INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Infectious bursal disease virus (IBDV) is the prototype member of the Avibirnavirus genus in the Birnaviridae family (44) and an important pathogen of chickens, accounting for important economic losses in the poultry industry worldwide and representing a major hazard for several species of wild birds (27). During the past decade there have been outbreaks of highly virulent strains against which classical vaccines were not protective (61, 77). Improvement in the control of the disease will be obtained only through further understanding of IBDV molecular biology, including viral structure.

The IBDV genome is formed by two double-stranded RNA (dsRNA) segments of 3.2 kb (segment A) and 2.8 kb (segment B) (35, 38). Segment A contains two partially overlapping open reading frames (ORFs). The first ORF encodes the nonstructural VP5 protein (17 kDa), whose functional properties are not yet clear, although it is important in virus release and dissemination (49, 60). The second ORF codes for a 110-kDa polyprotein that is autoproteolytically cleaved, yielding three proteins: VPX (~48 kDa), VP3 (32 kDa), and VP4 (28 kDa) (Fig. 1A). A major proportion of VPX (also designated pVP2) is further proteolytically processed to VP2 (41 kDa) (48, 59). Biochemical analysis of purified capsids from virions revealed that VP2 and VP3 are the major structural proteins in the mature virion (18), while VP4, a serine-lysine protease (7, 43), is involved in the proteolytic maturation of the polyprotein (22). Segment B contains an ORF that encodes VP1 (95 kDa), which is assumed to be the RNA-dependent RNA polymerase, responsible for the reactions of transcription (plus-strand or mRNA synthesis) and replication (minus-strand synthesis) (58, 73).

View larger version (45K): [in this window] [in a new window]   FIG. 1.   Expression of VPX and VP2. (A) IBDV polyprotein structure, NH2-VPX-VP4-VP3-COOH. The recently suggested VPX-VP4 cleavage site at Ala512-Ala513 is indicated (46, 73). The cleavage site for conversion of VPX to the mature form of VP2 is around residues 450 to 456, but it is unknown. The VPX and VP2 forms used in this work are diagrammed below the polyprotein structure. (B) Expression of VPX and VP2 by AcVPX.IBDV and AcVP2.IBDV, respectively. Purified VPX and VP2 fractions (see Materials and Methods) were subjected to SDS-PAGE (11% polyacrylamide) and detected by Coomassie blue staining. Purified IBDV particles were subjected to the same treatment with silver staining. Bands corresponding to the VP1, VPX, VP2, and VP3 proteins are indicated. Molecular weight markers (MWM), in thousands, are given on the right.(C) Detection of VPX, VP2, and IBDV virions by Western blotting with polyclonal rabbit anti-VPX serum.

IBDV is a nonenveloped virus that differs from most dsRNA viruses in having a single shell. By cryoelectron microscopy and computer image reconstruction methods Böttcher et al. (8) have shown that the capsid (maximum diameter, 700 Å) is an icosahedron with 780 subunits, clustered as 260 outer trimers, arranged with a triangulation number of T=13. However, the correlation of the structural features of the capsid and the structural proteins of the virus is poorly understood.

In capsids with T>1, the protein subunits are able to adopt several different conformations depending on their different structural environments in the shell; that is, the bonding properties of subunits are not identical, and several classes of conformers exist (11). High-resolution structural studies have revealed some clues about how a capsid protein is able to know the conformation that it must adopt (see, e.g., references 5, 47, and 69), although the mechanism is still poorly understood (37). These differences are quite subtle and may be controlled by flexible regions in the protein (loops, N ends, and C ends), duplex or single-stranded RNA, metal ions, or some combination of these (36). These factors are referred to as molecular switches. Additionally, capsids with large T numbers can be achieved by one or more auxiliary proteins (scaffold, minor capsid, or enzymatic proteins) (19, 74).

We have undertaken studies of IBDV based on recombinant baculovirus and vaccinia virus systems expressing defined combinations of IBDV capsid genes in order to establish structure-function relationships and understand their architectural principles (24, 48, 51). The IBDV polyprotein expressed with the baculovirus system is processed and spontaneously assembles into different structures, e.g., rigid tubular structures, icosahedral virus-like particles (VLPs), intermediate assembly products, and tubular structures built up by VP4 (28, 51). When expressed with the vaccinia virus system, the polyprotein, either in the presence or in the absence of VP1 protein, is properly processed and forms icosahedral VLPs with a size and morphology identical to those of IBDV virions (24, 48).

In order to learn if the individual expression of the major structural proteins would regenerate any kind of particles, we have undertaken the expression of VPX, VP2, and VP3 singly and in combination (VPX and VP3; VP2 and VP3) (unpublished data). VP3 alone did not yield any type of particle (52). Here we report the different structures obtained upon expression of VPX or VP2 alone using a baculovirus expression system and their comparison with IBDV virions. We have used cryoelectron microscopy and image processing techniques to determine the three-dimensional structure of the baculovirus-expressed VP2, which forms a T=1 capsid, to a resolution of 28 Å. By comparison with the T=13 capsid from virions, we clearly demonstrate the locations of the VP2 and VP3 structural proteins in the virion capsid. Some clues about their functionality based on their locations in the T=13 capsid are discussed. Our results indicate that the C-terminal region of the VPX/VP2 capsid protein may play an important role in determining different conformations of this protein during the construction of IBDV capsids, and we discuss their implications for virion assembly.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Virus preparation. IBDV strain Soroa, a serotype I virus, was purified by a standard protocol from chicken embryo fibroblasts infected at a multiplicity of infection of 0.1 PFU per cell (24, 48) and was stored in PES buffer [25 mM piperazine-N,N'-bis(2-ethanesulfonic acid) (PIPES) (pH 6.2), 150 mM NaCl, 20 mM CaCl₂].

Construction of recombinant baculoviruses. The coding sequences of VPX and VP2 were obtained by PCR with Vent DNA polymerase (New England Biolabs) by using the recombinant plasmid pFastBac/POLY as the template (51). The oligonucleotides used were IBDV1 (5' TTCGATGATCACGATGACAAACCTGTCAGATC 3') and IBDVX (5' ACTACTGATCACCCCTTGTCGGCGGCGAGAG 3'), which cover nucleotides 1 to 1548 of ORFA1, for VPX gene amplification and IBDV1 and IBDV2 (5' GAGACTGATCACACAGCTATCCTCCTTATG 3'), covering nucleotides 1 to 1368 of ORFA1, for VP2 gene synthesis. BclI sites, shown in italics, were included to generate BamHI-compatible ends for further cloning into the baculovirus transfer vector pAcYMI (54). The derivative plasmids, pAcYM1-VPX. IBDV and pAcYM1-VP2.IBDV, were proof sequenced. The corresponding recombinant baculoviruses, AcVPX.IBDV and AcVP2.IBDV, were obtained by standard procedures (39).

Purification of VP2 and VPX structures. Sf9 cells were infected with AcVPX.IBDV or AcVP2.IBDV at a multiplicity of infection of 1 PFU/cell. Cells were harvested at 72 h postinfection and processed as described previously (51), by purifying sedimenting material with a 25% sucrose cushion and a linear 25-to-50% sucrose gradient, both in PES buffer. Fractions containing VPX or VP2 proteins were identified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting with anti-VPX rabbit serum as described elsewhere (48, 51). Enriched fractions consisting of VPX or VP2 particles were selected for structural studies and were used within 1 to 2 days of purification.

Conventional electron microscopy. Samples (5 µl) were applied to glow-discharged carbon-coated grids for 2 min. Samples were negatively stained with 2% (wt/vol) aqueous uranyl acetate. Micrographs were recorded with a JEOL 1200 EXII electron microscope operating at 100 kV at a nominal magnification of ×40,000.

Cryoelectron microscopy. Fractions containing virions or VP2 structures to be examined by cryoelectron microscopy were pooled, centrifuged at 35,000 rpm for 2 h at 4°C in an SW55 rotor (Beckman), and resuspended in PES buffer (100 to 200 µl) at 2 to 5 mg/ml. They were then dialyzed against phosphate-buffered saline (PES buffer is a "bubbling" agent under cryoelectron microscopic analysis) and diluted until a uniform distribution of particles was observed (when examined by negative staining). Drops (5 µl) of sample were applied to one side of either a holey carbon or carbon-coated grid, which was then blotted and plunged into a bath of liquid ethane (180°C) according to established procedures (21), essentially as described previously(12). Micrographs were recorded under minimal exposure conditions so that the specimens imaged received exposures of 8 to 10 e/nm², at nominal magnifications of ×45,000 or ×40,000 on a Philips CM12 or a JEOL 1200 EXII electron microscope, respectively. Gatan 626 cryoholders operating at a temperature of about 171°C were used in both electron microscopes. Microscopes were operated at 100 kV, and images were recorded with a 1-s exposure on Kodak SO 163 electron image films, which were developed in full-strength Kodak D19 for 12 min at room temperature. In some experiments, bacteriophage T4 was vitrified and the 40.5-Å axial spacing of its tail sheath was used as an internal magnification standard (57). Micrographs were assessed for resolution and astigmatism by computer Fourier analysis and/or optical diffraction analysis, and their defocus values were estimated from the positions of the first zero of the contrast transfer function (CTF) (45). For the selected micrographs analyzed, the first zero was around 26 Å¹.

Image analysis. Micrographs were digitized on an Eikonix IEEE-488 camera with a square-pixel size corresponding to 5.3 (×45,000 negatives) or 6 (×40,000 negatives) Å/pixel. General image processing operations were carried out using the PIC Software system (76) running on an Alpha workstation DPW600au (Compaq). Particles were extracted and preprocessed using the automated procedure of Conway et al. (14). Particle orientations were determined by "common-lines" procedures of Fourier analysis (4, 15, 25). Model-based procedures were used for all subsequent orientation and phase origin refinements (3). For reconstruction of the small VP2 capsid, only model-based procedures were used, and as a starting model we used another small VP2 capsid extracted from the large VP2 capsid. As an internal control, the three-dimensional structure of large VP2 particles was calculated without imposing icosahedral symmetry by using a weighted-backprojection method and distributing the orientations over the whole orientation space by randomly selecting equivalent views that were related by symmetry to the originals (67, 76). The resulting density map, calculated from 412 particles and without any refinement steps, was visually similar to that obtained with the icosahedral symmetry-based method (data not shown).

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Expression and characterization of IBDV VPX and VP2 proteins. The baculovirus AcVPX.IBDV contains a 1,548-nucleotide insert, which expressed a 516-amino-acid protein. The baculovirus AcVP2.IBDV contains a 1,368-nucleotide insert, which expressed a 456-amino-acid protein. VPX and VP2 proteins were expressed in insect cells and purified by a sucrose cushion followed by a sucrose gradient. Fractions containing VPX banded in a broad rage of densities (1.142 to 2.212 g/cm³), while VP2 banded at a density of 1.091 g/cm³. VPX and VP2 were concentrated and characterized by SDS-PAGE, Western blot analysis, and electron microscopy (Fig. 1A). Coomassie blue staining of SDS-PAGE gels showed that the fractions enriched in VPX and VP2 were very pure. VPX consisted of a doublet of peptides of ~48 kDa, while VP2 consisted of a single polypeptide of ~41 kDa (Fig. 1B). The doublet of VPX may represent different cleavages of the protein (70) or, as has been demonstrated for bacteriophage 6 (17), a variable unfolding which alters its migration. The VPX/VP2-monospecific serum specifically recognized both proteins (Fig. 1C). As a control, a sample of purified IBDV particles was also analyzed (Fig. 1B and C).

View larger version (99K): [in this window] [in a new window]   FIG. 2.   Electron microscopy of VPX and VP2 assemblies, compared with IBDV virions. (A) VPX twisted tubular structures; (B) VP2 doughnut-like structures; (C) purified IBDV virions. Bar, 100 nm.

Cryoelectron microscopy of VP2 particles and IBDV. The major advantage of cryoelectron microscopy over conventional electron microscopy techniques is that biological macromolecules are observed in a frozen hydrated state in amorphous ice that closely resembles the native aqueous state. For that reason VP2 structures were analyzed by cryoelectron microscopy. The doughnut-shaped structures were also observed by this technique, but in a smaller proportion than other, larger structures, 55 to 65 nm in diameter (Fig. 3A). These bigger structures, which will be referred to as "large VP2 capsids," are most likely formed from the doughnut-like structures, referred to as "small VP2 capsids," since no proteins other than VP2 were present in the fractions analyzed (Fig. 1B and C). In some cases, we were able to take snapshots of disintegrating large VP2 capsids lacking one of these smaller constitutive elements (Fig. 3A, inset).

View larger version (133K): [in this window] [in a new window]   FIG. 3.   Cryoelectron microscopy of VP2 assemblies, compared with IBDV virions. (A) VP2 capsids. White arrows point to large VP2 capsids; black arrows point to small VP2 capsids. (Inset) Snapshot of a disintegrating large VP2 capsid. (B) IBDV particles. Bar, 100 nm.

Structure of large VP2 capsids. Images from electron cryomicrographs of large VP2 particles revealed a peculiar arrangement of structural units following icosahedral symmetry. The fivefold, threefold, and twofold views were relatively abundant and clearly observed (Fig. 4A, left column). The three-dimensional structure of large VP2 capsids was determined by using 72 particles whose orientations were distributed fairly uniformly in the icosahedral asymmetric unit (Fig. 4B). To confirm that the orientation of each particle had been correctly determined, the three-dimensional map was reprojected in the appropriate viewing geometry and compared with the original images both visually (some examples are shown in Fig. 4A; compare left and right columns), and by quantitative criteria (the Fourier ring correlation method) (Fig. 5).

View larger version (55K): [in this window] [in a new window]   FIG. 4.   Evaluation of the icosahedral symmetry of large VP2 capsids and orientations of small and large VP2 particles. (A) Images of large VP2 capsids taken directly from the original cryomicrograph (left column), compared to the projected view (right column) of the three-dimensional reconstruction in the corresponding orientation. Selected large VP2 capsids oriented close to a fivefold (~5f) (top), threefold (~3f) (center), or twofold (~2f) (bottom) axis of symmetry are shown. (B) Plot of the refined orientations determined for particles used to compute the three-dimensional maps. The orientation of each particle is mapped in the icosahedral asymmetric unit (shaded region in the icosahedron in the upper right corner).  and  are the angles that specify the orientation of the capsid relative to the view direction. The icosahedral fivefold ( = 90.0°,  = ±31.72°), threefold ( = 69.09°,  = 0.0°), and twofold ( = 90.0°,  = 0.0°) axes are indicated.

View larger version (22K): [in this window] [in a new window]   FIG. 5.   Resolution assessment by Fourier ring correlation function for three-dimensional reconstructions of large VP2, small VP2, and IBDV capsids. The resolution limits determined from these plots are ~29 Å (a spatial frequency of ~0.034 Å1) for the small VP2 capsid and ~28 Å (a spatial frequency of ~0.036 Å1) for the large VP2 and IBDV capsids. The dashed line represents an estimate of the significance level of resolution (this is 2/n, where n is the number of samples at a particular spatial frequency).

View larger version (118K): [in this window] [in a new window]   FIG. 6.   Three-dimensional structure of the large VP2 capsid and the IBDV capsid. (A) Surface-shaded representations of the outer surfaces of large VP2 capsids viewed along a fivefold (top left), a threefold (top right) and a twofold (bottom left) axis of icosahedral symmetry. A model with the front half of the protein shell removed, viewed along a fivefold axis, is shown at the bottom right. For size comparison, a three-dimensional map of a small VP2 capsid, viewed along a twofold axis, is shown in the center. (B) Surface-shaded representations of the outer (top) and inner (bottom) surfaces of IBDV capsids viewed along a threefold axis of icosahedral symmetry. The five different types of trimeric capsomers are indicated by the letters a to e. Bar, 100 Å.

Structure of IBDV capsids. For purposes of comparison, a three-dimensional reconstruction of IBDV particles was also calculated (Fig. 6B). The IBDV capsid shows the same structural features as those described by Böttcher et al. (8), although the resolution was limited to 28 Å in our map (Fig. 5). The surface-shaded maps were contoured to enclose a volume showing the same features as those previously published by Böttcher et al. (8). The capsid is icosahedral and exhibits a T=13 lattice, shown in the right-handed form as shown by Böttcher et al. (8), where 260 units protruding from a continuous shell are trimer clustered. Even at this moderate resolution, five different classes of triangular capsomers can be distinguished depending on their different local environments (labeled "a" to "e" in Fig. 6B). At the present resolution, as in previous work, significant changes can be observed between the various quasi-equivalent trimers. This fact is reflected in the interactions of each trimer with their neighbors. Class e trimers, located at the strict icosahedral threefold axis, interact rather closely with their neighbors, showing three thick arms connecting with surrounding trimers of class d. Class c and d trimers, which are enantiomorphs, show two connecting arms, one thick and another thinner. Trimers of class b also show three connecting arms, only one of which is thick. And trimers of class a, located around the strict icosahedral fivefold axis, have one thick arm connecting with trimers of class b. Following the "mnemonic rule" initially formulated for bluetongue virus (BTV), trimer a in IBDV corresponds to trimer P in BTV, b corresponds to Q, c to S, d to R, and e to T. These connecting arms form an arch-like structure located from a radius of ~31 nm out to ~35 nm. Under these arches, there appear to be small pores in the thin continuous shell, six around the local sixfold axis, except in those around the pentamers, where there appear to be five pores. The only gaps of density observed between adjacent trimers are between c and d trimers and between a and a trimers. On the inner shell, there are only 200 trimeric structures (Y-shaped structures). The five expected trimers surrounding each pentamer are replaced by a density which forms an annular rim around another concentric rim. This smaller rim almost closes a pentagonal cavity at the fivefold position. It should be noted that the previously published CTF-corrected IBDV structure (8) does not show this small rim of density. Whereas the vertices of inner trimers point to the center of the hexamers (local sixfold axis), the outer trimers are rotated ~60°, with their triangular edges facing the local sixfold and fivefold axes. The outer trimers extend outward by ~4 nm from the thin shell, ~2 nm thick, whereas the inner trimers extend inward by ~3 nm.

Structure of small VP2 capsid. One dodecahedron was extracted from the large VP2 capsid reconstruction and used as an initial model to find orientations of the small VP2 capsids, probably produced after disassembly of the larger capsids (Fig. 3A). The three-dimensional reconstruction of small VP2 particles, at a resolution of 29 Å (Fig. 5), showed the same arrangement as the empty T=1 dodecahedron that forms part of large VP2 particles (Fig. 7). Surface-shaded representations of small VP2 capsid were based on the assumption that 60 VP2 molecules make up each capsid and on taking a value of 0.73 cm³/g as the partial specific volume of protein. At this threshold level, the capsid was perforated by five small holes, ~1.5 nm in diameter, around each fivefold position. Trimeric protrusions were conformationally equivalent, since they had the same local environment. In comparison with the outer trimeric units of the IBDV capsid, they did not show any arms connecting to each other, although the size and general topography were essentially identical. The capsid wall was formed by connected densities that were arranged at two different radii: 12 pentagonal platforms around the fivefold axis at an average radius of ~9 nm and 20 smaller islands of density at an average radius of ~7 nm, extending further inward at the twofold axis (Fig. 7, bottom). On the outer surface, the trimeric units protruded ~3.5 nm from the pentagonal platform. Thus, the general shape of each monomer of VP2 may be envisioned (Fig. 7, top). Due to the handedness shown by these T=1 capsids, we have assumed the right-handed form as with virion particles.

View larger version (88K): [in this window] [in a new window]   FIG. 7.   Three-dimensional structure of the small VP2 capsid. Shown are surface-shaded representations of the outer (top row) and inner (bottom row) surfaces of small VP2 capsids viewed along a fivefold (left column), a threefold (middle column), and a twofold (right column) axis of icosahedral symmetry. T=1 pentamers are shown with the same handedness as T=13 pentamers. Different VP2 subunits are indicated by different colors. In the twofold view, two subunits are subdivided into the three proposed domains (A, B, and C). The internal protrusions, located at the icosahedral twofold axis, are tinged with orange (bottom row). Bar, 50 Å.

Comparison of small VP2 and IBDV capsids. The apparent similarity of outer protruding trimers of small VP2 and IBDV capsids made feasible the comparison of carefully scaled structures of the three-dimensional maps of IBDV and small VP2 capsids. Since both capsids were quite far from the spherical shape, they were sampled on icosahedral sections in order to conveniently compare equivalent features by using the "facets" program (kindly provided by R. A. Crowther [8]).

View larger version (195K): [in this window] [in a new window]   FIG. 8.   Structural organization of IBDV and small VP2 capsids. Shown are icosahedral sections of scaled three-dimensional maps of the IBDV capsid (large hexagon in each panel) and the small VP2 capsid (smaller hexagon at the bottom center of each panel), viewed along a twofold axis. The range of sections shown is from 34 (A) to 26 (I) nm for the IBDV capsid and from 13.5 (A) to 6.5 (H) nm for the small VP2 capsid, with a radial step of 1 nm between sections. The IBDV capsid extends to a 24-nm radius (not shown). The perpendicular distances of the faceted icosahedral sections from the center of the IBDV capsid are 34 (A), 33 (B), 32 (C), 31 (D), 30 (E), 29 (F), 28 (G), 27 (H), and 26 nm (I); from the center of the small VP2 capsid, these distances are 13.5 (A), 12.5 (B), 11.5 (C), 10.5 (D), 9.5 (E), 8.5 (F), 5.5 (G), and 6.5 (H) nm.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

General features of dsRNA viruses. Although dsRNA viruses are a rather diverse group, they share general architectural principles and numerous functional features (41). They have segmented genomes, and two or three concentric icosahedral shells usually form virion capsids (5). Whereas the outer layer is involved in protection, adhesion, and cell entry, the innermost layers are specialized compartments for transcription and replication of the dsRNA genome. A T=13 icosahedral shell composed of 260 trimeric clusters (or 200 trimers in incomplete T=13 shells) seems to be a common feature of dsRNA viruses. It is observed in BTV of the genus Orbivirus (32, 66), orthoreovirus (20, 55), rotavirus (65, 79), phytoreovirus (e.g., rice dwarf virus) (50), aquareovirus (62, 72), and bacteriophage 6, a member of the Cystoviridae family (10, 17). The other ubiquitous capsid structure observed is a "T=2" lattice, present in all viruses described above, as well as in dsRNA fungal viruses, such as L-A and P4 (12, 13), and insect cypoviruses such as cytoplasmic polyhedrosis virus (33, 80) (Table 1). L-A virus lacks an outer T=13 layer because its life cycle is entirely intracytoplasmic (78), and cytoplasmic polyhedrosis viruses are embedded within large crystalline inclusion bodies, proteinaceous polyhedra which act as transmission vehicles. IBDV is unique among dsRNA viruses in having a single capsid based on a T=13 layer and in lacking the supposed general replicative machine based on a T=2 layer, at least in the mature virions. Neither our studies nor previous structural analysis (8) has shown the presence of a T=2 layer. Biochemical and genetic analyses of infectious viral particles demonstrate that there is no protein candidate that could form a structure with 120 molecules arranged in a T=2 capsid, as observed in other dsRNA viruses (see, e.g., references 12, 30, 42, 56, and 68). However, we cannot discard the possibility that some of the major structural proteins are able to assemble into a 120-subunit capsid, as was shown with the capsid protein of brome mosaic virus, a plant virus which normally assembles into T=3 capsids (40).

Molecular anatomy of the IBDV capsid. The general architecture of IBDV strain Soroa, analyzed here, is essentially identical to that of the strain isolated from Russia. Our studies extend the analysis of the supramolecular organization of IBDV particles from that of Böttcher et al. (8), because we have included a comparison between IBDV capsids and small VP2 capsids, which are formed only by the VP2 major structural protein. These new results provide conclusive information on the specific structural features of most of the viral proteins and on the quaternary organization of the major structural proteins, VP2 and VP3. Figure 9 is a schematic diagram showing the supramolecular organization of the T=13 layer of IBDV. 9. All details in this discussion are represented in that model.

View larger version (77K): [in this window] [in a new window]   FIG. 9.   Schematic diagram showing subunit interactions in the T=13 layer of IBDV. A complete icosahedral face is shown. VP2 trimers (orange) are superimposed on VP3 trimers (blue), and a simplified version of their shapes is given for clarity. The five classes of trimeric VP2 units are represented by letters a to e. Thin and thick connecting arms between VP2 trimers, as observed on the surfaces of IBDV capsids, are shown in red. Annuli around the fivefold positions (green and violet) are unassigned features (see Discussion for details). Two-, three-, and fivefold axes are indicated by conventional symbols. (Top left) Schematic diagram showing arrangement of VP2 subunits in the trimeric protrusions of the T=1 surface lattice.

Large VP2 capsids. Overexpression of VP2 leads to production of large structures built up by 12 dodecahedra arranged in a quasi-icosahedral supercapsid. This unique arrangement probably reflects a natural tendency of VP2 trimers to interact, a feature that can eventually lead to the crystalline arrangements of viral particles found inside IBDV-infected cells. As far as we know, there are no other examples of high-order assembly of VLPs following this geometry, and studies of their possible uses for vaccination or content delivery are under way.

Tubular structures of VPX and functional implications. Notably, many structural proteins of dsRNA viruses that assemble as 260 trimers with a complete T=13l (levo) icosahedral lattice also form planar and tubular hexagonal arrangements: VP7 of African horsesickness virus, which is structurally similar to BTV VP7 (9); P8 of the phytoreovirus rice dwarf virus (81); and VP6, the protein making the T=13l lattice of double-layer particles of rotavirus (34, 46, 63). VPX/VP2 also has a natural propensity to form highly ordered hexagonal tubes (51).

Molecular switching mechanism. Each virus displays a switching mechanism for altering subunit interfaces and/or conformations required for the assembly of quasi-equivalent capsids (36). The major differences between IBDV VP2 trimers are clearly reflected at the top domain, where arch-like structures of variable thickness are observed, regardless of the contour display level. These differences are observed in our 28-Å resolution map as well as in the CTF-corrected IBDV structure published previously (8). Interestingly, these upper connections are not observed in any other T=13 capsid of dsRNA viruses, probably indicating that the quasi-equivalence principle is loosely followed by the IBDV capsid. Therefore, VP2 must undergo significant conformational changes upon adopting the quasi-equivalent locations on the T=13 lattice, illustrating a remarkable level of nonequivalence. This is probably the reason why VP2 trimeric capsomers in the IBDV capsid are not as well defined as in the VP2 capsids. Domains B and C, forming the base of VP2 trimers, must also undergo specific conformational changes. Thus, for example, VP3 is not found, at least as a trimeric structure, in the base of pentameric VP2 trimers.

Control of assembly pathway. The in vivo assembly pathway of IBDV has not been rigorously determined. The strong structural similarities between pentamers of the virion and small VP2 capsids suggest that their assembly may share intermediates. Both capsids may initiate assembly with trimers of VP2 that would form pentamers upon nucleation of additional equivalent (T=1 capsids) or nonequivalent (T=13 capsids) trimers. The formation of pentamers, as well as interpentameric interactions, is independent of the presence of VP3. In contrast, interhexameric interactions give rise to more-labile structures and require VP3 to maintain their integrity (see above).

Small VP2 capsid as a vaccine. VP2 contains the antigenic region responsible for induction of neutralizing antibodies (2, 6). The self-assembled small VP2 capsids show a topography similar to that of infectious virions, as both expose the upper domain of VP2 in the protruding trimeric units. Therefore, small VP2 particles should mimic conformational epitopes of intact IBDV virions, and their immunogenicity may be similar to that of infectious virions. This small VP2 capsid might be considered as a candidate for serological tests instead of whole virions, and it also provides a starting point in the design of alternatives to live IBDV vaccines for prevention of infectious bursal disease.

Conclusions. Although the similarities between dsRNA viruses at structural and functional levels are well established, there must be profound differences during the life cycle of IBDV, particularly in viral assembly and replication mechanisms. The C terminus of the IBDV VPX region plays a critical role in viral assembly. Its hydrophobic character is almost certainly required for the molecular switching mechanism. The plasticity of VP2, in part due to putative progressive proteolytic processing of its own C-terminal portion, is revealed as an important factor. Our results show a polymorphism in the assembly of a single capsid protein that allows in vivo assembly of 60 VP2 subunits in equivalent environments or of 780 VP2 subunits in five nonequivalent environments. However, VP3 would act to restrict the flexibility of VP2 and is an essential structural component for the proper assembly of VP2 into a T=13 capsid.