Previous Article | Next Article 
Journal of Virology, November 2001, p. 10991-11001, Vol. 75, No. 22
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.22.10991-11001.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Multiple Effects of Codon Usage Optimization on
Expression and Immunogenicity of DNA Candidate Vaccines Encoding the
Human Immunodeficiency Virus Type 1 Gag Protein
Ludwig
Deml,1
Alexandra
Bojak,1
Stephanie
Steck,1
Marcus
Graf,1
Jens
Wild,1
Reinhold
Schirmbeck,2
Hans
Wolf,1 and
Ralf
Wagner1,*
Institute of Medical Microbiology, University
of Regensburg, 93053 Regensburg,1 and
Institute of Medical Microbiology and Immunology,
University of Ulm, 89069 Ulm,2 Germany
Received 18 April 2001/Accepted 7 August 2001
 |
ABSTRACT |
We have analyzed the influence of codon usage modifications on the
expression levels and immunogenicity of DNA vaccines, encoding the
human immunodeficiency virus type 1 (HIV-1) group-specific antigen
(Gag). In the presence of Rev, an expression vector containing the
wild-type (wt) gag gene flanked by essential
cis-acting sites such as the 5'-untranslated region and
3'-Rev response element supported substantial Gag protein expression
and secretion in human H1299 and monkey COS-7 cells. However, only weak
Gag production was observed from the murine muscle cell line C2C12. In
contrast, optimization of the Gag coding sequence to that of highly
expressed mammalian genes (syngag) resulted in an
obvious increase in the G+C content and a Rev-independent expression
and secretion of Gag in all tested mammalian cell lines, including
murine C2C12 muscle cells. Mice immunized intramuscularly with the
syngag plasmid showed Th1-driven humoral and cellular
responses that were substantially higher than those obtained after
injection of the Rev-dependent wild-type (wt) gag vector
system. In contrast, intradermal immunization of both wt
gag and syngag vector systems with the
particle gun induced a Th2-biased antibody response and no cytotoxic T
lymphocytes. Deletion analysis demonstrated that the CpG motifs
generated within syngag by codon optimization do not
contribute significantly to the high immunogenicity of the
syngag plasmid. Moreover, low doses of coadministered
stimulatory phosphorothioate oligodeoxynucleotides (ODNs) had only a
weak effect on antibody production, whereas at higher doses
immunostimulatory and nonstimulatory ODNs showed a dose-dependent
suppression of humoral responses. These results suggest that increased
Gag expression, rather than modulation of CpG-driven vector immunity,
is responsible for the enhanced immunogenicity of the
syngag DNA vaccine.
 |
INTRODUCTION |
The development of a prophylactic
and therapeutic human immunodeficiency virus type 1 (HIV-1) vaccine
remains one of the most desirable objectives of research aimed at
controlling the current AIDS epidemic. Abundant clinical evidence
suggests that, besides neutralizing antibodies, cytotoxic T lymphocytes
(CTL) may be a key protective immune parameter in HIV-1 infection
(4, 18, 31).
A strong antiviral cytotoxic activity has been shown to correlate
temporally with the clearance of viremia in primary infection (4,
11, 14, 32) and a long-lasting control of virus replication within certain populations of long-term nonprogressing individuals (15, 38). The usefulness of Gag immunogens for vaccine
development and immunotherapeutic interventions is supported by the
fact that the protein is relatively conserved among diverse HIV-1
subtypes, and broad cross-clade CTL recognition directed against
Gag-specific targets has been well documented (2, 9, 22).
Furthermore, in persons with chronic infection, a decline of
Gag-specific CTL precursors was shown to coincide with a CD4 drop,
increasing virus load, and disease progression (16).
Recently, direct injection of naked DNA into animals has been evaluated
to be a promising approach for the induction of humoral and cellular
immune responses (8, 33). Plasmid DNA immunization reveals
some potential advantages compared to traditional protein vaccination
due to the induction of strong T helper 1 (Th1) and CTL responses, the
prolonged antigen expression, and the long-lived effector activity
(35, 42). Plasmids expressing nonoptimized HIV-1-derived
genes have been recently shown to induce humoral and cellular immune
responses in rodents (8, 36), in nonhuman primates
(6, 21, 25), and in phase I studies in humans (5,
23). However, in most of these initial studies both the titers
of circulating antibodies and the titers of the specific CTL were
transient and low.
Two factors have been suggested to be essential for the efficacy of a
DNA expression vector: (i) the quality of foreign gene expression unit
and (ii) the intrinsic adjuvant properties of the DNA, which are
determined by the complex interaction of immunostimulatory and
inhibitory sequence motifs (13). Furthermore, it was shown that the route and method of immunization are important modulators of
DNA vaccination. The most widely used strategies for the application of
DNA vaccine vectors are intramuscular (i.m.) needle injection and
intradermal (i.d.) inoculation using a gene gun (35). Both immunization strategies strongly differ in the efficiency of DNA delivery. In general, i.m. immunization by saline needle injection requires 100- to 1,000-fold more DNA than gene gun immunization in
order to generate an equivalent antibody response (27).
However, the latter approach seems to favor Th2-mediated immune
responses (10), which are considered to be less effective
for the prevention or control of an HIV infection.
In the present study, we have constructed two HIV-1 Gag DNA expression
vector systems and investigated the influence of codon optimization of
HIV gag on Gag expression in different mammalian cells.
Furthermore, we determined the impact of an increased CpG content on
the immunogenicity of the gag DNA vaccine construct. Our
data strongly indicate that syngag is more efficient in the priming of humoral and cellular immune responses than the Rev-dependent wild-type (wt) gag construct. Furthermore, our results
clearly indicate that the increased immunogenicity of syngag is due to an enhanced Gag expression rather than to intragenic accumulation of
CpG motifs as a consequence of codon usage modification.
 |
MATERIALS AND METHODS |
Plasmid constructs.
The construction and cloning of gagRRE,
UTRgagRRE, and the p-syngag plasmid has been described previously in
detail (12). The four typical CpG motifs (RRCGYY) located
within the syngag reading frame and one CpG motif located 3'
to syngag were inactivated by replacing the central cytosine
with another nucleotide, without alteration of the corresponding amino
acid sequence. The mutations were generated by using the QuikChange
site-directed mutagenesis kit (Stratagene, La Jolla, Calif.), according
to the manufacturer's instructions, by using primer pairs, sense and
antisense, respectively. Oligonucleotides A1sense (5'-CGC
CAG CAT GGG AGC CAG GGC CAG CG-3') and
A1antisense (5'-CGC TGG CCC TGG CTC
CCA TGC TGG CG-3'), corresponding to bp
6 to 19 within the
syngag, were used to create a C-to-A transfersion at
position 6. Oligonucleotides B1sense (5'-CAG GAC CCT
GAA TGC CTG GGT GAA GG-3') and B1antisense (5'-CCT TCA CCC AGG CAT
TCA GGG TCC TG-3'), corresponding to bp 447 to 472, were utilized
to create a C-to-T transition at position 459. Oligonucleotides
C1sense (5'-CCC CAT GTT CAG TGC
CCT GAG CGA GG-3') and C1antisense (5'-CCT CGC TCA
GGG CAC TGA ACA TGG GG'), corresponding to
bp 507 to 532, were utilized to introduce a C-to-T transition at
position 519. Oligonucleotides D1sense (5'-GCT GGT GCA
GAA TGC CAA CCC CGA CTG C') and
D1antisense (5'-GCA GTC GGG GTT GGC
ATT CTG CAC CAG C-3'), corresponding to bp 962 to
990, were used to introduce a C-to-T transition at position 915 within
syngag. Oligonucleotides E1sense (5'-GAT CCG GGA
GCG GAG TTC TCG AGC ATG-3') and E1antisense (5'-CAT GCT CGA GAA CTC
CGC TCC CGG ATC-3'), corresponding to bp 2 to 27 downstream of the
stop codon of the syngag reading frame, were used to
introduce a C-to-A transition at position +13. The CpG motifs are in
boldface, and the mutated nucleic acids within the CpG motifs are in
italics. For transient expression of the Gag polyprotein in mammalian
cells and immunization studies, the syngag
CpG sequence
was placed into the KpnI and XhoI restriction
sites of the pcDNA3.1(+) expression vector under the transcriptional
control of the cytomegalovirus immediate-early promoter-enhancer,
resulting in the plasmid p-syngag
CpG (Fig. 1). The plasmid pCsRevsg25-GFP (termed
pRev here) expressing Rev fused to the green fluorescent protein (GFP)
was kindly provided by Marcus Neumann (GSF, Munich, Germany). The
reading frames of all mutants were verified by DNA sequence analysis
using the dye terminator cycle sequencing technique and a PE Biosystems
ABI Prism 377 DNA sequencer (PE Biosystems, Weiterstadt, Germany).

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic representation of different wt and synthetic
HIV-1 gag gene constructs. Variations in
cis-acting elements comprise (i) the presence or absence
of the RRE, (ii) the 5' UTR containing the major splice donor site
(UTRgagRRE), (iii) extensive codon modification within the Gag encoding
region (syngag), and (iv) the lack of five functional
CpG motifs within the syngag gene
(syngag CpG). The positions of the mutated cytosines
within the gag gene within the CpG motifs are
indicated.
|
|
Synthetic peptides and ODNs.
A 9-mer peptide (AMQMLKETI),
which represents a defined Dd-restricted CTL
epitope of HIV-1 p24(CA) in BALB/c mice, was purchased from Toplab
(Martinsried, Germany). Nuclease-resistant phosphorothioate oligodeoxynucleotides (ODNs) were provided by Metabion (Munich, Germany) and used in single-stranded form. An immunostimulatory CpG ODN
(TCATTGGAAAACGTTCTTCGGGGCG)
and a control GpG ODN
(TCATTGGAAAAGGTTCTTGGGGGGG) with inactivated CpG motifs were synthesized according to previously published sequences (34). In a second control
oligodeoxynucleotide (CpG-M ODN) cytosines were substituted by methyl
cytosines in all CpG dinucleotides. The lyophilized ODNs were
resuspended in phosphate-buffered saline (PBS) prior to injection. The
lipopolysaccharide content in all ODNs and plasmid DNA preparations was
<10 ng/mg as determined by a Limulus amebocyte lysate
QLC-1000 kit (Whittaker Bioproducts, Walkersville, Md.).
Determination of the stimulatory properties of plasmid DNA.
Spleens were recovered under sterile conditions from nonimmunized mice
at an age of 50 to 70 days, and the obtained splenic single cell
suspensions were seeded at 2 × 106 cells
per ml in RPMI 1640 medium containing 10% heat-inactivated fetal calf
serum (FCS) and 1% penicillin-streptomycin (Gibco-BRL) in the presence
or absence of 50 µg of different plasmid constructs. As a positive
control, splenic cells were stimulated with 50 µg of CpG ODNs. After
36 h of culture, cytokine levels were determined from the
precleared supernatant by using a commercial enzyme-linked immunosorbent assay (ELISA) assay according to the manufacturer's instructions (Becton Dickinson).
Cell lines and transfections.
The
H-2d mastocytoma cell line P815 (TIB 64)
and the H-2d B-lymphoma cell line A20 (TIB
208) were obtained from the American Type Culture Collection,
Rockville, Md.). P815 and A20 cells were propagated in RPMI medium
supplemented with 5% (vol/vol) heat-inactivated FCS, 50 µM
2-mercaptoethanol, 100 IU of penicillin per ml, and 100 µg of
streptomycin per ml. COS-7 (African green monkey kidney cells), H1299
(human lung carcinoma cells), and C2C12 (mouse muscle cells) were
maintained in Dulbecco modified Eagle medium (Gibco-BRL, Eggenstein,
Germany) supplemented with 10% FCS, 2 mM
L-glutamine, 100 IU of penicillin per ml, and 100 µg of streptomycin per ml. All mammalian cell lines were maintained
in a humidified atmosphere with 7% CO2 at
37°C.
The cells were transfected by the calcium coprecipitation technique as
described previously (
12). Briefly, 1.5 × 10
6 C2C12, 3 × 10
6
H1299, or 5 × 10
6 COS-7 cells were seeded
on 100-mm-diameter culture dishes, incubated
for 24 h, and then
transfected with 45 µg of different Nucleobond
AX (Macherey-Nagel,
Düren, Germany) purified plasmid constructs.
At 16 h
posttransfection, the cell culture supernatant was replaced
with fresh
medium.
Immunoblotting and p24 capture assay.
Total cell lysates
were prepared 48 h posttransfection by using a triple-detergent
buffer system (radioimmunoprecipitation assay), which was
supplemented with a cocktail of protease inhibitors (Boehringer
Complete Mini Kit; Mannheim GmbH, Mannheim, Germany). The total protein
concentration was determined by a Bradford protein assay (Bio-Rad
Laboratories, Munich, Germany). Equal amounts (100 µg of total
protein) of lysates were separated by electrophoresis on a 12.5%
denaturing sodium dodecyl sulfate (SDS)-polyacrylamide gel. Proteins
were then transferred to nitrocellulose membranes (Schleicher & Schuell, Dassel, Germany), which were probed sequentially with a
1:2,000 dilution of the HIV-1 p24-specific monoclonal antibody 16-4-2 (41) and a 1:2,000 dilution of an alkaline
phosphatase-labeled goat anti-mouse immunoglobulin G (IgG; Bio-Rad
Laboratories, Munich, Germany). Proteins were visualized with NBT and
BCIP solutions (0.3% 4-nitroblue tetrazolium chloride [NBT], 0.3%
5-bromo-4-chloro-3-indolylphosphate [BCIP], 100 mM Tris, 100 mM NaCl,
50 mM MgCl2; pH 9.5 [Boehringer]). Cell culture
supernatants were collected 2 days after transfection and clarified by
centrifugation at 3,000 × g for 10 min. The Gag content was determined by using a p24 capture ELISA as described earlier in detail (26). The p24-specific monoclonal
antibodies 11-G-7 and 10-E-7, used in this assay, were kindly provided
by Matthias Niedrig (RKI, Berlin, Germany). The Gag concentration was
determined from a calibration curve by using different concentrations of purified Gag polyprotein, which was produced in insect cells by
using the baculovirus expression system (37).
DNA vaccination of mice.
Female BALB/c mice (Charles River,
Sulzfeld, Germany) were housed under specific-pathogen-free conditions
and injected at the age of 6 to 12 weeks. Mice were immunized with the
indicated plasmid concentrations by i.m. saline injection with 50 µl
of plasmid DNA in separate sites in both tibialis anterior muscles, followed by i.m. booster immunizations with the same doses of plasmid
DNA. For immunization with Gag expression vectors plus synthetic ODNs,
mice received two i.m. inoculations with 80 µg of DNA plus various
ODN concentrations at weeks 0 and 3. Alternatively, mice were gene gun
inoculated on shaved abdominal skin with plasmid DNA-coated gold
particles (0.95-µm particles, 2 µg of DNA/mg of gold, 0.5 mg of
gold/shot) and a hand-held Accel gene gun device (Bio-Rad Laboratories,
Hercules, Calif.) employing compressed helium (400 lb/in2) as the particle motive force.
Evaluation of antibody responses.
Serum was recovered from
mice by tail bleeding at the indicated time points after the booster
injection. Anti-Gag antibodies were quantified by an end-point dilution
ELISA assay (in duplicate) on samples from individual animals.
In brief, the wells of F-bottom microtiter plates (Greiner,
Frickenhausen, Germany) were coated with purified Gag protein
(
7) in 0.2 M carbonate buffer (pH 9.5 at 1 µg/ml; 100 µl/per
well) and incubated overnight at 4°C. The plates were washed
five
times with wash buffer (PBS, 0.05% Tween 20) and blocked at
37°C
for 1 h with 200 µl of blocking buffer (PBS, 3% FCS, 2%
Tween
20)/well. Test sera were diluted 1/40, followed by serial twofold
dilutions in blocking buffer. The block solution was aspirated;
the
plates were then incubated at 37°C for 2 h with 100 µl of
each
serum dilution/well. After five washings, the plates were
incubated for
1 h at 37°C with 100 µl of horseradish peroxidase-conjugated
goat anti-mouse IgG1 and IgG2a isotypes (1:1,000 in PBS-2% Tween
20-3% FCS; 100 µl/well [Becton Dickinson Biosciences, Heidelberg,
Germany])/well, as well as a goat anti-mouse immunoglobulin antibody
(Dako, Hamburg, Germany), each diluted 1:2,000 in blocking puffer.
After final seven washes, the plates were developed with an OPD
solution (Abbott, Wiesbaden, Germany) for 30 min. The reaction
was
stopped with 50 µl of 1 N
H
2SO
4/well, and the optical
density
(OD) was measured at dual wavelengths of 492 to 690 nm. The
reported
titers correspond to the reciprocal of the highest serum
dilution
that gave a threefold-higher OD value than the corresponding
dilution
of a nonimmune serum. The serum of each mouse was assayed, and
these values were used to calculate the mean and standard deviation
(SD) for each group of
mice.
Determination of cytokines.
Spleens were recovered under
sterile conditions from mice 5 days after the booster injection, and
the obtained splenic single cell suspensions were seeded at 2 × 106 cells per ml in RPMI 1640 medium containing
10% heat-inactivated FCS and 1% penicillin-streptomycin (Gibco-BRL)
in the presence or absence of Gag protein (10 µg/ml). After 36 h
of culture, cytokine levels were determined from the precleared
supernatant by using a commercial ELISA assay according to the
manufacturer's instructions (Becton Dickinson).
CTL assay.
Single cell suspensions were prepared aseptically
from spleens of mice 5 days after the booster immunization. Cells were
suspended in
-MEM medium (Gibco-BRL) supplemented with 10 mM HEPES
buffer, 50 µM
-mercaptoethanol, and 10% FCS. Then, 10% of a
selected batch of concanavalin A-stimulated rat spleen cell
supernatants (30) were added to the culture medium as a
source of growth factors. Responder cells (3 × 107) were cocultured with 1.5 × 106 syngeneic, 9-mer p24(CA) peptide-pulsed A20
cells (gamma irradiated with 20,000 rads) in 10 ml of tissue culture
medium in upright 25-cm3 tissue culture flasks in
a humidified atmosphere with 7% CO2 at 37°C.
Cytotoxic effector populations were harvested after 6 days of in vitro
culture. Serial dilutions of effector cells were cultured with
104 target cells in 200-µl round-bottom wells.
Targets were autologous P815 cells incubated for 1 h at 37°C
with 10 µM of the p24(CA)-derived peptide. Non-peptide-pulsed cells
were used as a negative control. Target and control P815 cells were
labeled with 51Cr (100 µCi/107 cells) for 1.5 h at 37°C and
washed several times prior to being added to the effector cells. After
a 3.5 h of incubation at 37°C, cells were sedimented by
low-speed centrifugation (300 × g, 5 min), and 50 µl
of supernatant was collected for gamma counting. The percentage of
specific release was calculated as [(experimental release
spontaneous release)/(total release
spontaneous release)] × 100. Total counts were measured after the addition of 1% Triton X-100
to the labeled target cells.
 |
RESULTS |
HIV-1 Gag expression in various mammalian cell lines.
The
construction of the syngag expression vector p-syngag and
the wt gag expression vectors gagRRE, UTRgagRRE has been
previously described in detail (12) (Fig. 1).
In order to assess the relative potency of wt and synthetic
gag genes to express the Gag protein in mammalian cells,
human
H1299, monkey COS-7, and murine C2C12 muscle cells were
transiently
transfected with different wt
gag and
syngag expression vectors.
Consistent with our previous
results, induction of Gag protein
expression and secretion from the
gagRRE plasmid was extremely
low or undetectable in all tested
mammalian cell lines, even in
presence of the Rev protein (Fig.
2). The addition of the authentic
untranslated region (UTR) localized 5' of the HIV-1
gag gene
rendered
Gag-expression Rev dependent and drastically increased Gag
production
in H1299 and COS-7 cells by several orders of magnitude,
when
cotransfected with the Rev expression vector pRev (Fig.
2A and
C).
Furthermore, significant concentrations of Gag protein were
secreted
into the supernatants of H1299 and COS-7 cell cultures
(Fig.
2B and D).
However, only a weak Gag expression (Fig.
2A
and C) and no detectable
Gag secretion (Fig.
2B and D) was observed
after cotransfection of the
murine C2C12 muscle cells with UTRgagRRE
and pRev, suggesting that the
Rev-Rev response element (RRE) system
is not efficiently working in
this cell type.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 2.
Increased expression of syngag in various
mammalian cell lines. H1299, COS-7, and C2C12 cells were transiently
transfected by calcium phosphate precipitation with the indicated
plasmids. Nontransfected cells were used as controls. Cells (A and C)
and cell culture supernatants (B and D) were harvested at 48 h
posttransfection. (A and B) Cell lysates (50 µg of total protein) and
sucrose-sedimented proteins from the culture supernatant were separated
by SDS-10% polyacrylamide gel electrophoresis (PAGE) and analyzed by
immunoblotting with a p24-specific monoclonal antibody. Arrows at the
right indicate the position of the Gag polyprotein. Sizes are indicated
in kilodaltons. (C and D) Yields of Gag protein were measured from the
cell culture supernatant by a commercial p24 capture ELISA by using
purified Gag for standardization. Bars represent Gag protein levels and
are the mean of triplicate determinations.
|
|
In contrast, an efficient and Rev/RRE-independent Gag polyprotein
expression and secretion was observed in all tested mammalian
cells,
including murine C2C12 muscle cells, after transfection
with p-syngag.
In our previous studies, we observed no obvious
positive effect of the
Rev export system on the Gag expression
rates from p-syngag
(
12). p-syngag-mediated Gag expression levels
in H1299 and
COS-7 cells were similar to those induced by the
UTRgagRRE and pRev
vector system (Fig.
2). However, despite an
almost equivalent Gag
protein production, Gag release was about
three times more efficient in
H1299 cells, compared to COS-7 cells,
independent from whether
UTRgagRRE/pRev or p-syngag constructs
were used in the transfection
experiment. Gag expression in C2C12
cells by p-syngag was ca. 50% less
efficient than that observed
in H1299 and COS-7 cells, coinciding with
a reduced transfection
efficacy of the C2C12 cell line (data not
shown). Furthermore,
expression of Gag in C2C12 cells from the codon
optimized p-syngag
vector exceeded that of the UTRgagRRE/Rev system by
more than
10-fold. These results suggest that cell-type specific
factors
may contribute to the observed Rev-responsiveness of UTRgagRRE.
Furthermore, adaptation of the
gag codon usage to that of
highly
expressed mammalian genes allows Rev-independent in vitro
expression
in absence of any
cis-acting regulatory elements,
resulting in
high yields of Gag
polyprotein.
Anti-Gag antibody responses in mice immunized with DNA vaccine
vectors.
The capacity of the generated Gag expression vector
systems to induce Gag-specific antibodies was investigated in female
BALB/c mice. Three groups of five animals each received an i.m. primary immunization of plasmid DNA (100 µg/dose), followed by two i.m. boosts at weeks 3 and 6 with the same DNA dose. A control group was
immunized with the pcDNA3 plasmid. Total immunoglobulin titers to
purified Gag protein were determined by ELISA. Vaccination with both
the p-syngag and UTRgagRRE/Rev vector system induced substantial
Gag-specific antibody responses (Fig. 3).
However, the antibody titers obtained after injection of p-syngag
appeared more rapid and were higher than those induced after
coimmunization with the UTRgagRRE and Rev plasmid. Mice immunized with
p-syngag developed measurable levels of p24(CA)-specific antibodies
already 3 weeks after the primary immunization (Fig. 3). Reactive
antibodies appeared to increase almost 100-fold 2 weeks after the first
booster immunization and reached Gag-specific endpoint titers of
1:81,000 1 week after the second booster injection.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 3.
Kinetics and strength of humoral responses induced in
BALB/c mice by i.m. injection of 100 µg of various Gag expression
vectors, respectively. Each point represents the mean value
(n = 5) ± the SD of individual groups for
anti-Gag immunoglobulin antibodies as determined by endpoint dilution
ELISA assay. Endpoint titers of the immune sera were defined as the
reciprocal of the highest plasma dilution that resulted in an
absorbance value (OD = 495) three times greater than that of a
preimmune serum with a cutoff value of 0.05. The arrows indicate the
time points of booster immunizations. Symbols: , gagRRE + Rev; ,
UTRgagRRE + Rev; , syngag; ×, pcDNA.
|
|
In contrast, Gag-specific serum antibody responses raised in mice after
repeated coadministration of UTRgagRRE and pRev were
significantly
delayed and reached poor maximum titers of 1:5,500
1 week after the
second booster immunization. No Gag-specific
antibody response was
detectable at any time point in the sera
of pcDNA3 plasmid-immunized
mice and animals coinjected with gagRRE
and the Rev expression
vector.
Anti-Gag isotype responses in mice immunized by different routes
with modified Gag expression vectors.
The method of DNA delivery
is an important parameter for optimizing the DNA immunization. Thus, we
compared i.m. needle injection and bombardment of abdominal skin with
plasmid DNA-coated gold particles (gene gun) with respect to the
induction of humoral and cellular immune responses. Antibody isotype
responses to Gag were assessed 2 weeks after the first (Fig.
4A) and second (Fig. 4B) booster
immunizations.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 4.
Influence of immunization route on the Gag-specific
isotype responses induced by i.m and i.d. immunization with various Gag
expression vectors. Mice were immunized either by i.m. injection or by
gene gun immunization and boostered twice in 3-week intervals. IgG1 and
IgG2a antibody titers in serum were determined 2 weeks after the first
(A) and second (B) booster immunizations of mice that were immunized
with Gag expression plasmids, as indicated. Gag-specific IgG1 and IgG2a
antibodies were measured in serum by ELISA and are expressed as the
reciprocal of the highest plasma dilution that resulted in an
absorbance value (OD = 495) three times greater than that
of the same dilution of the corresponding preimmune serum with a cutoff
value of 0.05. Each bar represents the group mean (n = 5) for anti-Gag titers, and vertical lines represent the SD. The
numbers above each bar pair represent the calculated ratio of IgG1 to
IgG2a anti-Gag antibodies.
|
|
Mice, which were i.m. immunized with p-syngag produced a significant
Th1 mediated anti-Gag response, characterized by high
titers of IgG2a
isotypes with substantial mean titers of 1:49,000,
but only minute
quantities of Gag-reactive IgG1 antibodies (1:7,000)
corresponding to
an IgG1/IgG2a ratio of 0.14 (Fig.
4A). A strong
Th1 response
(IgG1/IgG2a ratio of 0.04), but with substantially
lower IgG2a
(1:1,930) and IgG1 titers (1:80), was obtained after
i.m. coinjection
of UTRgagRRE and pRev. In contrast, at that time
point no anti-Gag
response was detectable from mice, in which
particle gun was used to
administer either p-syngag or UTRgagRRE
and pRev (Fig.
4A).
At 2 weeks after the second booster immunization by i.m. needle
injection, the p-syngag group of mice developed increased
levels of
IgG1 isotypes (1:30,720) but slightly decreased IgG2a
isotypes
(1:40,950), with an IgG1/IgG2a ratio of 0.75. At that
time point
increased IgG2a (1:10,230) and IgG1 (1:1,920) titers,
with an
IgG1/IgG2a ratio of 0.09 were detectable from the group
of mice
coimmunized with UTRgagRRE and pRev by the i.m. route
(Fig.
4B). In
contrast, i.d. immunization of these Gag expression
plasmids with the
particle gun resulted in a Th2-type antibody
response. Thus,
substantial titers of anti-Gag IgG1 isotypes (1:28,800),
but only low
levels of specific IgG2a isotypes (1:120), with an
IgG1/IgG2a ratio of
240, were observed after i.d. p-syngag injection
(Fig.
4B).
Furthermore, significant titers of IgG1 antibodies
(1:4,800) and IgG2a
antibodies (1:1,080), with an IgG1/IgG2a ratio
of 4.44, were detectable
from the serum of mice coimmunized with
UTRgagRRE and pRev by particle
gun. At all time points, no Gag-specific
antibodies were measurable
from the serum of mice from the control
group.
In vitro cytokine release of splenocytes from mice immunized with
plasmid DNA.
The antigen-specific cytokine secretion as a measure
of T helper cell subpopulations was determined by specific stimulation of splenic cells, obtained from mice 5 days after the second booster immunization. Splenocytes from mice i.m. immunized with both the p-syngag and UTRgagRRE/Rev vector systems showed a substantial gamma
interferon (IFN-
) production upon specific in vitro stimulation with
purified Gag proteins (Table 1). However,
only a weak, but specific IFN-
secretion was observed after i.d.
administration of p-syngag with the particle gun. In contrast, no
detectable amounts of IFN-
were secreted from restimulated
splenocytes of mice i.d. coimmunized with UTRgagRRE and a Rev
expression vector (Table 1) and nonstimulated splenocytes of all
experimental groups of mice (data not shown).
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Cytokine profile of in vitro Gag-stimulated splenocytes
from mice immunized i.m. by needle injection or i.d. by particle
gun with various Gag expression vectors
|
|
To assess Th2 differentiation, ELISA was performed from aliquots of the
same cell culture supernatants to quantify the concentrations
of
secreted interleukin-4 (IL-4) and IL-5. In all groups of immunized
and
nonimmunized mice, independent of the immunization route,
no IL-4 and
IL-5 secretion was detectable from the supernatants
of specifically
restimulated, as well as nonstimulated,
splenocytes.
Thus, an i.m. immunization of vectors containing the modified Gag
expression cassettes induced a strong Th1 cytokine profile,
whereas
particle gun injection of these plasmid constructs resulted
in a
cytokine response near background
levels.
Induction of CTL responses in mice immunized with modified Gag
expression plasmids.
In order to analyze the capacity of p-syngag
plasmids to induce a Gag-specific CTL response, splenic cells, derived
from immunized mice 3 weeks after the primary immunization, were
specifically restimulated in a 5-day mixed lymphocyte tumor cell
culture and tested for cytotoxic activity. The AMQMLKETI 9-mer
p24(CA)-derived peptide used in this assay is known to constitute a
Dd-restricted CTL epitope in BALB/c mice.
Gag-specific CTL were detectable after a single i.m. injection of
p-syngag, whereas the administration of UTRgagRRE-pRev and gagRRE-pRev
combinations was not sufficient to induce detectable CTL responses.
Furthermore, no CTL priming was observed after an i.d. injection of
p-syngag, as well as of the UTRgagRRE-pRev and gagRRE-pRev combinations by particle gun immunization (Fig. 5).
These results showed that i.m. injection of p-syngag was the most
efficient vaccination strategy to induce both substantial humoral and
cellular Gag-specific immune responses.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 5.
CTL activity in splenocytes from mice immunized i.m. by
needle injection or i.d. by particle gun with the indicated Gag
expression vectors. Lymphoid cells obtained from mice 5 days after the
booster injection were cocultured with Gag peptide-pulsed syngeneic
P815 mastocytoma cells (irradiated with 20,000 rads). Control assays
included splenocytes of nonimmunized mice stimulated in vitro with
peptide-pulsed P815 cells. Cytotoxic effector populations were
harvested after 5 days of in vitro culture. The cytotoxic response was
read against 9-mer Gag-peptide-pulsed A20 cells and untreated A20
negative target cells in a standard 51Cr release assay. The
data shown are mean values of triplicate cultures. The standard errors
of the means of triplicate data were always less than 15% of the
mean.
|
|
Contribution of CpG motifs within syngag on the
immunogenicity of the p-syngag expression vector.
The HIV-1 genome
differs from that of most human genes in terms of a noticeably high A+U
content and by the predominant use of adenine and uracile in the third
codon position. Adaption of the wt HIV-1 gag codon usage to
that of highly expressed human genes leads to a significant increase in
the G+C content and the generation of four typical CpG motifs
(RRCGYY), which are not present in the wt gag sequence. In
order to investigate the contribution of that CpG motifs on the high
immunogenicity of p-syngag, a modified syngag gene was
constructed, in which all cytosines within consensus CpG motifs were
mutated, without altering the amino acid sequence (p-syngag
CpG; Fig.
1). The mutations within syngag had no influence on the Gag
expression and secretion levels in murine C2C12 muscle cells (Fig.
6), as well as in human (H1299) and
monkey (COS-7) cells (data not shown). Furthermore, comparative
examination of the in vitro stimulatory properties of p-syngag and
p-syngag
CpG in splenic single cell cultures of nonimmunized mice
revealed nonsignificant differences of both vector constructs (Table
2). In this assay system, in contrast to
CpG ODNs, neither p-syngag nor p-syngag
CpG could induce significant
concentrations of Th1-type (IFN-
) or Th2-type (IL-5 and IL-6)
cytokines. Occasionally, increased IL-12 production was detectable in
cultures of splenic cells, stimulated with p-syngag, compared to those
stimulated with p-syngag
CpG. However, with respect to the high SDs
of individual IL-12 values, there is no statistical proof that the
IL-12 production from both vectors is substantially different. The lack
of immune stimulation by the used pcDNA3 vector constructs may be
explained by the presence of a number of inhibitory sequence motifs
within the plasmid backbone.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 6.
Comparative Gag expression in transfected C2C12 cells
with p-syngag and p-syngag CpG constructs. C2C12 cells were
transiently transfected by calcium phosphate precipitation with the
indicated plasmids, and cells (A) and cell culture supernatants (B)
were harvested 48 h posttransfection. Control C2C12 cells were
transfected with the pcDNA3 plasmid. Cell lysates (50 µg of total
protein) and sucrose-sedimented proteins from the culture supernatant
were separated by SDS-10% PAGE and analyzed by immunoblotting with a
p24-specific monoclonal antibody. Arrows at the right indicate the
position of the Gag polyprotein. Sizes are indicated in kilodaltons.
|
|
In order to assess the influence of CpG motifs on the high
immunogenicity of the p-syngag expression vector, groups of BALB/c
mice
were inoculated with p-syngag or p-syngag

CpG and tested
for the
specific induction of antibody, cytokine, and CTL responses.
For that
purpose groups of each 20 BALB/c were immunized in two
separate
experiments and serum samples, obtained 2 weeks after
the second
booster immunization, were analyzed for Gag-specific
total
immunoglobulin and isotype responses. In these experiments,
p-syngag

CpG induced high titers of specific total immunoglobulin
(1:153,600), IgG1 (1:114,300), and IgG2a (1:128,000) isotypes,
which
were similar to those induced by p-syngag (Table
3).
We used an ELISA assay to compare antigen-specific IFN-

secretion as
a measure of Th1 memory cells induced after immunization
with p-syngag
and p-syngag

CpG plasmids. Ten days after i.m. immunization
of BALB/c
mice, splenocytes were isolated, incubatedin vitro for
36 h with
or without purified Gag protein, and assayed for cytokine
production.
Upon restimulation with Gag protein, splenocytes from
mice immunized
with both p-syngag and p-syngag

CpG showed comparably
high IFN-

secretion, with mean concentrations of 13,499 and 12,441
pg/ml.
Furthermore, significant concentrations of IL-6 and IL-12,
but no
detectable levels of IL-4, IL-5, and tumor necrosis factor
alpha
(TNF-

), were secreted from splenic cells of both groups
of immunized
mice (Table
3). These findings clearly demonstrate
that both tested
syngag expression vectors induced a specific
Th1-dominated
immune response, which is not significantly modulated
by the presence
or absence of the five CpG motifs within or directly
3' to the codon
optimized
gag.
Moreover, a specific CTL response of BALB/c mice to the Gag protein was
induced to comparable efficiency with the p-syngag
and the
p-syngag

CpG expression vectors (Table
3). The p24(CA)-specific
CTL
reactivity was detectable as soon as 10 days after the primary
i.m.
injection of the
syngag vector constructs. These data
strongly
indicate that the additional CpG motifs within
syngag do not significantly
contribute to the strong
capacity of p-syngag to induce specific
CD8
+ CTL
responses.
Modulation of antibody induction from DNA vaccines by
coadministered CpG ODNs.
To study the potential of CpG motifs to
serve as an adjuvant for DNA vaccines, we used a CpG ODN that was
previously described to possess potent effects on the murine immune
system in vitro and to augment immune responses in vivo
(34). BALB/c mice were coimmunized with 80 µg of
p-syngag and increasing concentrations of CpG ODNs ranging from 0 to 50 µg per injection and the antibody responses were measured 2 weeks
after the booster immunization with the same plasmid-ODN combination.
The anti-Gag response was drastically lower in mice injected with
p-syngag plus high doses of CpG ODNs than in those immunized with DNA
vaccine alone, and the observed negative effect was dose dependent. For
example, the mean titers of anti-Gag antibodies were reduced ca. 2- to 10-fold and greater than 100-fold by the addition of 10 or 50 µg of
CpG ODN, respectively. Thus, direct adjuvation of the DNA vaccine with
high doses of ODNs appears to hinder the induction of antibody
responses against the expressed antigen (Fig.
7A). However, the decrease in antibody
production was also observed after coadministration of high
concentrations of nonstimulatory GpG and CpG-M ODNs (Fig. 7B),
indicating that the observed inhibition of immune responses is not
caused by CpG motifs. However, at low CpG ODN concentrations of 0.4 µg per dose, a 5- to 10-fold increase in Gag-specific antibody
response was induced by the coadministered p-syngag expression vector.
The enhancement of humoral responses was not observed after adjuvation
of syngag plasmids with low doses of the control ODNs GpG or CpG-M,
indicating that the CpG motif rather than other ODN-specific
properties, such as the backbone modification by using phosphorothioate
ODNs, was responsible for the observed weak enhancing effect of CpG
ODN. In addition, these results indicate a dose-dependent interference
of CpG and non CpG ODNs with the DNA vaccine.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 7.
Effect of coadministered phosphorothioate ODNs to the
immunogenicity of the p-syngag expression vector. (A) Various
concentrations of immunostimulatory CpG ODNs were coadministered i.m.
with 80 µg of p-syngag. Serum samples were obtained 2 weeks after the
booster immunization. Titers of Gag-specific IgG1 and IgG2a antibodies
were analyzed by isotype ELISA and are expressed as the reciprocal of
the highest plasma dilution that resulted in an absorbance value
(OD = 495) three times greater than that of a corresponding
preimmune serum with a cutoff value of 0.05. Each bar represents the
mean values derived from 18 animals. (B) Each 50 µg of the indicated
immunostimulatory and nonstimulatory ODNs was i.m. coadministered with
80 µg of p-syngag, and the specific antibody isotypes were measured 2 weeks after the booster immunization. Each bar represents the mean
values ± the SD derived from six mice.
|
|
 |
DISCUSSION |
Recent results by several groups have clearly demonstrated that
vaccine vectors exploiting codon-optimized genes elicit increased humoral and cellular responses than did vector constructs encoding the
corresponding wt gene (1, 29, 43). However, the mechanisms underlying the enhanced efficacy and immunogenicity of synthetic gene-based DNA vaccines are not yet clear so far. Thus, in the present
study we analyzed the potential impact of enhanced protein expression,
sequence modifications within the foreign gene, and the mode of gene
delivery on the immunogenicity of HIV-1 Gag expression vectors.
We have shown that syngag and wt gag expression
units were equally efficient to mediate Gag protein expression and
secretion from human H1299 lung carcinoma cells and African green
monkey COS-7 kidney cells. In contrast, we achieved >10-fold-increased Gag expression levels with the codon-optimized syngag
plasmids in murine C2C12 muscle cells compared to the corresponding wt gag vector system. The mechanisms supporting substantial Gag
expression from syngag, but not from wt gag
constructs, in the murine C2C12 muscle cells are still not clear.
However, this observation may be explained by previous results by
others, suggesting either a lack or nonfunctionality of specific
cellular (3, 24) and viral (28, 40) factors
to be responsible for defects in Gag protein production and lack of
virion assembly in murine cells. We have previously reported that the
marked differences between wt gag and syngag expression are clearly due
to alterations in the nuclear translocation of viral mRNAs and not
based on modifications in transcriptional regulation. More
specifically, the findings by our group and others that, unlike wt
gag-derived mRNAs, syngag-derived mRNAs are not
exported via the exportin-1 nuclear export pathway (12,
17) supports the suggestion that the absence or nonfunctionality of cellular or viral components, which are involved in the
Rev-CRM-1-dependent mRNA export or associated cellular mechanisms may
also account for the observed differences in Gag expression in murine
C2C12 muscle cells. However, this hypothesis remains to be validated in
future experiments.
In the light of the differences in Gag production from C2C12 cells,
further studies were conducted in the BALB/c mouse model to compare the
immunogenicity of both wt gag and syngag
expression plasmids. The results presented here show that
sequence-optimized syngag-based plasmids induce
substantially increased humoral and cellular responses compared to wt
gag-based DNA vaccine, independent of the route of vector
administration. The improved potency of syngag over the wt
gag system in terms of inducing anti-Gag responses correlated obviously with the more efficient in vitro Gag protein expression observed in cultures of murine C2C12 cells. These results indicate that the increase in protein expression may be an important parameter for the enhanced immunogenicity of the syngag constructs.
In addition, a number of studies have shown that the method of
immunization can influence both the strength and the nature of immune
responses. In our studies, i.m. needle injection was superior to i.d.
particle gun immunization with respect to the priming of humoral and
cellular immune responses, independent of the type of Gag expression
vectors used in the vaccination study. The i.m. needle injection of
both Gag plasmid systems in saline produced a Th1-biased immune
response with mostly IgG2a isotypes. In contrast, the same DNA vectors
delivered i.d. by gene gun produced a more Th2-like immune response
with predominantly IgG1 antibodies. Moreover, i.m. immunization was
more efficient than particle gun injection in priming of humoral
responses, due to elevated antibody titers and the occurrence of
antibodies at earlier times postimmunization. The i.m. needle injection
of plasmid DNA differs considerably from i.d. DNA inoculation by gene
gun immunization in several aspects, such as the method and route of
DNA delivery, the concentration of applicated plasmids, and the
efficacy of cell transfection by different routes of DNA entry. All of
these factors may contribute to the observed differences in T helper
cell differentiation and the strength and polarization of the immune
response. Previous work has shown that the differentiation of naive Th
cells into Th1 or Th2 cells can be affected by many factors, the most
important of which are cytokines. Herein, IFN-
is a key regulator of
Th1 differentiation, whereas IL-4 is a key regulator of Th2
differentiation. In the experiments presented here, IFN-
production
was much higher in i.m. immunized mice than in animals injected by
particle gun, independent on the vector constructs used, thus
supporting the enhanced capacity of the i.m. route of DNA
administration to prime Th1 immunity. However, the tendency of gene
gun-mediated DNA immunization to elicit predominantly IgG1 subclass
responses, while i.m. needle inoculation yields mixed or predominantly
IgG2a responses could also reflect significant differences in the
amounts of soluble antigen synthesized after DNA delivery by the i.m
and i.d. routes.
An other consideration for optimizing DNA vaccines is through the
adjuvant effects provided by immune stimulatory CpG motifs within the
inoculated gene (19). In a recent report it was suggested that a higher CpG content obtained by mammalian codon usage may contribute to a higher antibody and CTL response observed after synthetic versus wt gene vaccination (1, 29). However,
since neither antibody isotypes nor cytokine profiles were analyzed, any influence on the Th type of immune response was difficult to
evaluate in that investigation. When applying the definition of two 5'
purines, an unmethylated CpG motif and two 3' pyrimidines (RRCGYY), as
consensus putative immune stimulatory CpG motifs, as many as seven and
three CpG motifs are present in syngag and wt gag
genes, respectively. In order to define the role of CpG motifs within
the codon-optimized syngag on the observed strong immunogenicity of p-syngag, we generated a variant of
syngag, in which all CpG motifs, which have been newly
created within syngag in consequence of codon optimization,
were inactivated by silent point mutations. Our transfection studies
with various mammalian cell lines did not indicate significantly
altered yields of Gag protein expression by p-syngag
CpG relative to
p-syngag. Furthermore, our data strongly indicate that the few CpG
motifs generated within syngag by codon optimization did not
significantly influence the immunological properties of the plasmid and
the capacity of p-syngag to generate strong humoral and cellular immune responses in the mouse model. Thus, the few additional CpG motifs generated within syngag by codon optimization seem to have no significant influence on the biological properties of the syngag plasmid. The exact effects of CpG motifs within the plasmid are difficult to predict since the precise arrangement, spacing, and sequences on the flank of immune-stimulatory CpG motifs may influence CpG adjuvant effects. Furthermore, the addition of large numbers of CpG
motifs may even have negative effects on the priming of immune
responses, due to the overstimulation of IFN-
/
and other factors
that downregulate plasmid gene expression (34). This field
is even more complicated by the recent description of putative immune-neutralizing motifs, which oppose the ability of an
immune-stimulatory CpG motive to induce cytokine expression and may
interfere with the induction of the desired immune responses
(20). These inhibitory sequence motifs, consisting of
direct repeats of CpG dinucleotides and/or CpGs preceded by a C and
followed by a G, are present in the used pcDNA3 vaccine vectors in
multiple copies. In addition, since more than 400 nucleotide
substitutions have been conducted throughout wt gag gene to
generate a completely codon-optimized Gag gene (12), we
cannot exclude that other, not-yet-characterized activities have been
generated, which may contribute to the increased capacity of p-syngag
to induce humoral and cellular responses, compared to wt gag plasmids.
To study the potential of synthetic ODNs that contain unmethylated CpG
motifs (CpG ODNs) to serve as an adjuvant for DNA vaccines, we used a
CpG ODN (ISS) that is known to possess potent effects on the murine
immune system in vitro and to augment in vivo immune responses
(34). Surprisingly, at high CpG ODN concentrations, the
anti-Gag response detected at any given time point after immunization was lower in mice injected with p-syngag plus CpG than in those injected with the p-syngag plasmid alone, and the negative effect was
dose dependent. Thus, mixing ODNs directly with a DNA vaccine appears
to hinder the induction of antibody response against the expressed
antigen. These data support a previous work, which demonstrated that
the coadministration of CpG ODNs and a DNA vaccine encoding hepatitis B
surface antigen had a negative effect on the priming of specific immune
responses (39). The observed immunosuppressive effects of
CpG ODNs at higher concentrations could be a result of interference
with either antigen expression or the immune response against the
antigen. However, the dose dependency of CpG ODN interference and the
fact that nonstimulatory ODNs reduced gene expression as much as an
equivalent dose of CpG ODN suggests that reduced gene expression rather
than cytokine mediated downregulation of the cytomegalovirus promoter
plays a crucial role in the observed decrease in antibody production.
The reduced immunogenicity of p-syngag plasmid DNA mixed with ODNs may
be due to the interference of uptake into cells. However, our
data also indicate that, at low concentrations, the specific
immunostimulatory effects of CpG ODNs dominate over the
less-specific suppressive effects of ODNs on the immunogenicity
of the p-syngag vector. Further studies are needed to evaluate the
specific mechanism by which ODNs mediate dose-dependent promotion or
suppression of foreign gene expression from plasmid DNA. The results of
the present study clearly indicate that increased Gag expression levels
rather than altered vector immunity by codon adaption is responsible
for the strong immunogenicity of the p-syngag plasmid.
 |
ACKNOWLEDGMENTS |
The excellent technical assistance of Ingrid Kirst and Elke
Perthen is appreciated. We also thank Marcus Neumann (GSF, Munich, Germany) for providing the Rev expression plasmid pCsRevsg25-GFP.
This work was supported by DLR grant 01 KI 97 65/3 to R.W.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institute for
Medical Microbiology, Klinikum Regensburg, Franz-Josef-Strauss Allee 11, 93053 Regensburg, Germany. Phone: 49 (0) 941-944-6452. Fax: 49 (0)
941-944-6402. E-mail:
ralf.wagner{at}klinik.uni-regensburg.de.
 |
REFERENCES |
| 1.
|
Andre, S.,
B. Seed,
J. Eberle,
W. Schraut,
A. Bultmann, and J. Haas.
1998.
Increased immune response elicited by DNA vaccination with a synthetic gp120 sequence with optimized codon usage.
J. Virol.
72:1497-1503[Abstract/Free Full Text].
|
| 2.
|
Betts, M. R.,
J. Krowka,
C. Santamaria,
K. Balsamo,
F. Gao,
G. Mulundu,
C. Luo,
N. N'Gandu,
H. Sheppard,
B. H. Hahn,
S. Allen, and J. A. Frelinger.
1997.
Cross-clade human immunodeficiency virus (HIV)-specific cytotoxic T-lymphocyte responses in HIV-infected Zambians.
J. Virol.
71:8908-8911[Abstract].
|
| 3.
|
Bieniasz, P. D., and B. R. Cullen.
2000.
Multiple blocks to human immunodeficiency virus type 1 replication in rodent cells.
J. Virol
74:9868-9877[Abstract/Free Full Text].
|
| 4.
|
Borrow, P.,
H. Lewicki,
B. H. Hahn,
G. M. Shaw, and M. B. Oldstone.
1994.
Virus-specific CD8+ cytotoxic T-lymphocyte activity associated with control of viremia in primary human immunodeficiency virus type 1 infection.
J. Virol.
68:6103-6110[Abstract/Free Full Text].
|
| 5.
|
Boyer, J. D.,
A. D. Cohen,
S. Vogt,
K. Schumann,
B. Nath,
L. Ahn,
K. Lacy,
M. L. Bagarazzi,
T. J. Higgins,
Y. Baine,
R. B. Ciccarelli,
R. S. Ginsberg,
R. R. MacGregor, and D. B. Weiner.
2000.
Vaccination of seronegative volunteers with a human immunodeficiency virus type 1 env/rev DNA vaccine induces antigen-specific proliferation and lymphocyte production of beta-chemokines.
J. Infect. Dis.
181:476-483[CrossRef][Medline].
|
| 6.
|
Boyer, J. D.,
B. Wang,
K. E. Ugen,
M. Agadjanyan,
A. Javadian,
P. Frost,
K. Dang,
R. A. Carrano,
R. Ciccarelli,
L. Coney,
W. V. Williams, and D. B. Weiner.
1996.
In vivo protective anti-HIV immune responses in non-human primates through DNA immunization.
J. Med. Primatol.
25:242-250[Medline].
|
| 7.
|
Deml, L.,
R. Schirmbeck,
J. Reimann,
H. Wolf, and R. Wagner.
1999.
Immunostimulatory CpG motifs trigger a T helper-1 immune response to human immunodeficiency virus type-1 (HIV-1) gp 160 envelope proteins.
Clin. Chem. Lab. Med.
37:199-204[CrossRef][Medline].
|
| 8.
|
Donnelly, J. J.,
J. B. Ulmer,
J. W. Shiver, and M. A. Liu.
1997.
DNA vaccines.
Annu. Rev. Immunol.
15:617-648[CrossRef][Medline].
|
| 9.
|
Durali, D.,
J. Morvan,
F. Letourneur,
D. Schmitt,
N. Guegan,
M. Dalod,
S. Saragosti,
D. Sicard,
J. P. Levy, and E. Gomard.
1998.
Cross-reactions between the cytotoxic T-lymphocyte responses of human immunodeficiency virus-infected African and European patients.
J. Virol.
72:3547-3553[Abstract/Free Full Text].
|
| 10.
|
Feltquate, D. M.,
S. Heaney,
R. G. Webster, and H. L. Robinson.
1997.
Different T helper cell types and antibody isotypes generated by saline and gene gun DNA immunization.
J. Immunol.
158:2278-2284[Abstract].
|
| 11.
|
Ferbas, J.,
A. H. Kaplan,
M. A. Hausner,
L. E. Hultin,
J. L. Matud,
Z. Liu,
D. L. Panicali,
H. Nerng Ho,
R. Detels, and J. V. Giorgi.
1995.
Virus burden in long-term survivors of human immunodeficiency virus (HIV) infection is a determinant of anti-HIV CD8+ lymphocyte activity.
J. Infect. Dis.
172:329-339[Medline].
|
| 12.
|
Graf, M.,
A. Bojak,
L. Dem,
K. Bieler,
H. Wolf, and R. Wagner.
2000.
Concerted action of multiple cis-acting sequences is required for Rev dependence of late human immunodeficiency virus type 1 gene expression.
J. Virol.
74:10822-10826[Abstract/Free Full Text].
|
| 13.
|
Gurunathan, S.,
D. M. Klinman, and R. A. Seder.
2000.
DNA vaccines: immunology, application, and optimization.
Annu. Rev. Immunol.
18:927-974[CrossRef][Medline].
|
| 14.
|
Harrer, E.,
T. Harrer,
P. Barbosa,
M. Feinberg,
R. P. Johnson,
S. Buchbinder, and B. D. Walker.
1996.
Recognition of the highly conserved YMDD region in the human immunodeficiency virus type 1 reverse transcriptase by HLA-A2-restricted cytotoxic T lymphocytes from an asymptomatic long-term nonprogressor.
J. Infect. Dis.
173:476-479[Medline].
|
| 15.
|
Harrer, E.,
T. Harrer,
S. Buchbinder,
D. L. Mann,
M. Feinberg,
T. Yilma,
R. P. Johnson, and B. D. Walker.
1994.
HIV-1-specific cytotoxic T lymphocyte response in healthy, long-term nonprogressing seropositive persons.
AIDS Res. Hum. Retrovir.
10(Suppl. 2):S77-S78.
|
| 16.
|
Klein, M. R.,
C. A. van Baalen,
A. M. Holwerda,
S. R. Kerkhof Garde,
R. J. Bende,
I. P. Keet,
J. K. Eeftinck Schattenkerk,
A. D. Osterhaus,
H. Schuitemaker, and F. Miedema.
1995.
Kinetics of Gag-specific cytotoxic T lymphocyte responses during the clinical course of HIV-1 infection: a longitudinal analysis of rapid progressors and long-term asymptomatics.
J. Exp. Med.
181:1365-1372[Abstract/Free Full Text].
|
| 17.
|
Kotsopoulou, E.,
V. N. Kim,
A. J. Kingsman,
S. M. Kingsman, and K. A. Mitrophanous.
2000.
A Rev-independent human immunodeficiency virus type 1 (HIV-1)-based vector that exploits a codon-optimized HIV-1 gag-pol gene.
J. Virol.
74:4839-4852[Abstract/Free Full Text].
|
| 18.
|
Koup, R. A., and D. D. Ho.
1994.
Shutting down HIV.
Nature
370:416[CrossRef][Medline].
|
| 19.
|
Krieg, A. M.
1996.
Lymphocyte activation by CpG dinucleotide motifs in prokaryotic DNA.
Trends Microbiol.
4:73-76[CrossRef][Medline].
|
| 20.
|
Krieg, A. M.,
T. Wu,
R. Weeratna,
S. M. Efler,
H. L. Love,
L. Yang,
A. K. Yi,
D. Short, and H. L. Davis.
1998.
Sequence motifs in adenoviral DNA block immune activation by stimulatory CpG motifs.
Proc. Natl. Acad. Sci. USA
95:12631-12636[Abstract/Free Full Text].
|
| 21.
|
Lu, S.,
J. Arthos,
D. C. Montefiori,
Y. Yasutomi,
K. Manson,
F. Mustafa,
E. Johnson,
J. C. Santoro,
J. Wissink,
J. I. Mullins,
J. R. Haynes,
N. L. Letvin,
M. Wyard, and H. L. Robinson.
1996.
Simian immunodeficiency virus DNA vaccine trial in macaques.
J. Virol.
70:3978-3991[Abstract].
|
| 22.
|
Lynch, J. A.,
M. deSouza,
M. D. Robb,
L. Markowitz,
S. Nitayaphan,
C. V. Sapan,
D. L. Mann,
D. L. Birx, and J. H. Cox.
1998.
Cross-clade cytotoxic T cell response to human immunodeficiency virus type 1 proteins among HLA disparate North Americans and Thais.
J. Infect. Dis.
178:1040-1046[Medline].
|
| 23.
|
MacGregor, R. R.,
J. D. Boyer,
K. E. Ugen,
K. E. Lacy,
S. J. Gluckman,
M. L. Bagarazzi,
M. A. Chattergoon,
Y. Baine,
T. J. Higgins,
R. B. Ciccarelli,
L. R. Coney,
R. S. Ginsberg, and D. B. Weiner.
1998.
First human trial of a DNA-based vaccine for treatment of human immunodeficiency virus type 1 infection: safety and host response.
J. Infect. Dis.
178:92-100[Medline].
|
| 24.
|
Mariani, R.,
G. Rutter,
M. E. Harris,
T. J. Hope,
H. G. Krausslich, and N. R. Landau.
2000.
A block to human immunodeficiency virus type 1 assembly in murine cells.
J. Virol.
74:3859-3870[Abstract/Free Full Text].
|
| 25.
|
Mossman, S. P.,
C. C. Pierce,
M. N. Robertson,
A. J. Watson,
D. C. Montefiori,
M. Rabin,
L. Kuller,
J. Thompson,
J. B. Lynch,
W. R. Morton,
R. E. Benveniste,
R. Munn,
S. L. Hu,
P. Greenberg, and N. L. Haigwood.
1999.
Immunization against SIVmne in macaques using multigenic DNA vaccines.
J. Med. Primatol.
28:206-213[Medline].
|
| 26.
|
Niedrig, M.,
J. P. Rabanus,
J. L'Age Stehr,
H. R. Gelderblom, and G. Pauli.
1988.
Monoclonal antibodies directed against human immunodeficiency virus (HIV) Gag proteins with specificity for conserved epitopes in HIV-1: HIV-2 and simian immunodeficiency virus.
J. Gen. Virol.
69:2109-2114[Abstract/Free Full Text].
|
| 27.
|
Pertmer, T. M.,
M. D. Eisenbraun,
D. McCabe,
S. K. Prayaga,
D. H. Fuller, and J. R. Haynes.
1995.
Gene gun-based nucleic acid immunization: elicitation of humoral and cytotoxic T lymphocyte responses following epidermal delivery of nanogram quantities of DNA.
Vaccine
13:1427-1430[CrossRef][Medline].
|
| 28.
|
Pomerantz, R. J.,
D. Trono,
M. B. Feinberg, and D. Baltimore.
1990.
Cells nonproductively infected with HIV-1 exhibit an aberrant pattern of viral RNA expression: a molecular model for latency.
Cell
61:1271-1276[CrossRef][Medline].
|
| 29.
|
Qiu, J. T.,
R. Song,
M. Dettenhofer,
C. Tian,
T. August,
B. K. Felber,
G. N. Pavlakis, and X. F. Yu.
1999.
Evaluation of novel human immunodeficiency virus type 1 Gag DNA vaccines for protein expression in mammalian cells and induction of immune responses.
J. Virol.
73:9145-9152[Abstract/Free Full Text].
|
| 30.
|
Reimann, J.,
A. Bellan, and P. Conradt.
1988.
Development of autoreactive L3T4+ T cells from double-negative (L3T4 /Ly-2 ) Thy-1+ spleen cells of normal mice.
Eur. J. Immunol.
18:989-999[Medline].
|
| 31.
|
Rinaldo, C.,
X. L. Huang,
Z. F. Fan,
M. Ding,
L. Beltz,
A. Logar,
D. Panicali,
G. Mazzara,
J. M. Liebmann-Cottrill, et al.
1995.
High levels of anti-human immunodeficiency virus type 1 (HIV-1) memory cytotoxic T-lymphocyte activity and low viral load are associated with lack of disease in HIV-1-infected long-term nonprogressors.
J. Virol.
69:5838-5842[Abstract].
|
| 32.
|
Rinaldo, C. R., Jr.,
L. A. Beltz,
X. L. Huang,
P. Gupta,
Z. Fan, and D. J. Torpey.
1995.
Anti-HIV type 1 cytotoxic T lymphocyte effector activity and disease progression in the first 8 years of HIV type 1 infection of homosexual men.
AIDS Res. Hum. Retrovir.
11:481-489[Medline].
|
| 33.
|
Robinson, H. L., and C. A. Torres.
1997.
DNA vaccines.
Semin. Immunol.
9:271-283[CrossRef][Medline].
|
| 34.
|
Sato, Y.,
M. Roman,
H. Tighe,
D. Lee,
M. Corr,
M. D. Nguyen,
G. J. Silverman,
M. Lotz,
D. A. Carson, and E. Raz.
1996.
Immunostimulatory DNA sequences necessary for effective intradermal gene immunization.
Science
273:352-354[Abstract].
|
| 35.
|
Tang, D. C.,
M. DeVit, and S. A. Johnston.
1992.
Genetic immunization is a simple method for eliciting an immune response.
Nature
356:152-154[CrossRef][Medline].
|
| 36.
|
Ulmer, J. B.,
J. J. Donnelly,
S. E. Parker,
G. H. Rhodes,
P. L. Felgner,
V. J. Dwarki,
S. H. Gromkowski,
R. R. Deck,
C. M. DeWitt,
A. Friedman, et al.
1993.
Heterologous protection against influenza by injection of DNA encoding a viral protein.
Science
259:1745-1749[Abstract/Free Full Text].
|
| 37.
|
Wagner, R.,
L. Deml,
H. Fliessbach,
G. Wanner, and H. Wolf.
1994.
Assembly and extracellular release of chimeric HIV-1 Pr55gag retrovirus-like particles.
Virology
200:162-175[CrossRef][Medline].
|
| 38.
|
Wagner, R.,
B. Leschonsky,
E. Harrer,
C. Paulus,
C. Weber,
B. D. Walker,
S. Buchbinder,
H. Wolf,
J. R. Kalden, and T. Harrer.
1999.
Molecular and functional analysis of a conserved CTL epitope in HIV-1 p24 recognized from a long-term nonprogressor: constraints on immune escape associated with targeting a sequence essential for viral replication.
J. Immunol.
162:3727-3734[Abstract/Free Full Text].
|
| 39.
|
Weeratna, R.,
M. C. Brazolot,
A. M. Krieg, and H. L. Davis.
1998.
Reduction of antigen expression from DNA vaccines by coadministered oligodeoxynucleotides.
Antisense Nucleic Acid Drug Dev.
8:351-356[Medline].
|
| 40.
|
Winslow, B. J., and D. Trono.
1993.
The blocks to human immunodeficiency virus type 1 Tat and Rev functions in mouse cell lines are independent.
J. Virol.
67:2349-2354[Abstract/Free Full Text].
|
| 41.
|
Wolf, H.,
S. Modrow,
E. Soutschek,
M. Motz,
R. Grunow, and H. Döbl.
1990.
Production, mapping, and biological characterisation of monoclonal antibodies to the core protein (p24) of the human immunodeficiency virus type 1.
AIFO
1:24-29.
|
| 42.
|
Yankauckas, M. A.,
J. E. Morrow,
S. E. Parker,
A. Abai,
G. H. Rhodes,
V. J. Dwarki, and S. H. Gromkowski.
1993.
Long-term anti-nucleoprotein cellular and humoral immunity is induced by intramuscular injection of plasmid DNA containing NP gene.
DNA Cell Biol.
12:771-776[Medline].
|
| 43.
|
Zur, M. J.,
M. C. Chen,
B. Doe,
M. Schaefer,
C. E. Greer,
M. Selby,
G. R. Otten, and S. W. Barnett.
2000.
Increased expression and immunogenicity of sequence-modified human immunodeficiency virus type 1 gag gene.
J. Virol.
74:2628-2635[Abstract/Free Full Text].
|
Journal of Virology, November 2001, p. 10991-11001, Vol. 75, No. 22
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.22.10991-11001.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Collarini, E. J., Lee, F. E.-H., Foord, O., Park, M., Sperinde, G., Wu, H., Harriman, W. D., Carroll, S. F., Ellsworth, S. L., Anderson, L. J., Tripp, R. A., Walsh, E. E., Keyt, B. A., Kauvar, L. M.
(2009). Potent High-Affinity Antibodies for Treatment and Prophylaxis of Respiratory Syncytial Virus Derived from B Cells of Infected Patients. J. Immunol.
183: 6338-6345
[Abstract]
[Full Text]
-
Beignon, A.-S., Mollier, K., Liard, C., Coutant, F., Munier, S., Riviere, J., Souque, P., Charneau, P.
(2009). Lentiviral Vector-Based Prime/Boost Vaccination against AIDS: Pilot Study Shows Protection against Simian Immunodeficiency Virus SIVmac251 Challenge in Macaques. J. Virol.
83: 10963-10974
[Abstract]
[Full Text]
-
Siegismund, C. S., Hohn, O., Kurth, R., Norley, S.
(2009). Enhanced T- and B-cell responses to simian immunodeficiency virus (SIV)agm, SIVmac and human immunodeficiency virus type 1 Gag DNA immunization and identification of novel T-cell epitopes in mice via codon optimization. J. Gen. Virol.
90: 2513-2518
[Abstract]
[Full Text]
-
Schoenly, K. A., Weiner, D. B.
(2008). Human Immunodeficiency Virus Type 1 Vaccine Development: Recent Advances in the Cytotoxic T-Lymphocyte Platform "Spotty Business". J. Virol.
82: 3166-3180
[Full Text]
-
Wang, S., Taaffe, J., Parker, C., Solorzano, A., Cao, H., Garcia-Sastre, A., Lu, S.
(2006). Hemagglutinin (HA) Proteins from H1 and H3 Serotypes of Influenza A Viruses Require Different Antigen Designs for the Induction of Optimal Protective Antibody Responses as Studied by Codon-Optimized HA DNA Vaccines. J. Virol.
80: 11628-11637
[Abstract]
[Full Text]
-
Hegde, R., Liu, Z., Mackay, G., Smith, M., Chebloune, Y., Narayan, O., Singh, D. K.
(2005). Antigen Expression Kinetics and Immune Responses of Mice Immunized with Noninfectious Simian-Human Immunodeficiency Virus DNA. J. Virol.
79: 14688-14697
[Abstract]
[Full Text]
-
Talaat, A. M., Stemke-Hale, K.
(2005). Expression Library Immunization: a Road Map for Discovery of Vaccines against Infectious Diseases. Infect. Immun.
73: 7089-7098
[Full Text]
-
Ko, H.-J., Ko, S.-Y., Kim, Y.-J., Lee, E.-G., Cho, S.-N., Kang, C.-Y.
(2005). Optimization of Codon Usage Enhances the Immunogenicity of a DNA Vaccine Encoding Mycobacterial Antigen Ag85B. Infect. Immun.
73: 5666-5674
[Abstract]
[Full Text]
-
Deml, L., Aigner, M., Decker, J., Eckhardt, A., Schutz, C., Mittl, P. R. E., Barabas, S., Denk, S., Knoll, G., Lehn, N., Schneider-Brachert, W.
(2005). Characterization of the Helicobacter pylori Cysteine-Rich Protein A as a T-Helper Cell Type 1 Polarizing Agent. Infect. Immun.
73: 4732-4742
[Abstract]
[Full Text]
-
Trapp, S., von Einem, J., Hofmann, H., Kostler, J., Wild, J., Wagner, R., Beer, M., Osterrieder, N.
(2005). Potential of Equine Herpesvirus 1 as a Vector for Immunization. J. Virol.
79: 5445-5454
[Abstract]
[Full Text]
-
Baud, D., Ponci, F., Bobst, M., De Grandi, P., Nardelli-Haefliger, D.
(2004). Improved Efficiency of a Salmonella-Based Vaccine against Human Papillomavirus Type 16 Virus-Like Particles Achieved by Using a Codon-Optimized Version of L1. J. Virol.
78: 12901-12909
[Abstract]
[Full Text]
-
Ramakrishna, L., Anand, K. K., Mohankumar, K. M., Ranga, U.
(2004). Codon Optimization of the Tat Antigen of Human Immunodeficiency Virus Type 1 Generates Strong Immune Responses in Mice following Genetic Immunization. J. Virol.
78: 9174-9189
[Abstract]
[Full Text]
-
Bower, J. F., Yang, X., Sodroski, J., Ross, T. M.
(2004). Elicitation of Neutralizing Antibodies with DNA Vaccines Expressing Soluble Stabilized Human Immunodeficiency Virus Type 1 Envelope Glycoprotein Trimers Conjugated to C3d. J. Virol.
78: 4710-4719
[Abstract]
[Full Text]
-
Kong, W.-P., Huang, Y., Yang, Z.-Y., Chakrabarti, B. K., Moodie, Z., Nabel, G. J.
(2003). Immunogenicity of Multiple Gene and Clade Human Immunodeficiency Virus Type 1 DNA Vaccines. J. Virol.
77: 12764-12772
[Abstract]
[Full Text]
-
Marques, E. T. A. Jr., Chikhlikar, P., de Arruda, L. B., Leao, I. C., Lu, Y., Wong, J., Chen, J.-S., Byrne, B., August, J. T.
(2003). HIV-1 p55Gag Encoded in the Lysosome-associated Membrane Protein-1 as a DNA Plasmid Vaccine Chimera Is Highly Expressed, Traffics to the Major Histocompatibility Class II Compartment, and Elicits Enhanced Immune Responses. J. Biol. Chem.
278: 37926-37936
[Abstract]
[Full Text]