injection. A toxigenic strain of C. tetani (ATCC number 9441; ATCC) was cultivated in the ATCC 38 beef liver medium for anaerobes at 37°C under anaerobic gas mixture (80% N2-10% CO2-10% H2). Gram-stained cells were counted under a light microscope using a hemacytometer. Animals either succumbed to the disease or were euthanatized when backbone distortion occurred.

Anti-Ad neutralizing antibody assay. Anti-Ad neutralizing antibodies were measured as cytopathic effect (CPE)-inhibiting antibodies by incubating diluted serum samples with 100 PFU of Ad at 4°C for 1 h, followed by adding the neutralized particles to 105 human 293 cells in a tissue culture well. CPEs were scored from triplicate samples daily by examining the monolayers under a light microscope. The assay was terminated when viruses mixed with a 1/10 dilution of preimmune serum produced 100% CPE (4 days postinfection in this experiment). Sera capable of completely inhibiting CPE (defined as the disruption of confluent monolayers) at the highest dilution tested were assigned endpoint CPE inhibition (CPEI) titers of 1. This assay tests the ability of specific antibodies to prevent Ad from infecting human 293 cells and measures a subset of neutralizing antibodies.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Elicitation of an anti-TetC humoral immune response. The AdCMV-tetC vector was used in these studies to permit administration of a vectored tetanus vaccine in a needle-free manner. The needle-free routes of administration included topical and intranasal inoculations. A DNA-based vaccine (pCMV-tetC) also was administered by these routes as well as by intramuscular injection as another control. We report here that the efficiency of vector absorption into the skin was very low, with approximately 1 in 4,000 particles being taken within 1 h of the topical application (Fig. 1A). Most of the vectors applied to the surface failed to bind to the skin and were subsequently washed away. No adverse effects associated with inoculation were observed in any of the immunized mice during the course of these studies. Absorption of AdCMV-tetC particles following topical application was more effective in eliciting an anti-TetC antibody response than intradermal or intramuscular injection of the same vector at equivalent doses, as determined by seroconversion, which was monitored by analysis of sera from tail bleeds for the production of IgG antibody directed against TetC by ELISA (Fig. 1B).


View larger version (23K):
[in this window]
[in a new window]
 
FIG. 1.   Outer layer of skin as immunocompetent tissue with low capacity to absorb vectors from the environment. (A) Determination of the number (#) of vectors absorbed by the skin following topical application. One and 24 h after topical application of 1010 particles of the AdCMV-tetC vector using a patch, the mouse abdominal skin underneath the patch was washed, blotted dry, resected, and immediately homogenized in the DNAZOL solution for DNA extraction. The number of skin-associated vectors per animal was determined quantitatively by amplifying subfragments of the adenoviral fiber gene with the nested PCR procedure in conjunction with limited dilutions, under the assumption that each vector contains a single fiber gene. Three individual animals were analyzed at each time point. The data shown are means ± standard deviations. (B) Comparison of different modes for vaccine administration. AdCMV-tetC particles of various doses were inoculated into mice by topical application and intradermal and intramuscular injection. Animals were immunized only once. Sera were harvested for ELISA-based anti-TetC analysis 3 and 6 weeks postimmunization. NIVS-1, mice immunized by topical application of 1010 Ad particles with approximately 106 particles absorbed by the skin, as determined by the method described in panel A; ID-1, mice immunized by intradermal injection of 106 Ad particles; ID-2, mice immunized by intradermal injection of 108 Ad particles; ID-3, mice immunized by intradermal injection of 1010 Ad particles; IM-1, mice immunized by intramuscular injection of 106 Ad particles; IM-2, mice immunized by intramuscular injection of 108 Ad particles; IM-3, mice immunized by intramuscular injection of 1010 Ad particles. The data shown are GMTs for anti-TetC antibodies (5 animals per group for ID-1 and IM-3; 10 animals per group for NIVS-1, ID-2, ID-3, IM-1, and IM-2). No anti-TetC antibodies were detectable in some groups (both 3 and 6 weeks postimmunization in ID-1; 3 weeks postimmunization in IM-1), and low columns representing negative responses were included for visualization.

Seroconversion was observed in all of the mice immunized intranasally with >= 106 particles (groups B to E, M, and P to R) (Table 1) or topically with >= 109 particles (groups I, J, N, and T to V) (Table 1) of the AdCMV-tetC vector. The anti-TetC geometric mean titer (GMT) increased as the dose of AdCMV-tetC escalated (groups B to E and G to I) (Table 1). The level of anti-TetC reached a plateau when >= 109 particles of AdCMV-tetC were applied topically (groups I and J) (Table 1).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Summary of immune responses in micea

The TetC-specific IgG response of the mice that were administered AdCMV-tetC through application of an epicutaneous patch could be boosted to a high-titer response by three consecutive applications of the patch (GMT = 29,406 for group U compared to GMT = 5,971 for group T) (Table 1). The highest titers of antibody were observed in the mice administered AdCMV-tetC by the intranasal route (GMT >=  409,600; groups E, P, and Q) (Table 1). Intranasal boosting did not result in a significant increase in the anti-TetC titer (group P compared to group Q) (Table 1). Intramuscular injection of 100 µg (equivalent to approximately 1013 copies) of pCMV-tetC DNA induced seroconversion in all animals; however, only a weak immune response was produced (GMT = 1,055; group W) (Table 1). Intranasal inoculation (group A) (Table 1) and topical application (group F) (Table 1) of pCMV-tetC DNA were ineffective in eliciting any detectable anti-TetC antibodies.

Protection against tetanus following live bacterial challenge. Seroconversion does not necessarily confer protection. Therefore, the protective effects of the vaccination regimens were determined by challenge with a toxigenic strain of C. tetani injected in the footpad at a dose of 6 × 103 cells (LD50, 12.5). On such challenge, unprotected mice inevitably succumbed to tetanus with paralysis of the inoculated paw followed by distortion of the backbone and death. Administration of AdCMV-tetC as a nasal vaccine at a dose of >= 107 particles conferred complete protection in all animals after a single inoculation or three consecutive inoculations (P < 0.001) (Table 1; Fig. 2A and 3A). Full protection was also achieved after three consecutive applications of 1010 particles of AdCMV-tetC as an epicutaneous vaccine (P < 0.001), with 80% of the mice being protected (P < 0.001) by a single application (Table 1; Fig. 2B and 3B). All naïve animals that were not immunized (group X), as well as mice immunized with an irrelevant Ad vector (i.e., AdCMV-PR8.ha in groups O and S), were paralyzed severely or succumbed to tetanus within 4 days (Table 1; Fig. 3). Some mice that survived the challenge have been kept alive for up to 4 months and no symptoms of tetanus developed in any of the animals after day 10. Analysis of the anti-TetC IgG levels in the mice indicated that 100% survival was correlated with an anti-TetC titer of >6,400, although some animals with a lower titer could still survive the challenge.


View larger version (37K):
[in this window]
[in a new window]
 
FIG. 2.   Dose-response protection against tetanus after bacterial challenge. Animals were immunized by inoculation with Ad-vectored vaccines at escalating doses. Five weeks postimmunization, mice were challenged by footpad injection of a lethal dose (6 × 103) of live C. tetani cells and monitored daily for survival for 14 days. (A) Dose-response protection against tetanus by a single intranasal inoculation of the AdCMV-tetC vector at an escalating dose. Groups B to E, mice were immunized by intranasal inoculation of the AdCMV-tetC vector at an escalating dose (106 to 109 particles; the specific dose for each group is shown in Table 1); group A, mice were immunized by intranasal inoculation of 100 µg of pCMV-tetC DNA. (B) Dose-response protection against tetanus by a single topical application of the AdCMV-tetC vector at an escalating dose. Groups G to J, mice were immunized by topical application of the AdCMV-tetC vector at an escalating dose (107 to 1010 particles; the specific dose for each group is shown in Table 1); group F, mice were immunized by topical application of 100 µg of pCMV-tetC DNA. The data were plotted as percent survival versus number of days after challenge. Numbers in parentheses represent the number of animals for each treatment.


View larger version (29K):
[in this window]
[in a new window]
 
FIG. 3.   Effects of booster applications in protecting mice against tetanus after bacterial challenge. Mice were immunized either once or three times at intervals of 3 weeks. Eight weeks after the primary immunization, mice were challenged by footpad injection of 6 × 103 C. tetani cells and monitored daily for survival for 14 days. (A) Mice were immunized by intranasal inoculation with Ad vectors. Group O, intranasal inoculation with AdCMV-PR8.ha three times; group P, intranasal inoculation with AdCMV-tetC once; group Q, intranasal inoculation with AdCMV-tetC three times. (B) Mice were immunized by topical application of Ad vectors. Group S, topical application of AdCMV-PR8.ha three times; group T, topical application of AdCMV-tetC once; group U, topical application of AdCMV-tetC three times; group X, naïve control mice. The data were plotted as described in the legend to Fig. 2. Numbers in parentheses represent the number of animals for each treatment.

Only 10% of the mice (group W) were protected by a single intramuscular injection of 100 µg of pCMV-tetC DNA despite a low-level seroconversion that occurred in all animals (Table 1). This low potency is consistent with a report that intramuscular injection of DNA is not very effective in protecting mice against tetanus (16).

We have defined the limit of the protective capacity of current Ad-vectored vaccines. A single inoculation of epicutaneous vaccines by topical application of 1010 AdCMV-tetC particles conferred no protection when animals were challenged with 6 × 104 C. tetani cells (LD50, 125; group N), whereas a single intranasal inoculation of 109 AdCMV-tetC particles protected only 20% of the immunized mice when challenged at this high dose (group M) (Table 1; Fig. 4). It is conceivable that larger animals with anti-TetC of the same titer may be able to counteract a higher number of invading bacteria because there are more neutralizing antibody molecules in the reservoir, and more toxin molecules may be required to paralyze a larger animal.


View larger version (23K):
[in this window]
[in a new window]
 
FIG. 4.   Protective capacity of Ad-vectored vaccines. Five weeks postimmunization, mice were challenged by footpad injection of either 6 × 103 or 6 × 104 C. tetani cells and monitored daily for survival for 14 days. Groups E and M, mice immunized by a single intranasal inoculation with AdCMV-tetC vectors were challenged with 6 × 103 and 6 × 104 C. tetani cells, respectively; groups J and N, mice immunized by a single topical application of AdCMV-tetC vectors were challenged with 6 × 103 and 6 × 104 C. tetani cells, respectively; group L, naïve mice were challenged with 6 × 104 C. tetani cells. The data were plotted as described in the legend to Fig. 2. Numbers in parentheses represent the number of animals for each treatment.

Protection in the context of preexisting immunity to Ad. The possibility that preexisting immunity to Ad could interfere with the ability of an Ad-vectored vaccine to elicit a protective immune response was considered. We investigated this possibility by inoculating the mice intranasally with Ad5 2 weeks prior to the primary administration of the vaccine. Anti-Ad neutralization antibodies were subsequently detected in all mice with exposure to Ad5 (CPEI GMT = 171 for group R and CPEI GMT = 197 for group V) (Table 1).

Even though the animals had preexisting immunity to Ad, administration of AdCMV-tetC either intranasally or through an epicutaneous patch induced an IgG response to TetC (GMT = 382,170 for group R; GMT = 1,866 for group V) (Table 1). Protection against C. tetani challenge was unaffected by preexisting immunity to Ad in the mice that were administered AdCMV-tetC intranasally (group R, P < 0.001) (Fig. 5A). Although preexisting immunity did affect the level of protection conferred by the vaccine administered through the epicutaneous patch (group V, P = 0.003) (Fig. 5B), protection was positively demonstrated. Therefore, the immune repertoire can be mobilized toward a protective response against live C. tetani-mediated pathogenesis either by intranasal inoculation or topical application of an Ad-vectored vaccine in animals that have preexisting immunity to Ad.


View larger version (29K):
[in this window]
[in a new window]
 
FIG. 5.   Protection in the context of preexisting immunity to Ad. Two groups of mice were inoculated intranasally with 109 particles of Ad5 2 weeks prior to the primary immunization. Eight weeks after immunization with the AdCMV-tetC vector, animals were challenged by footpad injection of 6 × 103 C. tetani cells and monitored daily for survival for 14 days. (A) Protection by intranasal inoculation. Groups R and Q, mice immunized by intranasal inoculation with the AdCMV-tetC vector with and without preexposure to Ad5, respectively. (B) Protection by topical application of a patch. Groups V and U, mice immunized by topical application of the AdCMV-tetC vector with and without preexposure to Ad5, respectively. Groups O, S, and X are control groups described in the legend to Fig. 3. The data were plotted as described in the legend to Fig. 2. Numbers in parentheses represent the number of animals for each treatment.


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

A new generation of vaccines is required if the effectiveness of the global vaccine programs is to be enhanced. This demonstration that intranasal inoculation or topical application of an Ad-vectored vaccine results in statistically and preclinically significant protection against tetanus in mice ushers in two new modalities for the needle-free administration of tetanus vaccines. The vaccine used in these studies was a recombinant Ad vector encoding the atoxic C fragment of the tetanus toxin. The use of Ad-vectored vaccines is an attractive strategy due to its efficacy in eliciting an immune response. Another positive aspect of this strategy is the possible negation of the current requirement for an unbroken cold chain, since lyophilized Ad vectors can be reconstituted into active infectious particles (5).

Although all naïve mice and those immunized with irrelevant control vectors were paralyzed within 4 days of challenge, the partially protected animals exhibited symptoms of tetanus at a later date. Death occurred in some partially protected animals as late as 10 days postchallenge (Fig. 5B). This suggests that there is a critical initial time period during infection with C. tetani in which the host immune system is undergoing mobilization prior to achieving a response sufficient to eradicate the pathogen. Although the effectiveness of a tetanus vaccine may depend on its ability to rapidly induce adequate levels of antitoxin, it remains to be seen whether an anti-TetC cellular immune response (16) is involved in the eradication of live C. tetani cells in vivo.

Ad-vectored nasal vaccine elicited high titers of anti-TetC antibodies after a single administration, and these levels were not increased by short-term booster inoculations (groups P and Q). Moreover, as reported previously for rabies (27), the high titers were not suppressed appreciably by preexposure to Ad (groups Q and R). The potency of the intranasal inoculation may reflect the natural tropism of the Ad vector for the airway, where it can transduce a large number of cells and possibly activate the mucosal immune machinery to its full potential.

Although administration of the Ad-vectored vaccine through an epicutaneous patch was capable of causing seroconversion and was effective in protecting the animals from challenge with live C. tetani particularly after boosting, the titers of anti-TetC antibodies were relatively low when compared to those elicited by intranasal inoculations. Several strategies for optimization of the response can be envisioned. As boosting was effective in these studies, the immune response could be enhanced by applying the vaccine patch multiple times or over a large area. The efficacy of epicutaneous administration also may be enhanced by increasing the affinity of the Ad vector for specific cell types within the outer layer of skin (e.g., terminally differentiated keratinocytes, antigen-presenting cells that traffic to the surface, or other cell types along the skin barrier), which may be achieved by inserting a preselected ligand into the adenoviral fiber as previously described (6, 25) in an attempt to augment transduction efficiency in a targeted manner. Such a "skin-binding" vector could be a more effective carrier for epicutaneous vaccines than the current Ad vector due to the overexpression of antigens in specific cell types that are potent immunostimulators.

Emerging evidence suggests that the outer layer of skin may be more immunocompetent than deep tissues (7, 9) (Fig. 1B). It is also conceivable that the immune system may focus its surveillance on an interface that is in frequent contact with environmental pathogens. Overexpression of immunogens from a small number of vectored vaccines in the outer layer of skin may thus elicit a more potent immune response than the inoculation of an equivalent dose into deep tissues. This is borne out by the magnitude of the immune response that was elicited (Table 1 and Fig. 1B) by a relatively low number of vectors absorbed following topical application (Fig. 1A). However, it is unclear whether the leveling off of vaccine potency following topical application of AdCMV-tetC at a dose of >= 109 particles (groups G to J) (Table 1) was due to saturation of the antigen expression machinery or the antigen presenting capacity within a restricted subset of skin. A skin-targeted vector may amplify antigen expression in the outer layer of skin; however, strategies to mobilize antigen-presenting cells will have to be exploited if antigen presentation should appear to be the limiting step.

The suppression of the efficacy of the Ad-vectored epicutaneous vaccine by preexisting immunity to Ad (Table 1 and Fig. 5) is a problem that must be circumvented during the development of an Ad-vectored vaccine patch. It is likely that the suppression may not be attributed to anti-Ad antibodies that prevent Ad vectors from entering target cells, because a reporter gene (i.e., luciferase) can be effectively expressed in skin from an Ad vector following topical application in mice with preexposure to Ad (data not shown). It is also conceivable that anti-Ad antibodies may not be able to reach the surface of skin in sufficient quantities to neutralize concentrated vectors. A skin-targeted vector may lessen the impact of preexisting immunity to Ad by overexpressing antigens. Alternatively, the capacity for a gutless Ad (3) to mediate long-term transgene expression in immunocompetent animals also may allow an epicutaneous vaccine to elicit a potent immune response in the presence of preexisting anti-Ad immunity if immunosuppression is attributed to rapid elimination of transduced cells by an anti-Ad cellular immune response.

The rapid loss of vector DNA observed in these studies after topical application (Fig. 1A) may be beneficial in preventing the persistence of exogenous DNA. Presumably, the mechanisms that have evolved to degrade or expel skin-associated environmental DNA in order to protect the genomic integrity of the host may contribute to the elimination of the vector DNA following topical application. In contrast to the short half-life of vectored epicutaneous vaccines, DNA-based vaccines have been reported to persist in animals for up to a year after intramuscular injections (26). Conceivably, the degradation of vectored epicutaneous vaccines may contribute to not only a safer vaccine but also a more effective one, as the transient expression of antigens in vivo could foster the longevity of memory T cells by minimizing antigen-induced apoptosis of T lymphocytes (19, 29). If efficacy should be limited by overdegradation, the problem potentially can be circumvented by booster applications as shown in this report (Table 1 and Fig. 3B).

It has been demonstrated previously that topical application of TetC protein in conjunction with cholera toxin is capable of eliciting anti-TetC antibodies in mice (10). It is unclear, however, whether a protein-based epicutaneous vaccine is able to protect animals against bacterial infections. The profile of the immune response elicited by vectored vaccines may be quite different from that induced by their protein-based counterparts since the vector DNA dictates the synthesis of exogenous proteins in animals' own cells after inoculation, and antigens produced in situ can often induce a more solid immunity than inoculation of protein-based vaccines (14). Evidence suggests that an Ad vector encoding TetC could be more effective than the TetC protein as an epicutaneous vaccine since the latter required the coadministration of cholera toxin as an adjuvant (10), whereas topical application of the AdCMV-tetC vector alone was able to protect all of the recipients against challenge with live C. tetani (Fig. 3B). Although topical application of plasmid DNA also has been shown capable of eliciting an antibody response (1, 8, 18), it has not been demonstrated that this modality can evoke any protective immunity. Topical application of naked plasmid DNA, in the absence of an association with Ad or liposome, produced no detectable gene expression in the skin (4, 18), and we report here that naked plasmid DNA was ineffective in eliciting an anti-TetC antibody response or a protective immune response against tetanus following either topical or intranasal inoculations (Table 1 and Fig. 2). The potency of an Ad-vectored vaccine may be attributed to an efficient gene delivery in conjunction with robust transgene expression when compared to its plasmid counterpart (21).

In these studies, intranasal inoculation was more effective than topical application with respect to eliciting an immune response, although this difference may be attributed, in part, to the low absorption efficiency of the skin (Fig. 1A). There are, however, some issues that detract from the practicality of intranasal administration of vaccines. A major concern is the possibility of the elicitation of a severe adverse pulmonary reaction in those individuals who are allergic to components of the vaccine or in individuals with underlying pulmonary disease. Moreover, intranasal administration can irritate the nose, causing responses that result in expulsion of an unpredictable amount of the vaccine.

The recent report that a humoral immune response could be elicited in humans by topical application of a vaccine patch (11) suggests that the outer layer of human skin may be as immunocompetent as that of their animal counterparts. Although an experimental murine tumor could be arrested following topical application of tumor epitope peptides (17), it has not been demonstrated, prior to our studies, that a pathogen of human relevance could be arrested following topical application of any vaccines. We have shown, for the first time, that topical application of a vectored vaccine patch in a noninvasive manner could protect animals against infection by live bacteria in a disease setting.

By expressing antigens in an immunocompetent area without causing tissue damage, nasal and epicutaneous vaccines may emerge as preferred modalities for the inoculation of future vaccines in a simple, effective, economical, painless, and safe manner.


    ACKNOWLEDGMENTS

We thank M. Alder and D. Curiel for their support, F. Hunter and D. Grove for editorial assistance, L. Timares for critical reading of the manuscript, P. Bucy for consultation, J. VanCott and J. McGhee for providing the plasmid pTET-nir, R. Gerard for providing the plasmid pACCMV.PLPA, F. Graham for providing the plasmid pJM17, and Vical, Inc., for providing the plasmid pVR-1012. We also thank M. Kinzalow, S. Smith, and S. Lorengel for technical assistance.

This work was supported by National Institutes of Health grants 2-R42-AI44520-02, 1-R41-AI44520-01, and 1-R43-AI43802-01; Office of Naval Research grant N00014-01-1-0945; U.S. Army grant DAMD-17-98-1-8173; and investments from the Emerging Technology Partners and the Paradigm Venture Partners I, LLC. D.-C.C.T. was also supported by the Year 2000 Wallace H. Coulter Award for Innovation and Entrepreneurship, and M.Z. was supported by a postdoctoral fellowship from the Dermatology Foundation and Mary Kay Holding Corporation.


    FOOTNOTES

* Corresponding author. Mailing address: Department of Dermatology, University of Alabama at Birmingham, VH-501, 1670 University Blvd., Birmingham, AL 35294-0019. Phone: (205) 975-5603. Fax: (205) 975-0455. E-mail: dctang{at}uab.edu.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Carson, D. A., and E. Raz. October 1997. Methods and devices for immunizing a host against tumor-associated antigens through administration of naked polynucleotides which encode tumor-associated antigenic peptides. U.S. patent 5,679,647.
2. Chatfield, S. N., I. G. Charles, A. J. Makoff, M. D. Oxer, G. Dougan, D. Pickard, D. Slater, and N. F. Fairweather. 1992. Use of the nirB promoter to direct the stable expression of heterologous antigens in Salmonella oral vaccine strains: development of a single-dose oral tetanus vaccine. Bio/Technology 10:888-892[CrossRef][Medline].
3. Chen, H. H., L. M. Mack, R. Kelly, M. Ontell, S. Kochanek, and P. R. Clemens. 1997. Persistence in muscle of an adenoviral vector that lacks all viral genes. Proc. Natl. Acad. Sci. USA 94:1645-1650[Abstract/Free Full Text].
4. Ciernik, I. F., B. H. Krayenbuhl, and D. P. Carbone. 1996. Puncture-mediated gene transfer to the skin. Hum. Gene Ther. 7:893-899[Medline].
5. Croyle, M. A., D. J. Anderson, B. J. Roessler, and G. L. Amidon. 1998. Development of a highly efficient purification process for recombinant adenoviral vectors for oral gene delivery. Pharm. Dev. Technol. 3:365-372[Medline].
6. Dmitriev, I., V. Krasnykh, C. R. Miller, M. Wang, E. Kashentseva, G. Mikheeva, N. Belousova, and D. T. Curiel. 1998. An adenovirus vector with genetically modified fibers demonstrates expanded tropism via utilization of a coxsackievirus and adenovirus receptor-independent cell entry mechanism. J. Virol. 72:9706-9713[Abstract/Free Full Text].
7. Eisenbraun, M. D., D. H. Fuller, and J. R. Haynes. 1993. Examination of parameters affecting the elicitation of humoral immune responses by particle bombardment-mediated genetic immunization. DNA Cell Biol. 12:791-797[Medline].
8. Fan, H., Q. Lin, G. R. Morrissey, and P. A. Khavari. 1999. Immunization via hair follicles by topical application of naked DNA to normal skin. Nat. Biotechnol. 17:870-872[CrossRef][Medline].
9. Fynan, E. F., R. G. Webster, D. H. Fuller, J. R. Haynes, J. C. Santoro, and H. L. Robinson. 1993. DNA vaccines: protective immunizations by parenteral, mucosal, and gene-gun inoculations. Proc. Natl. Acad. Sci. USA 90:11478-11482[Abstract/Free Full Text].
10. Glenn, G. M., T. Scharton-Kersten, R. Vassell, G. R. Matyas, and C. R. Alving. 1999. Transcutaneous immunization with bacterial ADP-ribosylating exotoxins as antigens and adjuvants. Infect. Immun. 67:1100-1106[Abstract/Free Full Text].
11. Glenn, G. M., D. N. Taylor, X. Li, S. Frankel, A. Montemarano, and C. R. Alving. 2000. Transcutaneous immunization: a human vaccine delivery strategy using a patch. Nat. Med. 6:1403-1406[CrossRef][Medline].
12. Gomez-Foix, A. M., W. S. Coats, S. Baque, T. Alam, R. D. Gerard, and C. B. Newgard. 1992. Adenovirus-mediated transfer of the muscle glycogen phosphorylase gene into hepatocytes confers altered regulation of glycogen metabolism. J. Biol. Chem. 267:25129-25134[Abstract/Free Full Text].
13. Kozak, M. 1986. Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell 44:283-292[CrossRef][Medline].
14. McDonnell, W. M., and F. K. Askari. 1996. DNA vaccines. N. Engl. J. Med. 334:42-45[Free Full Text].
15. Parker, S. E., F. Borellini, M. L. Wenk, P. Hobart, S. L. Hoffman, R. Hedstrom, T. Le, and J. A. Norman. 1999. Plasmid DNA malaria vaccine: tissue distribution and safety studies in mice and rabbits. Hum. Gene Ther. 10:741-758[CrossRef][Medline].
16. Saikh, K. U., J. Sesno, P. Brandler, and R. G. Ulrich. 1998. Are DNA-based vaccines useful for protection against secreted bacterial toxins? Tetanus toxin test case. Vaccine 16:1029-1038[CrossRef][Medline].
17. Seo, N., Y. Tokura, T. Nishijima, H. Hashizume, F. Furukawa, and M. Takigawa. 2000. Percutaneous peptide immunization via corneum barrier-disrupted murine skin for experimental tumor immunoprophylaxis. Proc. Natl. Acad. Sci. USA 97:371-376[Abstract/Free Full Text].
18. Shi, Z., D. T. Curiel, and D. C. Tang. 1999. DNA-based non-invasive vaccination onto the skin. Vaccine 17:2136-2141[CrossRef][Medline].
19. Swain, S. L., H. Hu, and G. Huston. 1999. Class II-independent generation of CD4 memory T cells from effectors. Science 286:1381-1383[Abstract/Free Full Text].
20. Tang, D. C., R. S. Jennelle, Z. Shi, R. I. Garver, Jr., D. P. Carbone, F. Loya, C.-H. Chang, and D. T. Curiel. 1997. Overexpression of adenovirus-encoded transgenes from the cytomegalovirus immediate early promoter in irradiated tumor cells. Hum. Gene Ther. 8:2117-2124[Medline].
21. Tang, D. C., S. A. Johnston, and D. P. Carbone. 1994. Butyrate-inducible and tumor-restricted gene expression by adenovirus vectors. Cancer Gene Ther. 1:15-20[Medline].
22. Tang, D. C., Z. Shi, and D. T. Curiel. 1997. Vaccination onto bare skin. Nature 388:729-730[CrossRef][Medline].
23. Udwadia, F. E. (ed.). 1994. Tetanus. Oxford, New York, N.Y.
24. Ulmer, J. B., J. J. Donnelly, S. E. Parker, G. H. Rhodes, P. L. Felgner, V. J. Dwarki, S. H. Gromkowski, R. R. Deck, C. M. DeWitt, A. Friedman, L. A. Hawe, K. R. Leander, D. Martinez, H. C. Perry, J. W. Shiver, D. L. Montgomery, and M. A. Liu. 1993. Heterologous protection against influenza by injection of DNA encoding a viral protein. Science 259:1745-1748[Abstract/Free Full Text].
25. Wickham, T. J., E. Tzeng, L. L. Shears, P. W. Roelvink, Y. Li, G. M. Lee, D. E. Brough, A. Lizonova, and I. Kovesdi. 1997. Increased in vitro and in vivo gene transfer by adenovirus vectors containing chimeric fiber proteins. J. Virol. 71:8221-8229[Abstract].
26. Wolff, J. A., J. J. Ludtke, G. Acsadi, P. Williams, and A. Jani. 1992. Long-term persistence of plasmid DNA and foreign gene expression in mouse muscle. Hum. Mol. Genet. 1:363-369[Abstract/Free Full Text].
27. Xiang, Z. Q., Y. Yang, J. M. Wilson, and H. C. J. Ertl. 1996. A replication-defective human adenovirus recombinant serves as a highly efficacious vaccine carrier. Virology 219:220-227[CrossRef][Medline].
28. Zeng, M., S. K. Smith, F. Siegel, Z. Shi, K. R. Van Kampen, C. A. Elmets, and D. C. Tang. 2001. AdEasy system made easier by selecting the viral backbone plasmid preceding homologous recombination. BioTechniques 31:260-262[Medline].
29. Zinkernagel, R. M., and H. Hengartner. 2001. Regulation of the immune response by antigen. Science 293:251-253[Abstract/Free Full Text].


Journal of Virology, December 2001, p. 11474-11482, Vol. 75, No. 23
0022-538X/01/$04.00+0   DOI: 10.1128/JVI.75.23.11474-11482.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Toro, H., Tang, D. C. (2009). Protection of chickens against avian influenza with nonreplicating adenovirus-vectored vaccine. Poult. Sci. 88: 867-871 [Abstract] [Full Text]  
  • Vogt, A., Mahe, B., Costagliola, D., Bonduelle, O., Hadam, S., Schaefer, G., Schaefer, H., Katlama, C., Sterry, W., Autran, B., Blume-Peytavi, U., Combadiere, B. (2008). Transcutaneous Anti-Influenza Vaccination Promotes Both CD4 and CD8 T Cell Immune Responses in Humans. J. Immunol. 180: 1482-1489 [Abstract] [Full Text]  
  • Armelini, M. G., Lima-Bessa, K. M., Marchetto, M. C. N., Muotri, A. R., Chigancas, V., Leite, R. A., Carvalho, H., Menck, C. F. M. (2007). Exploring DNA damage responses in human cells with recombinant adenoviral vectors. Hum Exp Toxicol 26: 899-906 [Abstract]  
  • Zhang, J., Shi, Z., Kong, F.-k., Jex, E., Huang, Z., Watt, J. M., Van Kampen, K. R., Tang, D.-c. C. (2006). Topical Application of Escherichia coli-Vectored Vaccine as a Simple Method for Eliciting Protective Immunity.. Infect. Immun. 74: 3607-3617 [Abstract] [Full Text]  
  • DeCarlo, A.A., Whitelock, J.M. (2006). The Role of Heparan Sulfate and Perlecan in Bone-regenerative Procedures. JDR 85: 122-132 [Abstract] [Full Text]  
  • Marchetto, M. C. N., Muotri, A. R., Burns, D. K., Friedberg, E. C., Menck, C. F. M. (2004). Gene transduction in skin cells: Preventing cancer in xeroderma pigmentosum mice. Proc. Natl. Acad. Sci. USA 101: 17759-17764 [Abstract] [Full Text]  
  • Yang, T. C., Dayball, K., Wan, Y. H., Bramson, J. (2003). Detailed Analysis of the CD8+ T-Cell Response following Adenovirus Vaccination. J. Virol. 77: 13407-13411 [Abstract] [Full Text]  
  • Xiang, Z. Q., Gao, G. P., Reyes-Sandoval, A., Li, Y., Wilson, J. M., Ertl, H. C. J. (2003). Oral Vaccination of Mice with Adenoviral Vectors Is Not Impaired by Preexisting Immunity to the Vaccine Carrier. J. Virol. 77: 10780-10789 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shi, Z.
Right arrow Articles by Tang, D.-C. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shi, Z.
Right arrow Articles by Tang, D.-C. C.