Previous Article | Next Article 
Journal of Virology, December 2001, p. 11344-11353, Vol. 75, No. 23
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.23.11344-11353.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Functional Interactions of Human Immunodeficiency
Virus Type 1 Integrase with Human and Yeast HSP60
Vincent
Parissi,1,2,*
Christina
Calmels,1,2
Vaea Richard
De Soultrait,1,2
Anne
Caumont,2,3
Michel
Fournier,1,2
Stéphane
Chaignepain,4 and
Simon
Litvak1,2
REGER, UMR-5097 Centre National de la
Recherche Scientifique (CNRS)-Université Victor Segalen Bordeaux
2,1 Laboratoire de Virologie,
Hôpital Pellegrin,3
IBGC-CNRS,4 and IFR66
Pathologies infectieuses,2 Bordeaux,
France
Received 19 January 2001/Accepted 17 August 2001
 |
ABSTRACT |
Integration of human immunodeficiency virus type 1 (HIV-1) proviral
DNA in the nuclear genome is catalyzed by the retroviral integrase
(IN). In addition to IN, viral and cellular proteins associated in the
high-molecular-weight preintegration complex have been suggested to be
involved in this process. In an attempt to define host factors
interacting with IN, we used an in vitro system to identify cellular
proteins in interaction with HIV-1 IN. The yeast Saccharomyces
cerevisiae was chosen since (i) its complete sequence has been
established and the primary structure of all the putative proteins from
this eucaryote has been deduced, (ii) there is a significant degree of
homology between human and yeast proteins, and (iii) we have previously
shown that the expression of HIV-1 IN in yeast induces a lethal
phenotype. Strong evidences suggest that this lethality is linked to IN
activity in infected human cells where integration requires the
cleavage of genomic DNA. Using IN-affinity chromatography we identified
four yeast proteins interacting with HIV-1 IN, including the yeast
chaperonin yHSP60, which is the counterpart of human hHSP60. Yeast
lethality induced by HIV-1 IN was abolished when a mutated HSP60 was
coexpressed, therefore suggesting that both proteins interact in vivo.
Besides interacting with HIV-1 IN, the hHSP60 was able to stimulate the in vitro processing and joining activities of IN and protected this
enzyme from thermal denaturation. In addition, the functional human
HSP60-HSP10 complex in the presence of ATP was able to recognize the
HIV-1 IN as a substrate.
 |
INTRODUCTION |
The HIV-1 integrase IN catalyzes a
critical step in the infectious cycle of this retrovirus. The mechanism
leading to the integration of the proviral DNA into the host genome can
be divided into two separate reactions (1). HIV-1 IN
catalyzes first a hydrolytic reaction of the proviral DNA substrate,
termed "processing," and second a transesterification step termed
"joining" or "strand transfer," which allows the insertion of
the provirus into the nuclear genome. In the processing reaction where
OH
is the nucleophilic agent, IN is able to
endonucleolytically remove in vitro two nucleotides from an
oligonucleotide (ODN) mimicking the retroviral LTR ends of HIV-1. In
the joining or strand transfer reaction, by using the processed LTR as
a nucleophile, IN catalyzes a transesterification hydrolytic reaction.
The resulting double-stranded proviral DNA is part of a large
nucleoprotein structure termed the PIC. This complex contains the
information necessary for nuclear localization and the enzymatic
machinery required to insert the proviral DNA into the host genome (for a review of the PIC, see reference 4). In addition to IN
and the proviral DNA, the PIC has been reported to contain various viral and cellular proteins. However, a precise description of the
viral and cellular partners involved in this complex is not yet well defined.
Although recombinant IN purified from Saccharomyces
cerevisiae or bacteria can perform all the in vitro
reactions using synthetic substrates (9), there is much
evidence that proteins present in cytoplasmic extracts from uninfected
cells are also involved in the integration process. Two proteins, the
barrier-to-autointegration factor and HMG I(Y), have been identified as
specific cofactors (8, 17). In addition, Kalpana et al.
(21), using the yeast two-hybrid system, reported the
isolation of a host factor, the integrase-interacting protein 1 (Ini1),
as a binding partner of HIV-1 IN. Ini1 displays a high degree of
sequence similarity to the yeast protein SNF5, a factor involved in the
transcriptional activation of a number of genes.
We have previously shown that the expression of HIV-1 IN in yeast
induces a lethal phenotype (5), while the expression of an
inactive mutated IN does not. These results strongly suggest that the
lethal phenotype could be due to cell death by DNA damage induced by
the IN activity. Moreover, the inactivation of the SNF5
transcription factor gene abolished the lethal phenotype induced by the
expression of HIV-1 IN in yeast, indicating that SNF5 is able to
interact with HIV-1 IN in vivo (29). Therefore, the use of
the yeast system should facilitate the identification of IN-interacting
proteins, thus allowing further studies in a cellular context by
exploring the effect of gene inactivation on the IN-induced lethal effect.
To identify yeast cellular proteins in addition to SNF5, whose human
counterparts might participate in retroviral DNA integration, we
developed an in vitro system to detect the interactions between HIV-1
IN and S. cerevisiae proteins. Using IN-affinity
chromatography, we identified four yeast proteins which are highly
homologous to their human counterparts. We focused our interest on one
of these proteins corresponding to the ubiquitous chaperone HSP60. Here
we describe the functional characterization of the interactions between
hHSP60 and HIV-1 IN. We also show that hHSP60 stimulates both in vitro
processing and joining IN activities. In addition to interacting with
hHSP60, HIV-1 IN was also recognized as a substrate by the functional
hHSP60-HSP10 complex.
 |
MATERIALS AND METHODS |
Abbreviations.
HIV-1, human immunodeficiency virus
type 1; IN, integrase; PIC, preintegration complex; RT, reverse
transcriptase; LTR, long terminal repeat; hHSP60, human HSP60; yHSP60,
yeast HSP60; BSA, bovine serum albumin; CHAPS,
3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate; DTT,
dithiothreitol; NHS, N-hydroxysuccinimide; ODN,
oligodeoxynucleotide; SDS-PAGE, sodium dodecyl sulfate-polyacrylamide
gel electrophoresis; TFA, trifluoroacetic acid ; ELISA, enzyme-linked
immunosorbent assay; PBS, phosphate-buffered saline.
Yeast strains, culture media, growth conditions, and yeast
transformation.
The diploid yeast strain W303 a/
(MATa/
ura3/ura3 leu2/leu2
ade3/ade3 his3/his3 trp1/trp1) was used to perform the yeast
lethal assay (14) The protein extracts were obtained from
yeast strain JSC310 (MAT
ura3-52 leu2
trp1 prb1-1122 pep4-3 prc1-407) or JSC310
(IN) transformed with pHIV1-SF2IN (5). The W303
a/
temperature-sensitive strain expressing HSP60 G432D
(35) and the W303 a/
temperature-sensitive
strain (Yep351) expressing both HSP60 G432D and SCS1, derived from the diploid yeast strain W303 a/
, were used to study the in vivo effect of HSP60. Culture media used were (i) yeast complete medium
YEPD (1% yeast extract, 2% Bacto Peptone, 2% glucose), (ii) yeast
selective medium (YNB lacking uracil and leucine [0.67% yeast
nitrogen base without amino acids, 0.1 to 8% glucose]), and (iii)
YCAD lacking uracil (YNB supplemented with 0.5% Casamino Acids). Amino
acids and bases (20 to 30 mg/liter) were added as required. Liquid
cultures were performed in Erlenmeyer flasks filled to a fifth of their
capacity and then shaken. Solid media were obtained by supplementing
liquid media with 2% Bacto Agar. Yeast strains were grown at 30°C.
Yeast transformation was performed using LiCl as described
(7).
Yeast lethality assay.
The effect of IN and HSP60 on yeast
growth was assayed using the "drop test" (5).
Three-microliter droplets of plasmid-containing yeast standard
suspension (about 20 000 URA+ yeast cells) were
dropped on YNB solid medium lacking leucine and containing 0.1%
glucose to allow high IN expression. Petri dishes were incubated for 3 days at 30°C, and then phenotypes were observed.
Bacterial strains, culture media, transformation procedure, DNA
preparation, and DNA analysis.
The Escherichia coli
strain DH5
was used for plasmid amplification, and the bacterial
transformation was performed as described (16). BL21(DE3)
was used for expression of the His-tagged IN. Bacteria were grown on
standard Luria-Bertani medium containing ampicillin (50 µg/ml).
Plasmids were extracted from bacteria using the boiling method
(24). DNA restriction endonucleases and DNA ligase were
used under conditions recommended by the supplier (Promega). DNA
fragments were analyzed by electrophoresis on 1% agarose gel in the
presence of ethidium bromide (0.5 µg/ml) under UV light.
Plasmid vectors.
The HIV-1 IN gene was from a cloned
genomic provirus obtained from a San Francisco isolate (SF2)
(33). The expression vectors were derived from the
yeast-E. coli shuttle plasmid pBS24.1, previously described
(5). This plasmid, which, in addition to the 2µm sequence for autonomous replication in yeast, contained the yeast selection marker genes leu2-d (13) and
URA3, was used to transform yeast strains mutated in the
LEU2 and URA3 genes. Plasmid maintenance was
selected either on a medium lacking uracil or on a medium lacking
uracil and leucine. The latter medium allows the selection of yeast
cells containing a high plasmid copy number since the plasmid leu2-d is
poorly expressed. The expression of recombinant IN was under the
control of the alcohol dehydrogenase 2/glyceraldehyde-3-phosphate dehydrogenase-inducible hybrid promoter (11).
pET-15b(His-IN1-288), pET-15b(His-IN50-212), and
pET-15b(His-IN50-288) expression vectors
encoding His-tagged truncated INs were used to express His tagged INs
(a generous gift of J. F. Mouscadet, UMR-8532 CNRS, Villejuif, France).
Recombinant HIV-1 IN. (i) From yeast.
JSC310 (IN) yeast
cells were grown for 3 days on a YCAD selective medium, precultured in
YNB liquid medium, and then incubated in YPDA complete medium for 3 days. Cells were harvested for 10 min at 4,000 × g and
broken with glass beads in 5 mM HEPES (pH 7.6)-5 mM EDTA-1 mM
DTT. The lysate was centrifuged at 12,000 × g for 20 min, and the pellet was solubilized in 1 M NaCl-10 mM CHAPS. The same
procedure was performed using the JSC310 strain to obtain yeast
extracts without IN. The final NaCl concentration of the extracts was
attained by addition of salt or after dialysis, according to the
affinity column elution procedure used in the subsequent purification steps.
(ii) From bacteria.
Different forms of His-tagged HIV-1 IN
were overexpressed in E. coli and obtained as described by
Leh et al. (22).
Purification of IN. (i) Yeast-expressed untagged IN.
Purification was performed essentially as previously described
(6). The soluble fraction containing the HIV-1 IN obtained from JSC 310 (IN) was loaded on a Hitrap butyl-Sepharose 4B column (1 ml; Pharmacia-LKB), washed with LSC buffer (50 mM HEPES, pH 7.6; 0.2 M
NaCl; 0.1 M EDTA; 1 mM DTT; 7 mM CHAPS; 10% glycerol) and equilibrated
with 5 volumes of HSC buffer (50 mM HEPES, pH 7.6; 0.2 M NaCl; 1 M
ammonium sulfate; 0.1 mM EDTA; 1 mM DTT; 7 mM CHAPS). Proteins were
eluted by a decreasing ammonium sulfate gradient (1 to 0 M). Fractions
containing IN activity were pooled, and 7 mM CHAPS was added. Pooled
fractions were diluted 1/3 with 50 mM HEPES (pH 7.6), 0.1 M
EDTA, 1 mM DTT, 10% glycerol, and 7 mM CHAPS and loaded on a Hitrap
heparin Sepharose CL-4B column (1 ml; Pharmacia-LKB), washed with 5 volumes of HS buffer (50 mM HEPES, pH 7.6; 1 M NaCl; 0.1 mM EDTA; 1 mM
DTT; 10% glycerol; 7 mM CHAPS), and equilibrated with a linear
increasing NaCl gradient (0 to 1 M NaCl). Fractions containing IN
activity were pooled and concentrated by ultrafiltration (Centricon
Millipore), followed by addition of 7 mM CHAPS. Purified IN solutions
were kept at
80°C. Proteins were analyzed by SDS-12% PAGE.
(ii) His-tagged IN.
His-INs were purified as described by
Leh et al. (22) with minor modifications. All buffers
contained 7 mM CHAPS, and ZnSO4 was omitted
during elution. Proteins were dialyzed overnight against a solution
containing 20 mM Tris-HCl (pH 8), 0.5 M NaCl, 2 mM DTT, and 10%
glycerol. CHAPS (7 mM) was added to fractions containing IN.
After elution, the His-IN fusion proteins were cleaved using biotinylated thrombin (Novagen) and dialyzed as described above. Thrombin was then captured by incubation with streptavidin magnesphere paramagnetic particles (Promega).
Selection of yeast proteins interacting with HIV-1 IN.
Purified IN was dissolved to a final concentration of 500 ng/ml in a
coupling buffer (0.2 M NaHCO3, 0.5 M NaCl [pH
8.3]). An affinity chromatography column containing NHS groups
covalently linked to the column was washed with 1 ml of 1 mM HCl. The
IN solution was injected into the column (Pharmacia-LBK), and the coupling step was performed for 30 min at 25°C. NHS noncoupled groups
were inactivated by injecting 2 ml of buffer A (0.5 M ethanolamine, 0.5 M NaCl [pH 8.3]) and 2 ml of buffer B (0.1 M acetate, 0.5 M NaCl [pH
4]) according to the procedure described by the supplier. Under these
conditions, 70% of the IN was coupled to the column. Four milliliters
of the JSC310 yeast protein extract (about 4 µg of protein) was
loaded on the IN-coupled column in the absence of NaCl and eluted by a
gradient of NaCl linearly increasing from 0 to 1 M, followed by a 2 M
NaCl step to elute proteins associated to IN by ionic bonds. Fractions
were analyzed by SDS-12% PAGE. Protein staining was performed either
with the amido black or the silver nitrate methods.
Identification of IN-interacting proteins.
A sample of 100 ng of proteins eluted from the IN-affinity column was subjected to
SDS-PAGE and stained with amido black. The selected bands were excised
from the gel, destained, and cleaved in situ with the endoproteinase
Lys-C (Boehringer Mannheim). Cleavage was performed in 10% (vol/vol)
acetonitrile in 25 mM Tris-HCl (pH 8.6) for 16 h at 37°C, and
the resulting peptides were extracted (31) and applied to
a reverse-phase C18 column (Applied Biosystems). Peptides were separated by a linear gradient of solvent B (80% acetonitrile in 0.08% [vol/vol] TFA) in solvent A (0.1% [vol/vol] TFA in water). The N-terminal amino acid sequence of the isolated peptides was obtained by Edman degradation in an Applied Biosystems protein sequencer (model 491).
Proteins and antibodies.
Human proteins, HSP60, HSP10, and
HSP70 and LK2 monoclonal antibodies directed against the epitope
between amino acid residues 383 to 419 of hHSP60 were purchased from
Sigma. HIV-1 RT was a kind gift from M. L. Andreola (UMR 5097 CNRS, Bordeaux France). Monoclonal antibodies directed against the
C-terminal domain of HIV-1 IN were a kind gift from A. Leavitt (School
of Medicine. University of California, San Francisco).
In vitro IN activity assays.
All assays were performed in 20 mM HEPES (pH 8)-10 mM DTT-7.5 mM MnCl2-0.05%
NP-40. HIV-1 IN (1 to 5 pmol) and radiolabeled oligonucleotides (1 pmol) in a total volume of 20 µl were used. The reaction mixture was
incubated at 37°C for 1 h, and the incubation was stopped by
adding 10 µl of loading buffer (95% formamide, 20 mM EDTA, 0.05%
bromophenol blue) and heating at 90°C for 5 min. The reaction
products were analyzed by electrophoresis on 15% polyacrylamide gels
with 7 M urea in Tris-borate-EDTA, pH 7.6, and autoradiographed.
The sequences of the ODNs used to perform the processing and
strand transfer assays were the following: ODN 70, 5'GTGTGGAAAATCTCTAGCAGT3'; ODN 71, 5'GTGTGGAAAATCTCTAGCA3'; and ODN 72, 5'ACTGCTAGAGATTTTCCACAC3'.
To perform the 3' processing assay, the 5' radiolabeled ODN 70 hybridized to ODN 72 was used as a substrate, while the 5'
radiolabeled
ODN 71 hybridized to ODN 72 was used as a substrate
in the strand
transfer
reaction.
All IN activities were quantified by scanning of the bands after
gel electrophoresis and autoradiography using the NIH
software.
In vitro ATPase activity assay of the HSP60-HSP10 complex.
hHSP60-HSP10 complex (0.5 pmol; 1:1) was incubated for 1 h with
6.6 pmol of [
-32P]ATP and 10 to 15 pmol of
HIV-1 IN. Bilayer polyethyleneimine-cellulose chromatography
plates were loaded with the reaction products. After migration in the
presence of 10 mM Tris-HCl (pH 7.6)-1 M LiCl, plates were
autoradiographed. The ATP consumption was determined by scanning the
corresponding spots.
ELISA.
Plate wells were coated overnight at 4°C with 30 pmol of the proteins diluted in a 0.1 M carbonate solution. Wells were
washed with a solution of PBS containing 0.05% Tween (PBS-0.05%
Tween), saturated for 1 h with BSA (10 mg/ml) and washed three
times with PBS-0.05% Tween solution. The second partner (30 pmol) was
added and incubated for 1 h at 37°C. After washing three times
with PBS-0.05% Tween, primary antibodies were incubated for 2 h
at 37°C. After three washings, secondary antibodies were incubated for 1 h at 37°C, and the interaction was revealed with
ortho-phenylenediamine after washing with PBS. The
absorbance was determined at 492 nm.
 |
RESULTS |
Selection of yeast proteins interacting in vitro with HIV-1
IN.
Yeast proteins able to interact with HIV-1 IN were selected by
using an affinity chromatography column carrying the immobilized retroviral enzyme. The NHS chemical groups of the column were previously coupled to the NH2 groups of highly
purified HIV-1 IN. After inactivation of the unlinked NHS groups, a
protein extract from the JSC310 yeast strain was loaded onto the
column. The protease-deficient strain JSC310 was used to minimize yeast
protein digestion, as well as degradation of the IN coupled to the
column. After washing out the unbound proteins (corresponding to about
90% of total protein), a linear gradient from 0 to 1 M NaCl was used
to elute the IN-bound material (Fig. 1).
A final step of 2 M NaCl was applied to elute proteins still bound to
the immobilized IN. The profile of the three peaks of retained proteins
(called peaks 1, 2, and 3) was analyzed by SDS-PAGE after silver
nitrate staining (Fig. 2A). Most IN-bound
proteins were eluted between 0 and 300 mM NaCl. The analysis of this
fraction showed the presence of 15 to 20 proteins (Fig. 2A, lane 1). No
retained proteins were detected when using an IN-free column as a
control.

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 1.
Elution profile of yeast proteins interacting with
HIV-1 IN. Yeast proteins retained on the IN-affinity column were eluted
by an increasing gradient of NaCl. Peaks 1, 2, and 3 correspond to
protein-containing pooled fractions retained in the column. In parallel
an IN-free column was used and was eluted similarly. Symbols: filled
circle, absorbance at 280 nm of proteins eluted from the IN-coupled
column; thin line, absorbance at 280 nm of proteins eluted from the
IN-free column; thick line, NaCl concentration.
|
|

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 2.
(A) SDS-PAGE analysis of the yeast fractions containing
IN-interacting proteins. Fractions corresponding to peaks 1, 2, and 3 described in Fig. 1 were subjected to SDS-12% PAGE analysis and
stained with silver nitrate. M: Molecular mass markers (in
kilodaltons). Lanes 1, 2, and 3: fractions corresponding, respectively,
to peaks 1, 2, and 3; lane 4, control corresponding to the fractions
obtained with the noncoupled column. A, B, C, and D indicate proteins
submitted for further identification. (B) Western blot analysis. The
detection of the samples shown in Fig. 2A (lanes 1, 2, and 3) was
performed with monoclonal antibodies directed against hHSP60 (see
Materials and Methods).
|
|
As the protein concentration corresponding to bands A, B, C, and D was
high enough to identify them by microsequencing, these
fractions were
pooled and the proteins were separated by SDS-PAGE.
After amido black
staining the corresponding bands were cut for
identification.
Identification of proteins interacting in vitro with HIV-1 IN.
The amido black-stained gel bands A, B, C, and D were eluted, and
the proteins were digested with the endoproteinase Lys-C. The resulting
peptides were extracted and separated by high-performance liquid
chromatography as described in Materials and Methods section. One or
two peptides of each protein were submitted to sequencing. The
sequences obtained were compared to the full yeast genome at the
SGD website (Saccharomyces Genome Database
[http://genome-www.stanford.edu/Saccharomyces]) using BLAST
software to identify the corresponding proteins. Results are shown in
Table 1. The following yeast proteins
were identified: yHSP60, PCK1, CCT4, and TEF1
, which correspond,
respectively, to the A, B, C, and D bands shown in Fig. 2A. All these
yeast proteins share a high degree of sequence similarity with their human counterparts. By using monoclonal antibodies directed against hHSP60, we confirmed the presence of the yeast homolog in the eluted
fractions (Fig. 2B). Lower but significant levels of yHSP60 were
also detected in the elution fractions obtained with high salt concentration (peak 3), suggesting a strong interaction between yHSP60 and IN.
On the basis of previous evidence showing that hHSP60 copurified with
HIV-1 virions (
2) we focused our interest on this
chaperone in order to characterize the functional role(s) of the
interaction with
IN.
hHSP60 interacts with HIV-1 IN in vitro.
Having shown that
yHSP60 interacted with HIV-1 IN, we performed ELISA experiments to
verify whether the hHSP60 was also able to interact with IN. ELISA
plates were coated with the enzyme and incubated with the hHSP60
protein as described in Materials and Methods. The binding of hHSP60
was detected using the mouse monoclonal anti-hHSP60 antibody LK2
described above. Results unambiguously showed the binding of hHSP60 to
IN (Fig. 3A). In parallel, control experiments were performed using various proteins: BSA, the bacterial endonuclease BamHI, or recombinant HIV-1 RT also expressed
and purified from yeast (32). A low level of binding was
obtained with all these proteins.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 3.
Binding of hHSP60 to HIV-1 IN determined by ELISAs. (A)
hHSP60 (30 pmol) was incubated in ELISA wells coated with either 30 pmol of HIV-1 IN (IN), HIV-1 RT (RT), or bacterial restriction enzyme
BamHI (BamHI) or in the absence of
protein (Uncoated). The amount of bound hHSP60 was determined by using
the monoclonal anti-hHSP60 antibody. Values are the mean ± SD of
three independent experiments. (B) HIV-1 IN (30 pmol) was incubated in
ELISA wells coated with 30 pmol of hHSP60 (Hsp60), hHSP70 (Hsp70), or
restriction enzyme BamHI (BamHI) or
without protein (Uncoated). The amount of IN bound was determined by
using a monoclonal antibody directed against HIV-1 IN. Values are the
means + standard deviations (error bars) of three independent
experiments. OD, optical density.
|
|
To ascertain the specificity of the interaction, ELISA plates were
coated with hHSP60,
BamHI, and another heat shock protein,
the hHSP70, and incubated with HIV-1 IN. In this experiment the
binding
was monitored by using monoclonal antibodies against HIV-1
IN. Figure
3B shows that HIV-1 IN bound efficiently to hHSP60.
In contrast, no
binding was observed in the presence of
BamHI
or hHSP70,
demonstrating once again the specificity of the interaction
between
HIV-1 IN and hHSP60. These results confirm the interaction
between
yHSP60 and HIV-1 IN detected by IN-affinity
chromatography.
Mapping the interaction site for hHSP60 within IN.
To obtain
additional information concerning the IN binding site involved in the
interaction with hHSP60, we performed ELISA experiments using six forms
of recombinant HIV-1 IN expressed and purified from bacteria. As in all
the experiments reported above, we used an HIV-1 IN expressed in yeast;
it was important to verify whether the different forms of recombinant
IN expressed in bacteria were also able to interact with HSP60 (Fig.
4A). Besides the two complete forms of
IN, we tested three fragments of IN, one containing the N-terminal and
the catalytic core domains, another carrying the C-terminal and the
catalytic core domains, and another with only the catalytic core
domain. hHSP60 was able to interact with all the bacterially expressed
integrases (Fig. 4B). Therefore, the catalytic core domain of HIV-1 IN
is clearly involved in the interaction between hHSP60 and the
retroviral enzyme.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 4.
Determination of the HSP interacting IN domains. (A)
Schematic representation of different recombinant forms of HIV-1 IN.
All IN constructions were expressed in bacteria. IN, complete protein;
His-tag IN, complete IN carrying a histidine tag; His-tag IN dN,
His-tagged IN deleted from the N-terminal domain; IN dN, IN deleted
from the N-terminal domain; IN dC, IN deleted from the C-terminal
domain; IN CC, IN deleted from both the N-terminal and the C-terminal
domains. (B) Interaction between IN constructions and hHSP60. hHSP60
(30 pmol) was incubated in ELISA wells coated either with 30 pmol of
IN, His-tag IN, His-tag IN dN, IN dN, IN dC, IN CC, or no protein
(Uncoated) as indicated. The amount of bound hHSP60 was determined by
using the monoclonal anti-HSP60 antibody. OD, optical density. Values
are the means + standard deviations (error bars) of three independent
experiments.
|
|
We conclude that (i) the interaction between the hHSP60 and HIV-1 IN
does not depend on the expression system used to obtain
the recombinant
enzyme, (ii) the same type of interaction was
obtained with INs
possessing or not possessing a His tag, and
(iii) the interaction
between hHSP60 and the IN involves at least
the catalytic core domain
of HIV-1
IN.
HIV-1 IN is a substrate for the hHSP60-HSP10 complex.
The
hHSP60 protein performs its function in the cell in association with
the HSP10 cofactor in the presence of ATP (3). This
complex, which is composed of two rings of seven HSP60 molecules, binds
newly synthesized peptides. The folded active state of the substrate is
reached by conformational changes in the hHSP60 chaperonin induced by
the ATP binding. To know whether the functional complex hHSP60-HSP10 is
able to bind IN and induce conformational changes in the viral enzyme,
we tested the ATPase activity of the hHSP60-HSP10-IN complex in the in
vitro specific assay described in Materials and Methods.
ATP consumption was observed when IN was added to the hHSP60-HSP10
complex, but not in the absence of protein (Fig.
5). Furthermore,
ATP consumption was
highly increased when IN preincubated at 72°C
was used, suggesting
that the preferential form of IN recognized
by the functional
chaperonin complex is the denatured form of
IN.

View larger version (8K):
[in this window]
[in a new window]
|
FIG. 5.
ATPase activity assay of the hHSP60-HSP10 complex. The
hHSP60-HSP10 complex (0.5 pmol in a 1:1 ratio) was incubated for 1 h at 37°C with 6.6 pmol of [ -32P]ATP in the absence
of protein (bar 1), or in the presence of 10 pmol of IN (bar 2), 15 pmol of IN (bar 3), 10 pmol of IN preincubated at 72°C (bar 4), or 15 pmol IN preincubated at 72°C (bar 5). In control experiments without
the HSP60-HSP10 complex, [ -32P]ATP was incubated with
10 pmol of IN (bar 6) or 15 pmol of IN (bar 7). The reaction products
were chromatographed on bilayer polyethyleneimine-cellulose plates. The
ATP consumption was determined by scanning the corresponding spots on
the autoradiograms. Error bars, standard deviations.
|
|
hHSP60 stabilizes the IN active form.
The physiological role
of chaperones involves protein conformational changes allowing these
macromolecules to acquire their active form. It also protects them from
denaturation (3). To further investigate the effect of
hHSP60 on IN, we tested protection against heat denaturation in the
presence or absence of the chaperonin.
After preincubating IN at different temperatures in the presence or
absence of hHSP60, BSA, or hHSP70, we tested the in vitro
IN processing
activity. Under these conditions the processing
activity was stimulated
by the presence of hHSP60, suggesting
that the interaction between IN
and hHSP60 is able to improve
the in vitro activity of the retroviral
enzyme.
As seen in Fig.
6, the presence of hHSP60
reduced the thermal denaturation of the enzyme. After preincubation
with hHSP60
at 50°C, about 80% of the IN activity was retained,
while 40%
of the activity remained after heating at 72°C. It is
important
to note the striking effect observed at 72°C since no IN
activity
was observed in the absence of the chaperone. In contrast, no
protection was observed when HIV-1 IN was preincubated in the
presence
of either hHSP70 or BSA. The protection of HIV-1 IN against
heat
denaturation by hHSP60 strongly suggests the formation of
a stable
complex between both proteins, which is probably mediated
by the
stabilization of the active form of HIV-1 IN. Such a stabilizing
effect
could be in part responsible for the stimulation of the
IN activity
(see below) by hHSP60.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 6.
Effect of HSP60 on the thermal denaturation of HIV-1 IN.
HIV-1 IN (5 pmol) was preincubated at 37, 55, and 72°C for 10 min in
the presence or absence of 0.50 pmol of hHSP60, hHSP70, or BSA.
The processing activity assay was performed as described in Materials
and Methods.
|
|
To determine whether hHSP60 was also able to induce conformational
changes leading to the renaturation of HIV-1 IN, we studied
the effect
of the chaperone after enzyme denaturation. IN was
preincubated at the
same temperatures as reported above; then,
hHSP60 was added for 30 min
at 37°C and the in vitro IN activity
was assayed. Under these
conditions, no restoration of the activity
was observed, indicating
that denaturation at high temperatures
seems to be
irreversible.
hHSP60 stimulates in vitro IN activity.
Experiments were
designed to study the in vitro effect of hHSP60 on the processing and
strand transfer activities catalyzed by HIV-1 IN (Fig.
7A). Preincubation with increasing
amounts of hHSP60 resulted in a two- to fourfold dose-dependent
stimulation of both processing and strand transfer activities. In
contrast, no stimulation was observed with human HSP70 (Fig. 7B). The
addition of high concentrations of hHSP60 resulted in inhibition of
both IN activities (Fig. 7A, lane 5).

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 7.
In vitro effect of hHSP60 or HSP70 on HIV-1 IN
activities. (A) Increasing concentrations of hHSP60 (0, 0.14, 0.25, 0.50, and 1.41 pmol) corresponding, respectively, to lanes 1, 2, 3, 4, and 5, were preincubated for 30 min at 37°C with 5 pmol of HIV-1 IN
before performing the processing or strand transfer activity assays.
(B) Increasing concentrations of hHSP70 (0, 0.14, 0.25, 0.50, and 1.41 pmol) corresponding, respectively, to lanes 1, 2, 3, 4, and 5, were
preincubated for 30 min at 37°C with 5 pmol of HIV-1 IN before
performing processing or strand transfer activity assays.
Abbreviations: S, substrate; P, product.
|
|
As shown in Fig.
8, a stimulation of the
IN activity was also observed when using a constant concentration of
hHSP60 and increasing
concentrations of IN. Interestingly, in the
presence of hHSP60,
IN processing activity was detected even with
enzyme concentrations
that were too low to observe any activity under
the standard conditions.
Thus, in the presence of 0.5 pmol of hHSP60, a
low but significant
level of processing activity was observed with 2.2 pmol of IN,
while no activity was detected at the same concentration of
enzyme
in the absence of hHSP60. The lack of stimulation of the
activities
of a recombinant HIV-1 RT expressed in yeast
(
32) or the
BamHI
endonuclease by the
chaperone, points to the specificity of this
effect on HIV-1 IN.

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 8.
Effect of hHSP60 on the processing activity of HIV-1 IN.
hHSP60 (0.5 pmol) was preincubated for 30 min at 37°C with different
concentrations of HIV-1 IN as indicated before performing the
processing assay. The IN activity was quantified by using the NIH
software and was reported as indicated in the graph.
|
|
The presence of yHSP60 is necessary to obtain IN-induced lethality
in S. cerevisiae
To study the effect of the
chaperonin on the activity of IN within a cellular context, we used the
in vivo lethal test previously described in yeast cells
(5). In this system, the IN activity is detected by the
emergence of a lethal phenotype. The expression of IN in a diploid
yeast strain derived from W303 a/
was used, in which IN
induction leads to a lethal effect (Fig.
9, spot 2). This yeast strain was
identical to that reported previously (5), except for the
gene encoding yHSP60, which was mutated and which thus induced the
expression of a yHSP60 with an altered function at 38°C
(35). No lethality was observed with the yHSP60 mutant
(Fig. 9, spot 3). We verified that the yHSP60 mutation did not change
the level or the activity of HIV-1 IN expressed in yeast (data not
shown).

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 9.
Lethality assay of yeast strains. The drop test was
performed as described in Materials and Methods. Yeast cells were
spotted onto YNB solid medium lacking leucine and containing 0.1%
glucose for 3 days at 30°C. Spot 1, W303 a/ control
yeast strain containing the pBS24.1 vector, which does not express
HIV-1 IN; spot 2, W303 a/ (IN) yeast strain
containing the pHIV1-SF2IN vector expressing wild-type HIV-1 IN;
spot 3, W303 a/ temperature-sensitive yeast strain
containing the pHIV1-SF2IN vector expressing wild type HIV-1 IN and a
mutated yHSP60 product, the hps6 G432D protein; spot 4, W303
a/ temperature-sensitive yeast strain (Yep351) that
expresses both the mutated HSP60 G432D and SCS1 proteins and contains
the pHIV1-SF2IN vector expressing wild-type HIV-1 IN.
|
|
The use of a yeast strain able to express SCS1, a multicopy suppressor
of yHSP60 temperature-sensitive mutant encoding a protein
different
from yHSP60 (
35), did not restore the IN lethal
effect
(Fig.
9, spot 4). This suggests that the effect was probably due
to the specific action of yHSP60 associated with the IN-induced
lethality in yeast cells and that it was not related to an unspecific
effect of the yHSP60 chaperone activity. This strongly supports
the
idea that a physiological interaction operates between HIV-1
IN and
HSP60, thus suggesting the involvement of this chaperone
in the lethal
effect induced by IN in
yeast.
 |
DISCUSSION |
In this study we have identified some yeast proteins able
to interact with HIV-1 IN: PCK1, CCT4, TEF1
, and yHSP60.
These proteins, which were isolated by IN-affinity chromatography, are very similar to their human counterparts. PCK1 is an enzyme involved in
neoglycogenesis. A possible role of this protein in retroviral integration remains to be established. The yeast CCT4 protein is a
chaperonin of tubulin. Since it has been shown that spumaretroviruses use tubulin filaments to enter the nucleus and that purified HIV-1 virions contain actin and several actin-binding proteins
(28), CCT4 is a plausible candidate involved in the
intracellular transfer of IN. Furthermore, using the yeast two-hybrid
system, we have already identified other proteins related to tubulin
and able to interact with IN (our own unpublished results). Another
protein detected with the IN-affinity chromatography system was
TEF1
, the yeast counterpart of the human translation elongation
factor EF1
. These results can be related to those reported by
Cimarelli and Luban (10). They found that EF1
interacts
specifically with the HIV-1 Gag polyprotein. All this evidence suggests
an interaction between EF1
and IN and the possible function of this elongation factor in the HIV-1 cycle.
We focused our attention on the characterization of the interaction
between HIV-1 IN and hHSP60, the human counterpart of yHSP60. Heat
shock proteins are highly conserved during evolution. These ubiquitous
proteins play an essential role in cells by binding newly synthesized
proteins and facilitating their folding. Here we show that hHSP60 binds
in vitro to HIV-1 IN and that the catalytic core domain of IN is
involved in this interaction. Although the in vitro IN-hHSP60
interactions described in this work required no additional factors as
shown by ELISA and by the protection against thermal denaturation, we
cannot exclude the in vivo involvement of other proteins.
We have previously shown that the induction of HIV-1 IN in yeast cells
leads to the emergence of a lethal phenotype. Much genetic and
molecular evidence supports this hypothesis (5). Thus, the
absence of the IN-induced lethal phenotype in yeast after mutation of
the yHSP60-encoding gene indicates that interaction between IN and the
chaperonin operates in vivo and plays a key role in cellular lethality.
Proteins from the HSP60 chaperonin family recognize a well-defined set
of newly translated polypeptides. The HSP60 bacterial counterpart,
GroEL, interacts strongly with approximately 300 polypeptides
(18). The bacterial chaperonin substrates consist preferentially of two or more domains with 
folds, which contain
-helices and buried
-shields presenting extensive hydrophobic surfaces. Houry et al. (18) defined the typical GroEL
substrate as a protein with a molecular mass between 20 and 60 kDa
presenting such characteristics. Since the HIV-1 IN protein has a
similar quaternary structure, this enzyme may act as a cellular
substrate of this chaperonin. This hypothesis is supported by our
results concerning the hHSP60-IN interaction and the functionality of the HSP60-HSP10 complex in the presence of IN.
Several hypotheses may be proposed with regard to the biological
relevance of the interaction between hHSP60 and HIV-1 IN. On the basis
of the well-known functions of chaperones, hHSP60 may act either by
stabilizing the active form of IN or by inducing conformational changes
allowing inactive forms of IN to reach a functional folding state.
Inside the cell, such conformational changes involve the HSP60-HSP10
multimeric complex (3). Our results concerning the ATPase
activity of this complex in the presence of IN support a cellular role
of HSP60-HSP10 on the folding of HIV-1 IN.
Thermal denaturation experiments showed that hHSP60 protects HIV-1 IN
from inactivation, thus indicating that hHSP60 could also act as a
chaperone for HIV-1 IN in protein folding and assembly. The latter
effect may be related to the fact that purified HIV-1 IN aggregates
easily into insoluble multimeric complexes. Recent results from our
group and others (12) indicate that the active form of the
enzyme is a dimer. Thus, a possible role of hHSP60 in the cell may be
to prevent aggregation of HIV-1 IN. The in vivo interaction of hHSP60
or hHSP60-like proteins with IN may be to maintain the proper
conformation and/or the oligomerization state of the viral integrase.
Previous reports have shown a possible involvement of hHSP60 in the
HIV-1 biological cycle. The hHSP60 has been shown to copurify with
HIV-1 and simian immunodeficiency virus viral particles
(2), thus suggesting that this protein is able to bind to
one or more molecules encapsidated into HIV-1 particles. After
submission of this work, the interaction of HSP60 and the hepatitis B
virus DNA polymerase was described, leading to conclusions very similar to those described here (30). Heat shock proteins have
also been found to be associated with VSV (15), vaccinia
virus (20), adenovirus (23), Sindbis virus
(26), and canine distemper virus (27).
Moreover, the expression of hHSP60 is significantly increased in
virus-infected cells (25). Taken together, these results
strongly suggest that the interactions shown here between hHSP60 and
HIV-1 IN may be part of a more general infection mechanism involving
cell factors and virus components, which in turn supports the
hypothesis of a functional role of hHSP60 in the HIV-1 biological cycle. Thus, the in vitro results obtained in this work may be related
to possible functional interactions between hHSP60 and HIV-1 IN in the
infected human cell. As there is no direct evidence concerning the in
vivo role of the interactions described here, it remains to be
confirmed that the effect of HSP60 described in vitro operates during
the virus life cycle.
Even if a large amount of HSP60 was found in the mitochondria of
mammalian cells, a small but significant fraction has been also
detected in the nuclear and the cytoplasmic fractions (19, 34), suggesting that HIV-1 IN and the chaperonin may share the same compartments in the infected cell. Furthermore, as hHSP60 is
nucleus encoded and synthesized in the cytoplasm, the interaction between IN and hHSP60 may reflect a transient step, requiring a low
amount of chaperonin before the latter is transferred to the mitochondria.
Taken together, our results concerning the interactions of HIV-1 IN and
HSP60, the ones described very recently in the case of hepatitis B
virus DNA polymerase (30), and those described above in
other viral systems may indicate a general role of this chaperonin in
the conversion of some viral encoded proteins into an active state.
Work is under way to obtain further information regarding the
structure-function relationship of hHSP60-IN interactions.
 |
ACKNOWLEDGMENTS |
We are deeply grateful to L. Tarrago-Litvak for precious advice
and help with the manuscript. Editing of the manuscript was done with
the capable help of Ray Cooke (English Department, University Bordeaux
2). We thank A. Leavitt (University of California, San Francisco) for
generously providing HIV-1 IN IgG, R. L. Hallberg (Syracuse
University, Syracuse, N.Y.) for the gift of yeast strains, J. F. Mouscadet (UMR-8532 CNRS, Villejuif, France) for the gift of the
His-tagged truncated IN expression plasmids, and M.-L. Sallafranque-Andreola for the gift of the HIV-1 reverse transcriptase protein. We are grateful to J. H. Alix and A. El Yaagoubi (IBPC, Paris, France) for fruitful discussions.
This work was supported by the French Agence Nationale de Recherche
contre le SIDA (ANRS), the Centre National de la Recherche Scientifique, and the University Victor Segalen Bordeaux 2. V.P. and
V.R.D.S. benefited from a Ph.D. fellowship from the MNERT.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: REGER, UMR-5097
CNRS-Université Victor Segalen Bordeaux 2, 146 rue Léo
Saignat, 33076 Bordeaux Cedex, France. Phone: 33-(0)5 57 57 17 40. Fax:
33-(0)5 57 57 17 66. E-mail:
vincent.parissi{at}reger.u-bordeaux2.fr.
 |
REFERENCES |
| 1.
|
Asante-Appiah, E., and A. M. Skalka.
1997.
Molecular mechanisms in retrovirus DNA integration.
Antivir. Res.
36:139-156[CrossRef][Medline].
|
| 2.
|
Bartz, S. R.,
C. D. Pauza,
J. Ivanyi,
S. Jindal,
W. J. Welch, and M. Malkovsky.
1994.
An Hsp60 related protein is associated with purified HIV and SIV.
J. Med. Primatol.
23:151-154[Medline].
|
| 3.
|
Bukau, B., and A. L. Horwich.
1998.
The Hsp70 and Hsp60 chaperone machines.
Cell
92:351-366[CrossRef][Medline].
|
| 4.
|
Bukrinsky, M., and O. K. Haffar.
1999.
HIV-1 nuclear import: in search of a leader.
Front. Biosci.
4:772-781.
|
| 5.
|
Caumont, A. B.,
G. A. Jamieson,
S. Pichuantes,
A. T. Nguyen,
S. Litvak, and C.-H. Dupont.
1996.
Expression of functional HIV-1 integrase in the yeast Saccharomyces cerevisiae leads to the emergence of a lethal phenotype: potential use for inhibitor screening.
Curr. Genet.
29:503-510[Medline].
|
| 6.
|
Caumont, A. B.,
G. A. Jamieson,
V. Richard de Soultrait,
V. Parissi,
M. Fournier,
O. D. Zakharova,
R. Bayandin,
S. Litvak,
L. Tarrago-Litvak, and G. A. Nevinsky.
1999.
High affinity interaction of HIV-1 integrase with specific and non-specific single-stranded short oligonucleotides.
FEBS Lett.
455:154-158[CrossRef][Medline].
|
| 7.
|
Chen, D. C.,
B. C. Yang, and T. T. Kuo.
1992.
One-step transformation of yeast in stationary phase.
Curr. Genet.
21:83-84[CrossRef][Medline].
|
| 8.
|
Chen, H, and A. Engelman.
1998.
The barrier-to-autointegration protein is a host factor for HIV type 1 integration.
Proc. Natl. Acad. Sci. USA
95:15270-15274[Abstract/Free Full Text].
|
| 9.
| Chow, S. A. 1997. In vitro assays
for activities of retroviral integrase. A companion to methods in
enzymology. 12:306-317.
|
| 10.
|
Cimarelli, A., and J. Luban.
1999.
Translation elongation factor 1-alpha interacts specifically with the human immunodeficiency virus type 1 Gag polyprotein.
J. Virol.
73:5388-5401[Abstract/Free Full Text].
|
| 11.
|
Cousens, L. S.,
J. R. Shuster,
C. Gallegos,
L. L. Ku,
M. M. Stempien,
M. S. Urdea,
R. Sanchez-Pescador,
A. Taylor, and P. Tekamp-Olson.
1987.
High level expression of proinsulin in the yeast Saccharomyces cerevisiae.
Gene
61:265-275[CrossRef][Medline].
|
| 12.
|
Deprez, E.,
P. Tauc,
H. Leh,
J.-F. Mouscadet,
C. Auclair, and J. C. Brochon.
2000.
Oligomeric states of the HIV-1 integrase as measured by time-resolved fluorescence anisotropy.
Biochemistry
39:9275-9284[CrossRef][Medline].
|
| 13.
|
Erhart, E., and C. P. Hollenberg.
1983.
The presence of a defective LEU2 gene on 2µ DNA recombinant plasmids of Saccharomyces cerevisiae is responsible for curing and high copy number.
J. Bacteriol.
156:625-635[Abstract/Free Full Text].
|
| 14.
|
Hallberg, E. M.,
Y. Shu, and R. L. Hallberg.
1993.
Loss of mitochondrial hsp60 function: nonequivalent effects on matrix-targeted and intermembrane-targeted proteins.
Mol. Cell. Biol.
13:3050-3057[Abstract/Free Full Text].
|
| 15.
|
Hammond, C., and A. Helenius.
1994.
Folding of VSV G protein: sequential interaction with BiP and calnexin.
Science
266:456-458[Abstract/Free Full Text].
|
| 16.
|
Hanahan, D.
1983.
Studies on transformation of E. coli with plasmids.
J. Mol. Biol.
166:557-580[Medline].
|
| 17.
|
Hindmarsch, P.,
T. Ridky,
R. Reeves,
M. Andrake,
A. M. Skalka, and J. Leis.
1999.
HMG protein family members stimulate human immunodeficiency virus type 1 and avian sarcoma virus concerted DNA integration in vitro.
J. Virol.
73:2994-3003[Abstract/Free Full Text].
|
| 18.
|
Houry, W. A.,
F. Dmitrij,
C. Eckerskorn,
F. Lottspeich, and U. Hartl.
1999.
Identification of in vivo substrates of the chaperonin GroEl.
Nature
402:147-154[CrossRef][Medline].
|
| 19.
|
Itoh, H.,
R. Kobayshi,
H. Wakui,
A. Komatsuda,
H. Ohtani,
A. B. Miura,
M. Otaka,
O. Masamune,
H. Andoh,
K. Koyama,
Y. Sato, and Y. Yashima.
1995.
Mammalian 60-kDa stress protein (chaperonin homolog).
J. Biol. Chem.
270:13429-13435[Abstract/Free Full Text].
|
| 20.
|
Jindal, S., and R. A. Young.
1992.
Vaccinia virus infection induces a stress response that leads to association of Hsp70 with viral proteins.
J. Virol.
66:5357-5362[Abstract/Free Full Text].
|
| 21.
|
Kalpana, G. V.,
S. Marmon,
W. Wang,
G. R. Crabtree, and S. P. Goff.
1994.
Binding and stimulation of HIV-1 integrase by a human homolog of yeast transcription factor Snf5.
Science
266:2002-2006[Abstract/Free Full Text].
|
| 22.
|
Leh, H.,
P. Brodin,
J. Bischerour,
E. Deprez,
P. Tauc,
J. C. Brochon,
E. LeCam,
D. Coulaud,
C. Auclair, and J. F. Mouscadet.
2000.
Determinants of Mg2+-dependent activities of recombinant human immunodeficiency virus type 1 integrase.
Biochemistry
39:9285-9294[CrossRef][Medline].
|
| 23.
|
Macejak, D. V., and R. B. Luftig.
1991.
Association of Hsp70 with the adenovirus type 5 fiber protein in infected Hep-2 cells.
Virology
180:120-125[CrossRef][Medline].
|
| 24.
|
Maniatis, T.,
E. F. Fritsch, and J. Sambrook.
1982.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 25.
|
Morimoto, R. I.,
A. Tissieres, and G. Georgopoulos.
1994.
The biology of heat-shock proteins and molecular chaperones.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 26.
|
Mulvey, M., and D. T. Brown.
1995.
Involvement of the molecular chaperone BiP in maturation of Sindbis virus envelope glycoproteins.
J. Virol.
69:1621-1627[Abstract].
|
| 27.
|
Oglesbee, M. J.,
Z. Liu,
H. Henney, and C. L. Brooks.
1996.
The highly inducible member of the 70 kDa family of heat shock proteins increases canine distemper virus polymerase activity.
J. Gen. Virol.
77:2125-2135[Abstract/Free Full Text].
|
| 28.
|
Ott, D. E.,
L. V. Coren,
B. P. Kane,
L. K. Bush,
D. G. Johnson,
R. C. N. Sowder,
E. N. Chertova,
L. O. Arthur, and L. E. Henderson.
1996.
Cytoskeletal proteins inside human immunodeficiency virus type 1 virions.
J. Virol.
70:7734-7743[Abstract].
|
| 29.
|
Parissi, V.,
A. B. Caumont,
V. Richard de Soultrait,
C.-H. Dupont,
S. Pichuantes, and S. Litvak.
2000.
Inactivation of the SNF5 transcription factor gene abolishes the lethal phenotype induced by the expression of HIV-1 integrase in yeast.
Gene
247:129-136[CrossRef][Medline].
|
| 30.
|
Park, S. G., and G. Jung.
2001.
Human hepatitis B virus polymerase interacts with the molecular chaperonin Hsp60.
J. Virol.
75:6962-6968[Abstract/Free Full Text].
|
| 31.
|
Rosenfeld, J.,
J. Capdevielle,
J. C. Guillemot, and P. Ferrara.
1992.
In-gel digestion of proteins for internal sequence analysis after one-or two-dimensional gel electrophoresis.
Anal. Biochem.
203:173-179[CrossRef][Medline].
|
| 32.
|
Sallafranque-Andreola, M.-L.,
D. Robert,
J. P. Barr,
M. Fournier,
S. Litvak,
L. Sarih-Cottin, and L. Tarrago-Litvak.
1989.
Human immunodeficiency virus reverse transcriptase expressed in transformed yeast cells.
Eur. J. Biochem.
184:367-374[Medline].
|
| 33.
|
Sanchez-Pescador, R.,
M. D. Power,
P. J. Barr,
K. S. Steimer,
M. M. Stempien,
S. L. Brown-Shimer,
W. W. Gee,
A. Renard,
A. Randolph,
J. A. Levy,
D. Dina, and P. A. Luciw.
1985.
Nucleotide sequence and expression of an AIDS-associated retrovirus (ARV-2).
Science
227:484-492[Abstract/Free Full Text].
|
| 34.
|
Sanders, B. M.,
J. Nguyen,
T. G. Douglass, and S. Miller.
1994.
Heat-inducible proteins that react with antibodies to chaperonin 60 are localizated in the nucleus of a fish cell line.
Biochem. J.
297:21-25.
|
| 35.
|
Shu, Y., and R. L. Hallberg.
1995.
SCS1, a multicopy suppressor of hsp60-ts mutant alleles, does not encode a mitochondrially targeted protein.
Mol. Cell. Biol.
15:5618-5626[Abstract].
|
Journal of Virology, December 2001, p. 11344-11353, Vol. 75, No. 23
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.23.11344-11353.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Lesbats, P., Metifiot, M., Calmels, C., Baranova, S., Nevinsky, G., Andreola, M. L., Parissi, V.
(2008). In vitro initial attachment of HIV-1 integrase to viral ends: control of the DNA specific interaction by the oligomerization state. Nucleic Acids Res
36: 7043-7058
[Abstract]
[Full Text]
-
Mousnier, A., Kubat, N., Massias-Simon, A., Segeral, E., Rain, J.-C., Benarous, R., Emiliani, S., Dargemont, C.
(2007). von Hippel Lindau binding protein 1-mediated degradation of integrase affects HIV-1 gene expression at a postintegration step. Proc. Natl. Acad. Sci. USA
104: 13615-13620
[Abstract]
[Full Text]
-
Desfarges, S., San Filippo, J., Fournier, M., Calmels, C., Caumont-Sarcos, A., Litvak, S., Sung, P., Parissi, V.
(2006). Chromosomal integration of LTR-flanked DNA in yeast expressing HIV-1 integrase: down regulation by RAD51. Nucleic Acids Res
34: 6215-6224
[Abstract]
[Full Text]
-
Maroun, M., Delelis, O., Coadou, G., Bader, T., Segeral, E., Mbemba, G., Petit, C., Sonigo, P., Rain, J.-C., Mouscadet, J.-F., Benarous, R., Emiliani, S.
(2006). Inhibition of Early Steps of HIV-1 Replication by SNF5/Ini1. J. Biol. Chem.
281: 22736-22743
[Abstract]
[Full Text]
-
Montano, M., Rarick, M., Sebastiani, P., Brinkmann, P., Skefos, J., Ericksen, R.
(2006). HIV-1 burden influences host response to co-infection with Neisseria gonorrhoeae in vitro. Int Immunol
18: 125-137
[Abstract]
[Full Text]
-
Faure, A.él., Calmels, C., Desjobert, Céc., Castroviejo, M., Caumont-Sarcos, A., Tarrago-Litvak, L., Litvak, S., Parissi, V.
(2005). HIV-1 integrase crosslinked oligomers are active in vitro. Nucleic Acids Res
33: 977-986
[Abstract]
[Full Text]
-
Cherepanov, P., Devroe, E., Silver, P. A., Engelman, A.
(2004). Identification of an Evolutionarily Conserved Domain in Human Lens Epithelium-derived Growth Factor/Transcriptional Co-activator p75 (LEDGF/p75) That Binds HIV-1 Integrase. J. Biol. Chem.
279: 48883-48892
[Abstract]
[Full Text]