Previous Article | Next Article 
Journal of Virology, November 2001, p. 10766-10778, Vol. 75, No. 22
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.22.10766-10778.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
CD4-Independent Use of Rhesus CCR5 by Human Immunodeficiency
Virus Type 2 Implicates an Electrostatic Interaction between the CCR5 N
Terminus and the gp120 C4 Domain
George
Lin,1
Benhur
Lee,2
Beth S.
Haggarty,1
Robert W.
Doms,3 and
James A.
Hoxie1,*
Department of Medicine, Hematology-Oncology
Division,1 and Department of
Microbiology,3 University of Pennsylvania,
Philadelphia, Pennsylvania 19104, and Department of
Microbiology, Immunology, and Molecular Genetics, UCLA AIDS
Institute, University of California-Los Angeles, Los Angeles,
California 900952
Received 16 May 2001/Accepted 31 July 2001
 |
ABSTRACT |
Envelope glycoproteins (Envs) of human immunodeficiency virus type
2 (HIV-2) are frequently able to use chemokine receptors, CXCR4 or
CCR5, in the absence of CD4. However, while these Envs are commonly
dual-tropic, no isolate has been described to date that is CD4
independent on both CXCR4 and CCR5. In this report we show that a
variant of HIV-2/NIHz, termed HIV-2/vcp, previously shown to utilize
CXCR4 without CD4, is also CD4 independent on rhesus (rh) CCR5, but
requires CD4 to fuse with human (hu) CCR5. The critical determinant for
this effect was an acidic amino acid at position 13 in the CCR5 N
terminus, which is an asparagine in huCCR5 and an aspartic acid in
rhCCR5. Transferring the huCCR5 N terminus with an N13D substitution to
CCR2b or CXCR2 was sufficient to render these heterologous chemokine
receptors permissive for CD4-independent fusion. Chimeric Envs between
HIV-2/vcp and a CD4-dependent clone of HIV-2/NIHz as well as
site-directed Env mutations implicated a positively charged amino acid
(lysine or arginine) at position 427 in the C4 region of the HIV-2/vcp
env gene product (VCP) gp120 as a key determinant
for this phenotype. Because CD4-independent use of CCR5 mapped to a
negatively charged amino acid in the CCR5 N terminus and a positively
charged amino acid in the gp120 C4 domain, an electrostatic interaction
between these residues or domains is likely. Although not required for CD4-dependent fusion, this interaction may serve to increase the binding affinity of Env and CCR5 and/or to facilitate subsequent conformational changes that are required for fusion. Because the structural requirements for chemokine receptor use by HIV are likely to
be more stringent in the absence of CD4, CD4-independent viruses should
be particularly useful in dissecting molecular events that are critical
for viral entry.
 |
INTRODUCTION |
Human (HIV) and simian (SIV)
immunodeficiency viruses enter cells by fusing with the cellular
membrane in a reaction triggered by an interaction between the viral
envelope glycoprotein (Env) and two cellular molecules, CD4 and a
chemokine receptor, generally either CCR5 or CXCR4 (1, 11, 14,
18, 19, 28). All HIVs described to date have been shown to
utilize CCR5, CXCR4, or both for entry. Although additional members of
the chemokine receptor family and several other seven transmembrane
domain receptors can serve as coreceptors for HIV and SIV in vitro,
their importance in vivo is currently unclear (3, 32).
The HIV Env is composed of gp120 and gp41 subunits that are
noncovalently associated on virions in trimeric complexes (8, 69). Binding of CD4 to gp120 causes a conformational change that
exposes and/or induces the formation of a highly conserved domain in
gp120 that is important for binding to CCR5 (50, 58). This
region, termed the bridging sheet, consists largely of a four-stranded,
antiparallel
-sheet formed by the V1/V2 stem and components of the
fourth conserved region (C4) of gp120 (42, 58).
Conservation of this region among different HIV-1 isolates and, to some
extent, HIV-2 suggests that it may also be important for
interactions with CXCR4 and thus represents a generic chemokine receptor binding site. Exposure of the bridging sheet as a consequence of CD4 binding is thought to involve movement of the V1/V2 and V3
hypervariable loops (49, 68, 72, 73) that flank this domain (42, 58) and determine specificity for which
chemokine receptor is utilized (10-12, 34, 66).
Subsequent binding of gp120 to the chemokine receptor leads to final
conformational changes in gp41 that ultimately result in fusion between
the viral and cellular membranes (8, 15, 69).
Several laboratory-adapted HIV-1 isolates as well as many primary HIV-2
and SIV strains are able to bypass the requirement for CD4 (20,
23, 25, 33, 39, 43, 54, 55). Env proteins from these
CD4-independent isolates have been shown to interact directly with
chemokine receptors, indicating that their chemokine receptor binding
site is formed and exposed without the need for CD4 triggering
(21, 31, 33, 39, 46). These findings and the fact that
some feline immunodeficiency virus strains also use CXCR4 as a sole
receptor (71) suggest that chemokine receptors are the
primordial receptors for lentiviruses and that primate lentiviruses
subsequently evolved to bind to CD4 as well (23, 25, 39).
Interestingly, CD4-independent R5- and X4-tropic isolates exhibit
enhanced susceptibility to antibody-mediated neutralization by
anti-gp120 monoclonal antibodies as well as sera from HIV-1-infected
patients, suggesting that these variants are strongly selected against
in vivo (24, 33, 38).
Despite the many CD4-independent isolates identified thus far, none
have been able to utilize both CXCR4 and CCR5 independently of CD4. One
CD4-independent, X4-tropic variant of HIV-1, termed 8x, could fuse
using CCR5 in the absence of CD4 when it contained the V3 loop of an
R5-tropic virus, suggesting exposure of a region that could interact
with both CXCR4 and CCR5 (33, 43). However, this Env lost
the ability to fuse with CXCR4-expressing cells (33, 43),
suggesting additional structural constraints on chemokine receptor
usage. Moreover, in an analysis of primary HIV-2 isolates, which are
characteristically dualtropic for CXCR4 and CCR5 in the presence of
CD4, CD4 independence was observed for one but not both of these
receptors (54). It has been proposed that structural
differences between CXCR4 and CCR5 could preclude their ability to
function independently of CD4 for a single Env protein and that CD4
binding may allow greater tolerance for variations in Env-chemokine
receptor interactions (54).
In this study, we demonstrate that an HIV-2 Env, termed HIV-2/vcp, that
was previously shown to be CD4 independent on CXCR4 (25),
could also utilize rhesus (rh) CCR5 in the absence of CD4, while it
required CD4 to fuse with human (hu) CCR5. Determinants on both CCR5
and gp120 that were responsible for CD4-independent use of rhCCR5 were
identified. We found that a negatively charged amino acid at position
13 in the rhCCR5 N terminus and a positively charged amino acid at
position 427 in the C4 domain of gp120 were required for
CD4-independent fusion on CCR5. This finding suggests that an
electrostatic interaction between these residues or domains occurs and
likely modulates the binding affinity and/or subsequent conformational changes that are required for fusion.
 |
MATERIALS AND METHODS |
Plasmids and plasmid construction.
The env genes
from HIV-2/ROD/A and HIV-2/ROD/B were cloned identically into a
modified pCR3.1 vector from full-length infectious proviral molecular
clones pACR23 and ROD/B.14 (55; G. Lin and J. A. Hoxie,
submitted for publication). The HIV-2/vcp env gene (designated VCP) was recloned from the original pCR3.1 expression vector (25) to generate an env clone with the
5' untranslated region from ROD/A, producing an expression vector
identical to the ROD/A and ROD/B env clones except for the
open reading frame (Lin and Hoxie, submitted). An env clone
designated NIHzc8 was generated by Josephine Romano (University of
Pennsylvania, Philadelphia) from a viral swarm of HIV-2/NIHz-infected
CEM cells, provided by Celia C. LaBranche (Duke University, Durham,
N.C.) in a manner similar to that described for the original VCP
env clone (25). This clone was subsequently
recloned into the HIV2-/vcp env clone equalized to ROD/A
with BsmI 5' and BamHI 3', in essence exchanging the open reading frames.
Chimeras were generated between VCP and NIHzc8 with restriction enzymes
HindIII in the vector and combinations of
BstXI, PstI, and MaeI to generate
exchanges between the V1/V2, V3, and V4/C4 regions, respectively. The
QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, Calif.)
was used to generate point mutations in VCP and NIHzc8 env
clones. The HIV-2/vcp env clone with a deleted V1/V2
hypervariable loop (residues 110 to 194 deleted and replaced with a
glycine-alanine-glycine motif) was constructed with QuikChange with the
following pair of complementary primers: 5'CAAATTAACACCCTTATGTGTAGGTGCCGGCCATTGCAATACATCAGTC3' and
5'GACTGATGTATTGCAATGGCCGGCACCTACACATAAGGGTGTTAATTTG3'.
Human and rhesus CCR5 with the corresponding position 13 change
(huCCR5/N13D and rhCCR5/D13N) have been described (
21).
QuikChange was used to generate human and rhesus CCR5 with either
a
glutamic acid or an alanine at position 13. Constructs for huCCR2b
and
chimeras between huCCR5 and huCCR2b have been described
(
62).
The ones used in this study were C25-01, C25-06, and
C25-28. Constructs
for huCXCR2 and chimeras between huCCR5 and huCXCR2
have been
described (
17). QuikChange was also used to
introduce an aspartic
acid at position 13 for chimeras containing the
huCCR5 N
terminus.
Rhesus CD4, CXCR4, and CCR5 in pcDNA3 were provided by Bridget A. Puffer (University of Pennsylvania). Human CD4, CXCR4, and
CCR5 in
pcDNA3 and the reporter plasmid encoding luciferase under
the control
of a T7 promoter (T7.luciferase), used in a cell-cell
fusion assay,
have been described previously (
22,
33,
43,
61).
Cell-cell fusion assay.
A cell-cell fusion assay (22,
61) was modified as described (Lin and Hoxie, submitted for
publication). Briefly, to generate effector env-expressing
cells, QT6 quail fibrosarcoma cells in T-25 flasks were infected with
vaccinia virus strain WR at a multiplicity of infection of 10 for
1 h at 37°C and transfected for 4 h by the standard calcium
phosphate method with 6 µg of the desired env-expressing
plasmid and 6 µg of pSP64.vE/L.T7 RNAP (Lin and Hoxie, submitted), a
plasmid containing T7 RNA polymerase under the regulation of the
synthetic vaccinia virus early and late promoter (6).
Cells were incubated overnight with rifampin at a concentration of 100 µg/ml. To generate target receptor cells, QT6 quail cells in 24-well
plates were transfected with the desired receptors and the
T7.luciferase reporter plasmid in a total of 1 µg by the standard
calcium phosphate method for 4 h and expressed overnight. Effector
cells were mixed with receptor target cells and cell-cell fusion was
assessed 7.5 h later by lysing with 0.5% NP-40-phosphate-buffered
saline (PBS). After addition of luciferase substrate (Promega, Madison,
Wis.), luciferase activity was quantified with a Wallac 1450 Microbeta
Plus luminometer.
Analysis of CCR5 expression and tyrosine sulfation levels.
QT6 quail cells were transfected with huCCR5 and huCCR5 mutants by the
standard calcium phosphate method. After overnight expression, cells
were detached with ice-cold 1 mM EDTA-PBS and analyzed by
fluorescence-activated cell sorting (FACS) (43) using a
monoclonal antibody to CCR5 (2D7) directly conjugated to phycoerythrin
(BD PharMingen, San Diego, Calif.). Cells were also labeled in six-well
plates for 4 h with either 500 µCi total of
[35S]cysteine and [35S]methionine or 500 µCi of [35S]sulfate (NEN Life Science Products, Boston,
Mass.) and analyzed for CCR5 tyrosine sulfation as described
(48). After radiolabeling, cells were lysed in Cymal-5
(Anatrace, Maumee, Ohio) lysis buffer containing 1% detergent, 100 mM
(NH4)2SO4, 20 mM Tris-HCl (pH 7.5),
10% glycerol, and Complete protease inhibitor cocktail (Roche Molecular Biochemicals, Indianapolis, Ind.) and immunoprecipitated with
2D7 and protein A/G beads overnight. Beads were pelleted and
washed with Cymal-5 lysis buffer supplemented with 500 mM NaCl. Sodium
dodecyl sulfate (SDS) sample buffer was added to the beads and heated
at 55°C for 1 h, and samples analyzed by SDS-polyacrylamide gel
electrophoresis (PAGE). Radioactivity corresponding to either
[35S]cysteine- and [35S]methionine- or
[35S]sulfate-labeled CCR5 was quantified on a PhosphorImager.
 |
RESULTS |
HIV-2 exhibits CD4-independent use of rhCCR5 but not huCCR5.
HIV-2/vcp has been shown to utilize human CXCR4 in the absence of CD4
(25). Although HIV-2 isolates are commonly dual-tropic for
CXCR4 and CCR5 and are frequently CD4 independent for one of these
coreceptors, no HIV-2 Envs described to date have been able to use both
CXCR4 and CCR5 in the absence of CD4 (54). Coreceptor
usage of VCP was further evaluated on human and rhesus CXCR4 and CCR5
in the presence and absence of CD4. We found that this Env was able to
use both human and rhesus CXCR4 independently of CD4. Remarkably, it
was also able to use rhCCR5 but not huCCR5 in the absence of CD4,
although it could use both receptors when CD4 was present (Fig. 1A and
1B). We also evaluated HIV-2/ROD/A Env,
which is CD4 dependent on CXCR4, and HIV-2/ROD/B Env, which was derived
from ROD/A and is CD4 independent on CXCR4 (55). Although
ROD/A and ROD/B utilized huCCR5 and rhCCR5 in the presence of CD4,
neither clone could use these receptors in the absence of CD4 (Fig. 1A
and 1B). Both VCP and particularly ROD/B were able to fuse when the QT6
quail target cells expressed CD4 alone, raising the possibility of an
endogenous CD4-dependent coreceptor on this nonmammalian cell type.
Nonetheless, these findings indicated that the HIV-2/vcp Env must
contain determinants that enable it to use both CXCR4 and rhCCR5
without CD4 and that rhCCR5 must differ from huCCR5 in a way that
supports CD4-independent fusion.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 1.
Evaluation of HIV-2 Env proteins with human and rhesus
receptors. HIV-2 env clones VCP, ROD/A, and ROD/B were
evaluated in a cell-cell fusion assay on QT6 target cells expressing
(A) human or (B) rhesus receptors CXCR4 and CCR5 in the presence or
absence of human or rhesus CD4. Values are represented as percent
fusion, calculated using luciferase activity normalized to ROD/A fusion
on CXCR4 with CD4. Mean values + standard error of the mean (SEM)
are represented.
|
|
Role of CCR5 amino terminus in CD4-independent fusion.
Previous reports have shown differential use of human and rhesus CCR5
by SIV Envs. SIVmac239 gp120 binds to rhCCR5 independently of CD4 but
requires soluble CD4 to bind to huCCR5 (46). SIVmac/CP-MAC can use rhCCR5 for infection in the absence of CD4 but requires CD4 to
use huCCR5 (21). Both studies mapped the determinant for
CD4 independence to residue 13 in the CCR5 N terminus, which is an
asparagine (N) for huCCR5 and an aspartic acid (D) for rhCCR5. Thus,
changing position 13 in huCCR5 to a D (huCCR5/N13D) conferred CD4
independence, while changing position 13 in rhCCR5 to an N (rhCCR5/D13N) abrogated CD4 independence (21, 46).
To determine if this amino acid had a similar effect for HIV-2/vcp,
huCCR5/N13D and rhCCR5/D13N were evaluated in fusion assays
with and
without CD4 (Fig.
2A). In the presence of
human or rhesus
CD4, VCP could fuse with both hu- and rhCCR5, although
fusion
was typically greater when rhCD4 was used with rhCCR5. Although
fusion with huCCR5 was CD4 dependent, it became CD4 independent
with
the N13D substitution. CD4-independent use of rhCCR5 was
abrogated when
it contained the D13N substitution, although this
receptor remained
functional in the presence of CD4. Thus, a D
at position 13 was
critical for CD4-independent fusion on CCR5
by VCP.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 2.
Human and rhesus CCR5 N-terminal mutations at position
13. (A) HIV-2/vcp was evaluated in cell-cell fusion on QT6 target cells
expressing huCCR5, rhCCR5, or CCR5 mutants containing either an
aspartic acid (D) or an asparagine (N) at position 13, as indicated.
The ability of these CCR5 N-terminal mutants to support membrane fusion
by VCP Env was assessed in the presence or absence of both human and
rhesus CD4. Results are expressed as luciferase activity in relative
light units (RLU). (B) VCP Env fusion was also assessed with CCR5
mutants containing either a glutamic acid (E) or an alanine (A) at
position 13, as indicated. Values are represented as percent fusion,
calculated using RLU normalized to VCP fusion on huCCR5 with huCD4.
Mean values + SEM are represented.
|
|
To determine if CD4-independent use of rhCCR5 was due to the presence
of the aspartic acid, the mere presence of a negative
charge, or the
specific loss of an asparagine, hu- and rhCCR5
mutants that contained
either a glutamic acid (E) or an alanine
(A) at position 13 were
created. FACS analysis using a monoclonal
antibody (2D7) that binds to
a determinant in the second extracellular
loop of CCR5 (
44,
63) demonstrated that all huCCR5 mutants
were expressed at
levels comparable to wild-type huCCR5 (Fig.
3). Although the HIV-2/vcp Env was able
to fuse with each construct
in the presence of CD4, it was only CD4
independent on CCR5 molecules
that contained a D or an E, but not an N
or an A (Fig.
2B). Therefore,
the ability of rhCCR5 to support
CD4-independent fusion by HIV-2/vcp
was due to the presence of a
negative charge in the N terminus
at position 13.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 3.
Cell surface expression of CCR5 mutants. QT6 quail cells
were transiently transfected with huCCR5 or huCCR5 mutants by the
standard calcium phosphate method, and after overnight expression,
cells were detached with ice-cold 1 mM EDTA-PBS and analyzed by FACS
using a monoclonal antibody to CCR5 (2D7) directly conjugated to
phycoerythrin. Histograms are labeled with mean channel fluorescence
(MCF). Cells expressing CCR5 are shown with a bold line, while cells
transfected with vector alone are shown with a thin line.
|
|
CCR5 N terminus can confer CD4-independent fusion on CCR5 by
HIV-2/vcp to heterologous chemokine receptors.
Interactions of HIV
with CCR5 are conformationally complex, involving to at least some
degree all extracellular domains of this coreceptor. However, the
N-terminal domain of CCR5 and the second extracellular loop are
particularly important regions for Env interactions (4).
In addition to being CD4 dependent on huCCR5, VCP also exhibited
CD4-dependent fusion with cells expressing huCCR2b or huCXCR2 (Fig.
4A, data not shown), which are 76 and 34% homologous to huCCR5, respectively (17, 62). To
determine if the N terminus of CCR5 with a negative charge at position
13 could confer CD4 independence on other receptors, we analyzed usage
of CCR2b and CXCR2 chimeras containing the N terminus of CCR5 or other
domains of CCR5. These receptor chimeras were previously shown to be
functional for other CCR5-tropic HIV-1 Envs (17).

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 4.
Role of CCR5 N terminus in CD4-independent use of CCR2b
and CXCR2. HIV-2/vcp was evaluated in cell-cell fusion on QT6 target
cells expressing (A) human CCR2b/CCR5 chimeras with the entire N
terminus as well as the first transmembrane domain exchanged, or (B)
human CCR2b/CCR5 and CXCR2/CCR5 chimeras containing a minimal
N-terminal exchange made at the conserved cysteine at position 20. Nomenclature shows the first number representing the N terminus and the
second, third, and fourth numbers representing the second, third, and
fourth extracellulat loops, respectively. 5 refers to CCR5, 2 refers to
CCR2b, and B refers to CXCR2. An asterisk (5*222) indicates that this
construct differs from 5222 in that the N-terminal exchange was made at
cysteine 20. CCR5 N-terminal chimeras denoted N13D contained an
aspartic acid at residue 13. Values are represented as percent fusion,
calculated using luciferase activity normalized to VCP fusion on huCCR5
with huCD4. Mean values + SEM are represented.
|
|
CCR2b chimeras that contained either the entire N-terminal domain of
CCR5 or only the first 20 residues supported CD4-dependent
fusion with
VCP (Fig.
4A and
4B). However, these chimeras supported
CD4-independent
fusion when residue 13 was changed to an aspartic
acid (Fig.
4A and
4B). The same observation was made with the
more heterologous
CXCR2/CCR5 N-terminal chimeras (Fig.
4B). Notably,
the second
extracellular loop of CCR5 was not critical for CD4
independence, since
on the CCR5/CCR2b chimeras, VCP used 5222/N13D
without CD4 just as well
as it used 5252/N13D (Fig.
4A). Therefore,
the N-terminal domain of
huCCR5 containing a negatively charged
residue at position 13 was
sufficient to confer CD4-independent
fusion by HIV-2/vcp onto
heterologous chemokine
receptors.
Tyrosine sulfation levels of CCR5 mutants.
Tyrosines in the N
terminus of CCR5 at positions 3, 10, 14, and 15 are sulfated and play
an important role in gp120 binding and efficient HIV entry (13,
26, 27). Because acidic residues surrounding tyrosines serve as
tyrosine sulfation signals, especially acidic residues at the
1
position from a tyrosine (5, 36, 45, 60), we considered
the possibility that a D or an E at position 13 could improve the
efficiency of CCR5 utilization and permit CD4 independence by
increasing the level of tyrosine sulfation. Therefore, we examined the
relative levels of tyrosine sulfation between huCCR5 and huCCR5
containing a D or an E at position 13 by radiolabeling with either
[35S]sulfate or [35S]cysteine and
[35S]methionine as previously described
(48). By using [35S]cysteine and
[35S]methionine incorporation as a means to normalize for
CCR5 expression, we were able to determine the relative levels of
sulfation. We found that [35S]sulfate incorporation into
huCCR5/N13D and huCCR5/N13E relative to wild-type CCR5 was 115 and
82%, respectively (Fig. 5), indicating that differences in tyrosine sulfation could not account for the CD4-independent fusion. Thus, a negatively charged amino acid at
position 13 may be more directly involved in CD4-independent use of
rhCCR5.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 5.
Tyrosine sulfation levels of CCR5 mutants. QT6 quail
cells were transiently transfected with huCCR5 or huCCR5 mutants by the
standard calcium phosphate method, radiolabeled with
[35S]cysteine and [35S]methionine or
[35S]sulfate, lysed, immunoprecipitated with 2D7, and
analyzed by SDS-PAGE as described in the text. Radioactivity
corresponding to either [35S]cysteine- and
[35S]methionine- or [35S]sulfate-labeled
CCR5 was quantified on a PhosphorImager. Background radioactive counts
from pcDNA3 control-transfected cells were subtracted, and results are
expressed as the relative number of cpm normalized to huCCR5.
huCCR5/N13D and N13E ratios for [35S]sulfate to
[35S]cysteine and [35S]methionine labeling
were 115 and 82%, respectively.
|
|
Derivation and sequence analysis of a CD4-dependent clone from
HIV-2/NIHz compared to HIV-2/vcp.
To identify regions within the
HIV-2/vcp Env that determined its CD4 independence on CCR5, we derived
an env clone from an early passage of the parental
HIV-2/NIHz isolate. This clone, designated NIHzc8, utilized both CCR5
and CXCR4 in fusion assays, but only when CD4 was present (see Fig. 7;
data not shown). The sequences of the NIHzc8 and VCP Env clones are
shown and compared to the published sequence of NIHz (Fig.
6) (75). VCP differed from
NIHzc8 by 11 amino acids in gp120 and 9 amino acids in the gp41 ecto-
and membrane-spanning domains. Both NIHzc8 and NIHz contain an unpaired
cysteine in the V1/V2 domain, which in HIV-2 and SIV contains four
additional cysteines compared to HIV-1 (35). NIHzc8 also
acquired a cysteine at position 632 in the gp41 ectodomain. In
addition, relative to NIHz, NIHzc8 and VCP contained mutations that
resulted in the loss of a predicted N-linked glycosylation site at
position 401 and 458, respectively. NIHzc8 also has a frameshift
mutation in the TM cytoplasmic domain at position 696 that results in
an aberrant and prematurely truncated tail of 34 amino acids. Similar
to many laboratory-adapted HIV-2 and SIV isolates (37,
41), VCP contained a premature stop codon in its cytoplasmic
tail.

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 6.
Sequence analysis of HIV-2 env clones NIHzc8
and VCP in comparison to NIHz. Sequences are shown for the HIV-2/vcp
env in comparison to HIV-2/NIHz (75) and an
env clone derived from HIV-2/NIHz-infected cells (NIHzc8).
NIHzc8 is CD4 dependent for rhesus and human CCR5 and CXCR4 (not
shown). Positions of variable loops, conserved domain 4, the gp120/gp41
cleavage site, and the TM membrane-spanning domain (msd) are
indicated. Predicted N-linked glycosylation sites are represented with
a shaded circle. NIHzc8 contains a frameshift mutation at position 696, resulting in a prematurely truncated cytoplasmic tail at position 745. The VCP cytoplasmic tail is also prematurely truncated at position 742. NIHzc8 and VCP have each lost a consensus N-linked glycosylation site
at positions 401 and 458, respectively. Restriction sites
(BstXI, PstI, and MaeI) used to
construct NIHzc8 and VCP Env chimeras are indicated with a vertical
arrow.
|
|
Mapping Env determinants for CD4 independence using Env
chimeras.
To identify the structural determinants in HIV-2/vcp Env
that enabled it to use rhCCR5 independently of CD4, chimeras were made
between VCP and the CD4-dependent NIHzc8 clone. Env chimeras were
constructed using available restriction sites to exchange the V1/V2,
the V3, and the V4/C4 loops in various combinations, as well as the
entire gp120 and gp41 subunits (Fig. 6,
7, and 8). Fusion assays were performed
on cells expressing huCCR5/N13D, since we hoped to identify
determinants on Env that would likely interact with residue 13 in the
CCR5 N terminus. All constructs were competent for fusion when CD4 was
present, although the levels of activity varied. The CD4-independent
activity of VCP clearly resided within gp120, since the NIHzc8 gp120
paired with VCP gp41 lost CD4 independence, while a chimera containing
VCP gp120 with the NIHzc8 gp41 was fully CD4 independent (Fig. 7).
Thus, the marked differences in the cytoplasmic domains of these
proteins had no obvious effect on the CD4-independent phenotype, nor
did other changes in the gp41 ectodomain.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 7.
Mapping determinants for CD4-independent use of CCR5
with progressive N- to C-terminal exchanges. HIV-2/vcp and HIV-2/NIHzc8
chimeras were constructed using the indicated restriction sites (see
also Fig. 6) and evaluated in cell-cell fusion on QT6 target cells
expressing huCCR5/N13D with and without rhesus CD4. Values are
represented as percent fusion, calculated using luciferase activity
normalized to NIHzc8 fusion on huCCR5/N13D with rhCD4. Mean values + SEM are represented.
|
|
Within gp120, the V4/C4 domain appeared to be particularly important,
since VCP chimeras containing the NIHzc8 V4/C4 domain
alone or in
combination with the V1/V2 or V3 domain became CD4
dependent on
huCCR5/N13D (Fig.
8). However, the VCP
V4/C4 domain
could not by itself confer CD4 independence on NIHzc8
(Fig.
8),
although introducing the VCP V4/C4 region onto an NIHzc8
background
in combination with either V1/V2 or V3 did confer CD4
independence
(Fig.
8). Therefore, the VCP V4/C4 domain was necessary
but not
sufficient to confer CD4 independence to NIHzc8.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 8.
Mapping determinants for CD4-independent use of CCR5
with exchanges of gp120 subdomains. HIV-2/vcp and HIV-2/NIHzc8 chimeras
were constructed using the indicated restriction sites and evaluated in
cell-cell fusion on QT6 target cells expressing huCCR5/N13D with and
without rhesus CD4. Values are represented as percent fusion,
calculated using luciferase activity normalized to NIHzc8 fusion on
huCCR5/N13D with rhCD4. Mean values + SEM are represented.
|
|
In analyzing sequence differences between NIHzc8 and VCP, the loss of a
cysteine in the NIHzc8 V1/V2 loop was intriguing because
unpaired
cysteine residues in the ectodomains of HIV and SIV glycoproteins
are
uncommon. Although not sufficient to confer CD4 independence
on NIHzc8,
the VCP V1/V2 clearly contributed since this domain,
as noted above, in
conjunction with V4/C4 rendered NIHzc8 fully
CD4 independent (Fig.
8).
We therefore considered the possibility
that the absence of C144 in
NIHzc8 disrupted the V1/V2 domain
and adversely affected Env function.
When we restored a cysteine
at position 144 in the NIHzc8 chimera
containing the VCP V4/C4
region, we found that the resulting construct
was fully CD4 independent
(Fig.
9,
compare numbers 4, 5, and 6). These findings indicated
that differences
between the NIHzc8 and VCP V4/C4 domains are
important for
CD4-independent use of CCR5.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 9.
Fine mapping of determinants of CD4 independence. Point
mutations were introduced into HIV-2/vcp and HIV-2/NIHzc8
env clones and chimeras as depicted at positions 144 and 427 through QuikChange site-directed mutagenesis and evaluated in cell-cell
fusion on QT6 target cells expressing huCCR5/N13D with and without
rhesus CD4. Constructs 4 and 5 contain the VCP V4/C4 domains
(PstI to MaeI fragment) on an NIHzc8 background.
An HIV-2/vcp env construct containing a deleted V1/V2
hypervariable loop that was replaced with a glycine-alanine-glycine
motif was also evaluated. Values are represented as percent fusion,
calculated using luciferase activity normalized to NIHzc8 fusion on
huCCR5/N13D with rhCD4. Mean values + SEM are represented.
|
|
Identification of lysine 427 within V4/C4 domain as a determinant
for CD4-independent use of CCR5.
VCP differed from NIHzc8 at four
positions in the V4/C4 domain (403, 427, 453, and 458)
(Fig. 6). Among these changes, we were particularly interested in the
difference at position 427, since that resulted in a change to a
positively charged lysine in VCP from the negatively charged glutamic
acid in NIHzc8 (Fig. 6). Given the importance of a negatively charged
residue at position 13 in the CCR5 N terminus for CD4-independent
fusion, we hypothesized that a gain in positive charges would
facilitate VCP CD4 independence. Indeed, by changing residue 427 to a
lysine in the NIHzc8/R144C background, CD4 independence was conferred
(Fig. 9, compare numbers 6 and 7). Moreover, CD4 independence was also
conferred if position 427 was changed to a different positively charged
residue (arginine), but was lost if an alanine was substituted (Fig. 9,
numbers 8 and 9). Conversely, when position 427 in VCP was changed to a glutamic acid, a considerable degree of CD4 independence was lost (Fig.
9, number 2). Despite its role in CD4 independence, VCP residue C144
was not believed to contribute to the interaction with residue 13 in
the CCR5 N terminus because VCP Env with the entire V1/V2 hypervariable
loop deleted retained some degree of CD4 independence (Fig. 9, number
10). Therefore, similar to the analysis of the CCR5 receptor, what was
critical for CD4 independence on Env was the presence of a positively
charged residue at position 427 in the C4 region and not a specific
basic residue.
 |
DISCUSSION |
The fusion activity of HIV and SIV Envs is typically triggered by
sequential interactions with CD4 and a coreceptor. For primary HIV-1
strains, CD4 binding induces structural alterations in gp120 that
enable it to interact with CCR5 and/or CXCR4 (67, 72). While coreceptor binding is needed for membrane fusion, it is not clear
exactly how coreceptors bind to Env, nor are the structural consequences of this interaction well understood. CD4-independent virus
strains provide a means to dissect the roles played by CD4 and
coreceptor binding in the virus entry process, since coreceptor binding
alone is sufficient to elicit membrane fusion for these viruses
(20, 23, 25, 33, 39, 43, 54, 55).
We have previously shown that HIV-2/vcp can efficiently use CXCR4
independently of CD4 (25). In the present study we found that VCP could also use rhesus but not human CCR5 independently of CD4.
Of the four extracellular differences between huCCR5 and rhCCR5
(9), the critical determinant for CD4-independent use of
rhCCR5 by VCP mapped solely to residue 13 in the CCR5 N terminus. Specifically, an acidic amino acid at this position enabled either huCCR5 or rhCCR5 to support CD4-independent fusion. Potential indirect
effects of a negatively charged residue at position 13, such as an
increase in coreceptor expression or tyrosine sulfation of the CCR5 N
terminus, which would have confounded our interpretation, were ruled
out. Previous studies have shown that SIVmac239 gp120 binding to rhCCR5
and CD4-independent SIVmac/CP-MAC infection are likewise dependent on
an acidic residue at position 13 in the CCR5 N terminus (21,
46). Moreover, the N-terminal domain of huCCR5 with a negatively
charged residue at position 13 was sufficient to confer CD4-independent
use by VCP on CCR2b and CXCR2, underscoring the importance of the CCR5
N terminus for Env binding and efficient coreceptor use. Consistent
with this view, CCR5 N-terminal peptides containing sulfated tyrosines
at position 10 and 14 have been shown to bind gp120-CD4 complexes from
HIV-1 CCR5-tropic isolates and to inhibit virus entry, suggesting that this domain by itself adopts a conformation that binds directly to
gp120 (13, 27).
By using chimeras between VCP and a closely related CD4-dependent Env,
we identified a critical determinant on Env for CD4-independent use of
CCR5 as a positively charged residue in the C4 domain of gp120 at
position 427. By homology analysis, VCP residue 427 corresponds to
HIV-1 HXBc2 residue 432, which lies in the highly conserved four-stranded, antiparallel
-sheet implicated in forming the CCR5
binding site (Fig. 10) (42,
57). The requirement for a positively charged residue at this
position in gp120 coupled with the need for a negatively charged
residue at position 13 in CCR5 suggests that an electrostatic
interaction between these residues is important for the CD4-independent
phenotype. A number of other basic residues are located in the CCR5
binding site, including several that have been shown to be important
for CCR5 binding (Fig. 10) (57). These basic residues
could potentially interact with negatively charged residues in the CCR5
N terminus, including the sulfated tyrosines. However, our results with
VCP are clearly context dependent, since there are other R5-tropic,
CD4-independent isolates that can use human CCR5, which lacks the
aspartic acid at position 13 (21, 23, 33, 39, 58). In
addition, the V3 loop of Env is also implicated in interacting with the
CCR5 N terminus and plays a critical role in coreceptor choice
(10-12, 27, 66). Finally, the CCR5 extracellular loops
also play a role in HIV entry (17, 62), although it is not
clear how they interact with Env.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 10.
Positively charged residues in the putative CCR5
binding site on gp120. A space-filling model (A) and a ribbon diagram
(B) of the HIV-1 gp120 core crystal structure (white) is depicted
complexed with a ribbon diagram of CD4 (yellow) (42).
HIV-1 amino acid 432, which corresponds to residue 427 of NIHzc8 (Glu),
is shown in red. Amino acid positions at which mutations produced a
50% decrease in HIV-1/YU2 gp120 binding to CCR5 are shown in cyan.
Positively charged residues included within this region (K121, K207,
R419, K421, and R440) are shown in blue (58). Positions of
the V1/V2 stem and the base of the V3 loop are shown in orange. As
shown in Fig. 9, E427K and E427R mutations in NIHzc8 enabled this clone
to use huCCR5/N13D independently of CD4.
|
|
How does a single amino acid change in gp120 result in a
CD4-independent phenotype? While it could be argued that the lysine at
position 427 is involved in exposing the coreceptor binding site on
gp120, a VCP Env containing a lysine to glutamic acid substitution at
position 427 remained highly CD4 independent on CXCR4 (data not shown).
Thus, we consider it less likely that a basic residue at this position
simply exposes the coreceptor binding site. However, it is possible
that the region in the bridging sheet responsible for CXCR4 binding is
at least somewhat different from the region implicated in CCR5 binding.
Thus, the acquisition of a positively charged amino acid at 427 could
result in enhanced exposure of that portion of the coreceptor binding
site needed to interact with CCR5.
It is also possible that the electrostatic interactions that we have
implicated enhance the affinity and/or avidity of Env-coreceptor binding. Recent work indicates that multiple coreceptor binding events
are needed for optimal fusion activity of Env trimers
(40). Thus, Envs that bind coreceptor with high affinity
will engage multiple coreceptors more quickly than Envs that bind with
low affinity, resulting in more efficient triggering. While our studies have not yet addressed the affinity of the VCP Env for CCR5, studies by
Cormier et al. (13) have shown that gp120 binding to
sulfated peptides from the CCR5 N terminus can be quantitated. It will be of great interest to determine if CD4-dependent and CD4-independent use of hu- and rhCCR5, respectively, corresponds to differences in
affinity of VCP gp120 binding to sulfated peptides from these receptors.
Finally, it is possible that an electrostatic interaction between
residue 427 in VCP gp120 and residue 13 in CCR5 allows more efficient
triggering of postbinding, fusion-inducing conformational changes in
Env. Thermodynamic analysis of the gp120-CD4 binding reaction indicates
that extensive structural rearrangements in gp120 occur upon CD4
binding that likely involve movements of the V1/V2 and V3 hypervariable
loops as well as formation of the bridging sheet, which connects the
inner and outer domains of gp120 (49, 50, 72, 73).
However, the exact structural consequences of coreceptor binding to Env
are unknown, and it is unclear how this interaction leads to
conformational changes in gp41 and formation of the six
-helical
bundle that ultimately drives membrane fusion (7, 47, 59, 64,
70). VCP Env can interact with huCCR5, since fusion occurs when
CD4 is present. CD4, in addition to Env binding, may serve to
facilitate the coreceptor-induced structural changes in Env that huCCR5
cannot induce alone. Without CD4, the more favorable electrostatic
interaction provided by a negatively charged residue at position 13 in
rhCCR5 may serve to transmit signals to gp41 that enable subsequent
conformational changes to occur.
It is likely that CD4 binding allows more genetic variation in the
Env-chemokine receptor interaction to be tolerated. In this context,
CD4 may serve not only to induce favorable conformational changes for
coreceptor binding, but could also contribute to the net avidity of Env
with a cellular CD4-chemokine receptor complex (74).
However, our demonstration that VCP can use both CXCR4 and CCR5
independently of CD4 indicates that these divergent coreceptors clearly
can adopt a conformation that permits a direct interaction with a
single gp120. Nonetheless, coreceptor binding may itself be a complex
and cooperative process involving several Env chemokine receptor
subdomains. While this study has implicated an interaction between the
CCR5 N terminus and the gp120 C4 domain, another study of an X4-tropic,
CD4-independent HIV-2 implicated an interaction with the CXCR4 second
extracellular loop (53). Studies to identify the
determinants and mechanisms for CD4-independent use of CXCR4 by
HIV-2/vcp may help to identify additional coreceptor domains that have
been optimized by this Env.
Given the relatively broad expression pattern of CXCR4 in human tissues
and the more restricted expression of CD4, CD4-independent viruses
would be expected to exhibit expanded tropism in vivo. However, primary
CD4-independent HIV-1 isolates have not yet been identified, perhaps
because of their markedly enhanced sensitivity to neutralizing
antibodies, resulting in selective immune pressure in vivo against
their emergence (24, 33, 38). A CD4-independent HIV-1
gp120 protein that we have described has been shown to have a stably
exposed coreceptor binding site, raising the possibility that such
genetically triggered Env proteins may also elicit antibodies against
this highly conserved region (31, 33). The feasibility of
targeting cryptic epitopes on Env or fusion intermediates is evidenced
by the ability of strategically deglycosylated Envs to generate
antibody responses with increased neutralizing activity (56) and the success of peptide-based pharmaceuticals in
preventing membrane fusion (7, 47, 59, 64, 70). Combining
immunologic and pharmacologic strategies that target concealed epitopes
and fusion intermediates may be highly synergistic in inhibiting HIV infection (16).
In summary, our findings have implicated an electrostatic interaction
between an HIV-2 gp120 and the CCR5 N terminus as playing a key role in
events that lead to viral entry. Although CD4 likely modulates the
exposure, affinity, and/or orientation of Env that enables it to engage
coreceptors, an accumulation of favorable charge-charge interactions
can apparently obviate the need for CD4, at least in the context of
cell-cell fusion used in our analysis. In addition, accessory molecules
such as the newly discovered C-type lectins DC-SIGN and DC-SIGNR, which
also bind HIV Env, are generating increased interest as factors that
can enhance HIV transmission to T cells via a trans
mechanism (2, 29, 30, 51, 52, 65). Whether these other
attachment mediators also induce structural changes in Env that bear on
interactions with CD4 and coreceptors or simply serve to bind virus
remains to be determined. The development of a molecular model that
takes into account all components of viral entry will lead to the more rational design of pharmacologic and immunologic inhibitors that target
Env domains critical to the viral entry process. CD4-independent isolates that interact with both CXCR4 and CCR5 may be particularly useful in this regard.
 |
ACKNOWLEDGMENTS |
We thank Bridget A. Puffer, Jacqueline D. Reeves, and Josephine
Romano for plasmids; George J. Leslie for technical assistance; Michael
Farzan for technical advice; and Celia C. LaBranche for providing the
HIV-2/NIHz virus stock.
G.L. was supported by the National Institutes of Health Medical
Scientist Training Program and the Cell and Molecular Biology Training
Grant. B.L. was supported by NIH grant KO8 HL03923 and a Burroughs
Wellcome Fund Career Development Award. J.A.H. and R.W.D. were
supported by NIH grant RO1 AI45378 and by an Elizabeth Glaser Scientist
Award from the Pediatric AIDS Foundation and a Burroughs Wellcome Fund
Translational Research Award to R.W.D. Support was also provided by the
Penn Center for AIDS Research, NIH grant P30 AI45008.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Biomedical
Research Building II/III, Room 356, University of Pennsylvania, 421 Curie Blvd., Philadelphia, PA 19104. Phone: (215) 898-0261. Fax: (215) 573-7356. E-mail: hoxie{at}mail.med.upenn.edu.
 |
REFERENCES |
| 1.
|
Alkhatib, G.,
C. Combadiere,
C. C. Broder,
Y. Feng,
P. E. Kennedy,
P. M. Murphy, and E. A. Berger.
1996.
CC CKR5: a RANTES, MIP-1 , MIP-1 receptor as a fusion cofactor for macrophage-tropic HIV-1.
Science
272:1955-1958[Abstract].
|
| 2.
|
Bashirova, A. A.,
T. B. Geijtenbeek,
G. C. van Duijnhoven,
S. J. van Vliet,
J. B. Eilering,
M. P. Martin,
L. Wu,
T. D. Martin,
N. Viebig,
P. A. Knolle,
V. N. KewalRamani,
Y. van Kooyk, and M. Carrington.
2001.
A dendritic cell-specific intercellular adhesion molecule 3-grabbing nonintegrin (DC-SIGN)-related protein is highly expressed on human liver sinusoidal endothelial cells and promotes hiv-1 infection.
J. Exp. Med.
193:671-678[Abstract/Free Full Text].
|
| 3.
|
Berger, E. A.
1998.
HIV entry and tropism: when one receptor is not enough.
Adv. Exp. Med. Biol.
452:151-157[Medline].
|
| 4.
|
Berson, J. F., and R. W. Doms.
1998.
Structure-function studies of the HIV-1 coreceptors.
Semin. Immunol.
10:237-248[CrossRef][Medline].
|
| 5.
|
Bundgaard, J. R.,
J. Vuust, and J. F. Rehfeld.
1997.
New consensus features for tyrosine O-sulfation determined by mutational analysis.
J. Biol. Chem.
272:21700-21705[Abstract/Free Full Text].
|
| 6.
|
Chakrabarti, S.,
J. R. Sisler, and B. Moss.
1997.
Compact, synthetic, vaccinia virus early/late promoter for protein expression.
Biotechniques
23:1094-1097[Medline].
|
| 7.
|
Chan, D. C.,
C. T. Chutkowski, and P. S. Kim.
1998.
Evidence that a prominent cavity in the coiled coil of HIV type 1 gp41 is an attractive drug target.
Proc. Natl. Acad. Sci. USA
95:15613-15617[Abstract/Free Full Text].
|
| 8.
|
Chan, D. C.,
D. Fass,
J. M. Berger, and P. S. Kim.
1997.
Core structure of gp41 from the HIV envelope glycoprotein.
Cell
89:263-273[CrossRef][Medline].
|
| 9.
|
Chen, Z.,
P. Zhou,
D. D. Ho,
N. R. Landau, and P. A. Marx.
1997.
Genetically divergent strains of simian immunodeficiency virus use CCR5 as a coreceptor for entry.
J. Virol.
71:2705-2714[Abstract].
|
| 10.
|
Cho, M. W.,
M. K. Lee,
M. C. Carney,
J. F. Berson,
R. W. Doms, and M. A. Martin.
1998.
Identification of determinants on a dualtropic human immunodeficiency virus type 1 envelope glycoprotein that confer usage of CXCR4.
J. Virol.
72:2509-2515[Abstract/Free Full Text].
|
| 11.
|
Choe, H.,
M. Farzan,
Y. Sun,
N. Sullivan,
B. Rollins,
P. D. Ponath,
L. Wu,
C. R. Mackay,
G. LaRosa,
W. Newman,
N. Gerard,
C. Gerard, and J. Sodroski.
1996.
The beta-chemokine receptors CCR3 and CCR5 facilitate infection by primary HIV-1 isolates.
Cell
85:1135-1148[CrossRef][Medline].
|
| 12.
|
Cocchi, F.,
A. L. DeVico,
A. Garzino-Demo,
A. Cara,
R. C. Gallo, and P. Lusso.
1996.
The V3 domain of the HIV-1 gp120 envelope glycoprotein is critical for chemokine-mediated blockade of infection.
Nat. Med.
2:1244-1247[CrossRef][Medline].
|
| 13.
|
Cormier, E. G.,
M. Persuh,
D. A. Thompson,
S. W. Lin,
T. P. Sakmar,
W. C. Olson, and T. Dragic.
2000.
Specific interaction of CCR5 amino-terminal domain peptides containing sulfotyrosines with HIV-1 envelope glycoprotein gp120.
Proc. Natl. Acad. Sci. USA
97:5762-5767[Abstract/Free Full Text].
|
| 14.
|
Deng, H.,
R. Liu,
W. Ellmeier,
S. Choe,
D. Unutmaz,
M. Burkhart,
P. Di Marzio,
S. Marmon,
R. E. Sutton,
C. M. Hill,
C. B. Davis,
S. C. Peiper,
T. J. Schall,
D. R. Littman, and N. R. Landau.
1996.
Identification of a major co-receptor for primary isolates of HIV-1.
Nature
381:661-666[CrossRef][Medline].
|
| 15.
|
Doms, R. W.
2000.
Beyond receptor expression: the influence of receptor conformation, density, and affinity in HIV-1 infection.
Virology
276:229-237[CrossRef][Medline].
|
| 16.
|
Doms, R. W., and J. P. Moore.
2000.
HIV-1 membrane fusion: targets of opportunity.
J. Cell Biol.
151:F9-F14.
|
| 17.
|
Doranz, B. J.,
Z. H. Lu,
J. Rucker,
T. Y. Zhang,
M. Sharron,
Y. H. Cen,
Z. X. Wang,
H. H. Guo,
J. G. Du,
M. A. Accavitti,
R. W. Doms, and S. C. Peiper.
1997.
Two distinct CCR5 domains can mediate coreceptor usage by human immunodeficiency virus type 1.
J. Virol.
71:6305-6314[Abstract].
|
| 18.
|
Doranz, B. J.,
J. Rucker,
Y. Yi,
R. J. Smyth,
M. Samson,
S. C. Peiper,
M. Parmentier,
R. G. Collman, and R. W. Doms.
1996.
A dual-tropic primary HIV-1 isolate that uses fusin and the beta- chemokine receptors CKR-5, CKR-3, and CKR-2b as fusion cofactors.
Cell
85:1149-1158[CrossRef][Medline].
|
| 19.
|
Dragic, T.,
V. Litwin,
G. P. Allaway,
S. R. Martin,
Y. Huang,
K. A. Nagashima,
C. Cayanan,
P. J. Maddon,
R. A. Koup,
J. P. Moore, and W. A. Paxton.
1996.
HIV-1 entry into CD4+ cells is mediated by the chemokine receptor CC-CKR-5.
Nature
381:667-673[CrossRef][Medline].
|
| 20.
|
Dumonceaux, J.,
S. Nisole,
C. Chanel,
L. Quivet,
A. Amara,
F. Baleux,
P. Briand, and U. Hazan.
1998.
Spontaneous mutations in the env gene of the human immunodeficiency virus type 1 NDK isolate are associated with a CD4-independent entry phenotype.
J. Virol.
72:512-519[Abstract/Free Full Text].
|
| 21.
|
Edinger, A. L.,
C. Blanpain,
K. J. Kunstman,
S. M. Wolinsky,
M. Parmentier, and R. W. Doms.
1999.
Functional dissection of CCR5 coreceptor function through the use of CD4-independent simian immunodeficiency virus strains.
J. Virol.
73:4062-4073[Abstract/Free Full Text].
|
| 22.
|
Edinger, A. L., and R. W. Doms.
1999.
A cell-cell fusion assay to monitor HIV-1 Env interactions with chemokine receptors, p. 41-49.
In
N. L. Michael, and J. H. Kim (ed.), Methods in molecular medicine, vol. 17. Humana Press, Inc., Totowa, N.J.
|
| 23.
|
Edinger, A. L.,
J. L. Mankowski,
B. J. Doranz,
B. J. Margulies,
B. Lee,
J. Rucker,
M. Sharron,
T. L. Hoffman,
J. F. Berson,
M. C. Zink,
V. M. Hirsch,
J. E. Clements, and R. W. Doms.
1997.
CD4-independent, CCR5-dependent infection of brain capillary endothelial cells by a neurovirulent simian immunodeficiency virus strain.
Proc. Natl. Acad. Sci. USA
94:14742-14747[Abstract/Free Full Text].
|
| 24.
|
Edwards, T. G.,
T. L. Hoffman,
F. Baribaud,
S. Wyss,
C. C. LaBranche,
J. Romano,
J. Adkinson,
M. Sharron,
J. A. Hoxie, and R. W. Doms.
2001.
Relationships between CD4 independence, neutralization sensitivity, and exposure of a CD4-induced epitope in a human immunodeficiency virus type 1 envelope protein.
J. Virol.
75:5230-5239[Abstract/Free Full Text].
|
| 25.
|
Endres, M. J.,
P. R. Clapham,
M. Marsh,
M. Ahuja,
J. D. Turner,
A. McKnight,
J. F. Thomas,
B. Stoebenau-Haggarty,
S. Choe,
P. J. Vance,
T. N. Wells,
C. A. Power,
S. S. Sutterwala,
R. W. Doms,
N. R. Landau, and J. A. Hoxie.
1996.
CD4-independent infection by HIV-2 is mediated by fusin/CXCR4.
Cell
87:745-756[CrossRef][Medline].
|
| 26.
|
Farzan, M.,
T. Mirzabekov,
P. Kolchinsky,
R. Wyatt,
M. Cayabyab,
N. P. Gerard,
C. Gerard,
J. Sodroski, and H. Choe.
1999.
Tyrosine sulfation of the amino terminus of CCR5 facilitates HIV-1 entry.
Cell
96:667-676[CrossRef][Medline].
|
| 27.
|
Farzan, M.,
N. Vasilieva,
C. E. Schnitzler,
S. Chung,
J. Robinson,
N. P. Gerard,
C. Gerard,
H. Choe, and J. Sodroski.
2000.
A tyrosine-sulfated peptide based on the N terminus of CCR5 interacts with a CD4-enhanced epitope of the HIV-1 gp120 envelope glycoprotein and inhibits HIV-1 entry.
J. Biol. Chem.
275:33516-33521[Abstract/Free Full Text].
|
| 28.
|
Feng, Y.,
C. C. Broder,
P. E. Kennedy, and E. A. Berger.
1996.
HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane, G protein-coupled receptor.
Science
272:872-877[Abstract].
|
| 29.
|
Geijtenbeek, T. B.,
D. S. Kwon,
R. Torensma,
S. J. van Vliet,
G. C. van Duijnhoven,
J. Middel,
I. L. Cornelissen,
H. S. Nottet,
V. N. KewalRamani,
D. R. Littman,
C. G. Figdor, and Y. van Kooyk.
2000.
DC-SIGN, a dendritic cell-specific HIV-1-binding protein that enhances trans-infection of T cells.
Cell
100:587-597[CrossRef][Medline].
|
| 30.
|
Geijtenbeek, T. B.,
R. Torensma,
S. J. van Vliet,
G. C. van Duijnhoven,
G. J. Adema,
Y. van Kooyk, and C. G. Figdor.
2000.
Identification of DC-SIGN, a novel dendritic cell-specific ICAM-3 receptor that supports primary immune responses.
Cell
100:575-585[CrossRef][Medline].
|
| 31.
|
Hoffman, T. L.,
G. Canziani,
L. Jia,
J. Rucker, and R. W. Doms.
2000.
A biosensor assay for studying ligand-membrane receptor interactions: binding of antibodies and HIV-1 Env to chemokine receptors.
Proc. Natl. Acad. Sci. USA
97:11215-11220[Abstract/Free Full Text].
|
| 32.
|
Hoffman, T. L., and R. W. Doms.
1998.
Chemokines and coreceptors in HIV/SIV-host interactions.
AIDS
12:S17-S26.
|
| 33.
|
Hoffman, T. L.,
C. C. LaBranche,
W. Zhang,
G. Canziani,
J. Robinson,
I. Chaiken,
J. A. Hoxie, and R. W. Doms.
1999.
Stable exposure of the coreceptor-binding site in a CD4-independent HIV-1 envelope protein.
Proc. Natl. Acad. Sci. USA
96:6359-6364[Abstract/Free Full Text].
|
| 34.
|
Hoffman, T. L.,
E. B. Stephens,
O. Narayan, and R. W. Doms.
1998.
HIV type I envelope determinants for use of the CCR2b, CCR3, STRL33, and APJ coreceptors.
Proc. Natl. Acad. Sci. USA
95:11360-11365[Abstract/Free Full Text].
|
| 35.
|
Hoxie, J. A.
1991.
Hypothetical assignment of intrachain disulfide bonds for HIV-2 and SIV envelope glycoproteins.
AIDS Res. Hum. Retroviruses
7:495-499[Medline].
|
| 36.
|
Kehoe, J. W., and C. R. Bertozzi.
2000.
Tyrosine sulfation: a modulator of extracellular protein-protein interactions.
Chem. Biol.
7:R57-R61[CrossRef][Medline].
|
| 37.
|
Kodama, T.,
D. P. Wooley,
Y. M. Naidu,
H. W. Kestler, 3rd,
M. D. Daniel,
Y. Li, and R. C. Desrosiers.
1989.
Significance of premature stop codons in env of simian immunodeficiency virus.
J. Virol.
63:4709-4714[Abstract/Free Full Text].
|
| 38.
|
Kolchinsky, P.,
E. Kiprilov, and J. Sodroski.
2001.
Increased neutralization sensitivity of CD4-independent human immunodeficiency virus variants.
J. Virol.
75:2041-2050[Abstract/Free Full Text].
|
| 39.
|
Kolchinsky, P.,
T. Mirzabekov,
M. Farzan,
E. Kiprilov,
M. Cayabyab,
L. J. Mooney,
H. Choe, and J. Sodroski.
1999.
Adaptation of a CCR5-using, primary human immunodeficiency virus type 1 isolate for CD4-independent replication.
J. Virol.
73:8120-8126[Abstract/Free Full Text].
|
| 40.
|
Kuhmann, S. E.,
E. J. Platt,
S. L. Kozak, and D. Kabat.
2000.
Cooperation of multiple CCR5 coreceptors is required for infections by human immunodeficiency virus type 1.
J. Virol.
74:7005-7015[Abstract/Free Full Text].
|
| 41.
|
Kuiken, C.,
B. Foley,
B. Hahn,
P. Marx,
F. McCutchan,
J. Mellors,
J. Mullins,
S. Wolinsky, and B. Korber.
1999.
Human retroviruses and AIDS.
Theoretical Biology and Biophysics, Los Alamos National Laboratory, Los Alamos, N. Mex.
|
| 42.
|
Kwong, P. D.,
R. Wyatt,
J. Robinson,
R. W. Sweet,
J. Sodroski, and W. A. Hendrickson.
1998.
Structure of an HIV gp120 envelope glycoprotein in complex with the CD4 receptor and a neutralizing human antibody.
Nature
393:648-659[CrossRef][Medline].
|
| 43.
|
LaBranche, C. C.,
T. L. Hoffman,
J. Romano,
B. S. Haggarty,
T. G. Edwards,
T. J. Matthews,
R. W. Doms, and J. A. Hoxie.
1999.
Determinants of CD4 independence for a human immunodeficiency virus type 1 variant map outside regions required for coreceptor specificity.
J. Virol.
73:10310-10319[Abstract/Free Full Text].
|
| 44.
|
Lee, B.,
M. Sharron,
C. Blanpain,
B. J. Doranz,
J. Vakili,
P. Setoh,
E. Berg,
G. Liu,
H. R. Guy,
S. R. Durell,
M. Parmentier,
C. N. Chang,
K. Price,
M. Tsang, and R. W. Doms.
1999.
Epitope mapping of CCR5 reveals multiple conformational states and distinct but overlapping structures involved in chemokine and coreceptor function.
J. Biol. Chem.
274:9617-9626[Abstract/Free Full Text].
|
| 45.
|
Lin, W. H.,
K. Larsen,
G. L. Hortin, and J. A. Roth.
1992.
Recognition of substrates by tyrosylprotein sulfotransferase. Determination of affinity by acidic amino acids near the target sites.
J. Biol. Chem.
267:2876-2879[Abstract/Free Full Text].
|
| 46.
|
Martin, K. A.,
R. Wyatt,
M. Farzan,
H. Choe,
L. Marcon,
E. Desjardins,
J. Robinson,
J. Sodroski,
C. Gerard, and N. P. Gerard.
1997.
CD4-independent binding of SIV gp120 to rhesus CCR5.
Science
278:1470-1473[Abstract/Free Full Text].
|
| 47.
|
Melikyan, G. B.,
R. M. Markosyan,
H. Hemmati,
M. K. Delmedico,
D. M. Lambert, and F. S. Cohen.
2000.
Evidence that the transition of HIV-1 gp41 into a six-helix bundle, not the bundle configuration, induces membrane fusion.
J. Cell Biol.
151:413-424[Abstract/Free Full Text].
|
| 48.
|
Mirzabekov, T.,
N. Bannert,
M. Farzan,
W. Hofmann,
P. Kolchinsky,
L. Wu,
R. Wyatt, and J. Sodroski.
1999.
Enhanced expression, native purification, and characterization of CCR5, a principal HIV-1 coreceptor.
J. Biol. Chem.
274:28745-28750[Abstract/Free Full Text].
|
| 49.
|
Moore, J. P.,
Q. J. Sattentau,
R. Wyatt, and J. Sodroski.
1994.
Probing the structure of the human immunodeficiency virus surface glycoprotein gp120 with a panel of monoclonal antibodies.
J. Virol.
68:469-484[Abstract/Free Full Text].
|
| 50.
|
Myszka, D. G.,
R. W. Sweet,
P. Hensley,
M. Brigham-Burke,
P. D. Kwong,
W. A. Hendrickson,
R. Wyatt,
J. Sodroski, and M. L. Doyle.
2000.
Energetics of the HIV gp120-CD4 binding reaction.
Proc. Natl. Acad. Sci. USA
97:9026-9031[Abstract/Free Full Text].
|
| 51.
|
Pohlmann, S.,
F. Baribaud,
B. Lee,
G. J. Leslie,
M. D. Sanchez,
K. Hiebenthal-Millow,
J. Munch,
F. Kirchhoff, and R. W. Doms.
2001.
DC-SIGN interactions with human immunodeficiency virus type 1 and 2 and simian immunodeficiency virus.
J. Virol.
75:4664-4672[Abstract/Free Full Text].
|
| 52.
|
Pohlmann, S.,
E. J. Soilleux,
F. Baribaud,
G. J. Leslie,
L. S. Morris,
J. Trowsdale,
B. Lee,
N. Coleman, and R. W. Doms.
2001.
DC-SIGNR, a DC-SIGN homologue expressed in endothelial cells, binds to human and simian immunodeficiency viruses and activates infection in trans.
Proc. Natl. Acad. Sci. USA
98:2670-2675[Abstract/Free Full Text].
|
| 53.
|
Reeves, J. D.,
N. Heveker,
A. Brelot,
M. Alizon,
P. R. Clapham, and L. Picard.
1998.
The second extracellular loop of CXCR4 is involved in CD4-independent entry of human immunodeficiency virus type 2.
J. Gen. Virol.
79:1793-1799[Abstract].
|
| 54.
|
Reeves, J. D.,
S. Hibbitts,
G. Simmons,
A. McKnight,
J. M. Azevedo-Pereira,
J. Moniz-Pereira, and P. R. Clapham.
1999.
Primary human immunodeficiency virus type 2 (HIV-2) isolates infect CD4-negative cells via CCR5 and CXCR4: comparison with HIV-1 and simian immunodeficiency virus and relevance to cell tropism in vivo.
J. Virol.
73:7795-7804[Abstract/Free Full Text].
|
| 55.
|
Reeves, J. D., and T. F. Schulz.
1997.
The CD4-independent tropism of human immunodeficiency virus type 2 involves several regions of the envelope protein and correlates with a reduced activation threshold for envelope-mediated fusion.
J. Virol.
71:1453-1465[Abstract].
|
| 56.
|
Reitter, J. N.,
R. E. Means, and R. C. Desrosiers.
1998.
A role for carbohydrates in immune evasion in AIDS.
Nat. Med.
4:679-684[CrossRef][Medline].
|
| 57.
|
Rizzuto, C., and J. Sodroski.
2000.
Fine definition of a conserved CCR5-binding region on the human immunodeficiency virus type 1 glycoprotein 120.
AIDS Res. Hum. Retroviruses
16:741-749[CrossRef][Medline].
|
| 58.
|
Rizzuto, C. D.,
R. Wyatt,
N. Hernandez-Ramos,
Y. Sun,
P. D. Kwong,
W. A. Hendrickson, and J. Sodroski.
1998.
A conserved HIV gp120 glycoprotein structure involved in chemokine receptor binding.
Science
280:1949-1953[Abstract/Free Full Text].
|
| 59.
|
Root, M. J.,
M. S. Kay, and P. S. Kim.
2001.
Protein design of an HIV-1 entry inhibitor.
Science
11:11.
|
| 60.
|
Rosenquist, G. L., and H. B. Nicholas.
1993.
Analysis of sequence requirements for protein tyrosine sulfation.
Protein Sci.
2:215-222[Medline].
|
| 61.
|
Rucker, J.,
B. J. Doranz,
A. L. Edinger,
D. Long,
J. F. Berson, and R. W. Doms.
1997.
Cell-cell fusion assay to study role of chemokine receptors in human immunodeficiency virus type 1 entry.
Methods Enzymol.
288:118-133[Medline].
|
| 62.
|
Rucker, J.,
M. Samson,
B. J. Doranz,
F. Libert,
J. F. Berson,
Y. Yi,
R. J. Smyth,
R. G. Collman,
C. C. Broder,
G. Vassart,
R. W. Doms, and M. Parmentier.
1996.
Regions in beta-chemokine receptors CCR5 and CCR2b that determine HIV-1 cofactor specificity.
Cell
87:437-446[CrossRef][Medline].
|
| 63.
|
Siciliano, S. J.,
S. E. Kuhmann,
Y. Weng,
N. Madani,
M. S. Springer,
J. E. Lineberger,
R. Danzeisen,
M. D. Miller,
M. P. Kavanaugh,
J. A. DeMartino, and D. Kabat.
1999.
A critical site in the core of the CCR5 chemokine receptor required for binding and infectivity of human immunodeficiency virus type 1.
J. Biol. Chem.
274:1905-1913[Abstract/Free Full Text].
|
| 64.
|
Sodroski, J. G.
1999.
HIV-1 entry inhibitors in the side pocket.
Cell
99:243-246[CrossRef][Medline].
|
| 65.
|
Soilleux, E. J.,
R. Barten, and J. Trowsdale.
2000.
DC-SIGN; a related gene, DC-SIGNR; and CD23 form a cluster on 19p13.
J. Immunol.
165:2937-2942[Abstract/Free Full Text].
|
| 66.
|
Speck, R. F.,
K. Wehrly,
E. J. Platt,
R. E. Atchison,
I. F. Charo,
D. Kabat,
B. Chesebro, and M. A. Goldsmith.
1997.
Selective employment of chemokine receptors as human immunodeficiency virus type 1 coreceptors determined by individual amino acids within the envelope V3 loop.
J. Virol.
71:7136-7139[Abstract].
|
| 67.
|
Trkola, A.,
T. Dragic,
J. Arthos,
J. M. Binley,
W. C. Olson,
G. P. Allaway,
C. Cheng-Mayer,
J. Robinson,
P. J. Maddon, and J. P. Moore.
1996.
CD4-dependent, antibody-sensitive interactions between HIV-1 and its co-receptor CCR-5.
Nature
384:184-187[CrossRef][Medline].
|
| 68.
|
Trkola, A.,
T. Ketas,
V. N. Kewalramani,
F. Endorf,
J. M. Binley,
H. Katinger,
J. Robinson,
D. R. Littman, and J. P. Moore.
1998.
Neutralization sensitivity of human immunodeficiency virus type 1 primary isolates to antibodies and CD4-based reagents is independent of coreceptor usage.
J. Virol.
72:1876-1885[Abstract/Free Full Text].
|
| 69.
|
Weissenhorn, W.,
A. Dessen,
S. C. Harrison,
J. J. Skehel, and D. C. Wiley.
1997.
Atomic structure of the ectodomain from HIV-1 gp41.
Nature
387:426-430[CrossRef][Medline].
|
| 70.
|
Wild, C. T.,
D. C. Shugars,
T. K. Greenwell,
C. B. McDanal, and T. J. Matthews.
1994.
Peptides corresponding to a predictive alpha-helical domain of human immunodeficiency virus type 1 gp41 are potent inhibitors of virus infection.
Proc. Natl. Acad. Sci. USA
91:9770-9774[Abstract/Free Full Text].
|
| 71.
|
Willett, B. J.,
M. J. Hosie,
J. C. Neil,
J. D. Turner, and J. A. Hoxie.
1997.
Common mechanism of infection by lentiviruses.
Nature
385:587[Medline].
|
| 72.
|
Wu, L.,
N. P. Gerard,
R. Wyatt,
H. Choe,
C. Parolin,
N. Ruffing,
A. Borsetti,
A. A. Cardoso,
E. Desjardin,
W. Newman,
C. Gerard, and J. Sodroski.
1996.
CD4-induced interaction of primary HIV-1 gp120 glycoproteins with the chemokine receptor CCR-5.
Nature
384:179-183[CrossRef][Medline].
|
| 73.
|
Wyatt, R.,
M. Thali,
S. Tilley,
A. Pinter,
M. Posner,
D. Ho,
J. Robinson, and J. Sodroski.
1992.
Relationship of the human immunodeficiency virus type 1 gp120 third variable loop to a component of the CD4 binding site in the fourth conserved region.
J. Virol.
66:6997-7004[Abstract/Free Full Text].
|
| 74.
|
Xiao, X.,
L. Wu,
T. S. Stantchev,
Y. R. Feng,
S. Ugolini,
H. Chen,
Z. Shen,
J. L. Riley,
C. C. Broder,
Q. J. Sattentau, and D. S. Dimitrov.
1999.
Constitutive cell surface association between CD4 and CCR5.
Proc. Natl. Acad. Sci. USA
96:7496-7501[Abstract/Free Full Text].
|
| 75.
|
Zagury, J. F.,
G. Franchini,
M. Reitz,
E. Collalti,
B. Starcich,
L. Hall,
K. Fargnoli,
L. Jagodzinski,
H. G. Guo,
F. Laure,
S. K. Arya,
S. Josephs,
D. Zagury,
F. Wong-Staal, and R. C. Gallo.
1988.
Genetic variability between isolates of human immunodeficiency virus (HIV) type 2 is comparable to the variability among HIV type 1.
Proc. Natl. Acad. Sci. USA
85:5941-5945[Abstract/Free Full Text].
|
Journal of Virology, November 2001, p. 10766-10778, Vol. 75, No. 22
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.22.10766-10778.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Agrawal-Gamse, C., Lee, F.-H., Haggarty, B., Jordan, A. P. O., Yi, Y., Lee, B., Collman, R. G., Hoxie, J. A., Doms, R. W., Laakso, M. M.
(2009). Adaptive Mutations in a Human Immunodeficiency Virus Type 1 Envelope Protein with a Truncated V3 Loop Restore Function by Improving Interactions with CD4. J. Virol.
83: 11005-11015
[Abstract]
[Full Text]
-
Lin, G., Bertolotti-Ciarlet, A., Haggarty, B., Romano, J., Nolan, K. M., Leslie, G. J., Jordan, A. P.-O., Huang, C.-c., Kwong, P. D., Doms, R. W., Hoxie, J. A.
(2007). Replication-Competent Variants of Human Immunodeficiency Virus Type 2 Lacking the V3 Loop Exhibit Resistance to Chemokine Receptor Antagonists. J. Virol.
81: 9956-9966
[Abstract]
[Full Text]
-
Wyss, S., Dimitrov, A. S., Baribaud, F., Edwards, T. G., Blumenthal, R., Hoxie, J. A.
(2005). Regulation of Human Immunodeficiency Virus Type 1 Envelope Glycoprotein Fusion by a Membrane-Interactive Domain in the gp41 Cytoplasmic Tail. J. Virol.
79: 12231-12241
[Abstract]
[Full Text]
-
Abrahamyan, L. G., Mkrtchyan, S. R., Binley, J., Lu, M., Melikyan, G. B., Cohen, F. S.
(2005). The Cytoplasmic Tail Slows the Folding of Human Immunodeficiency Virus Type 1 Env from a Late Prebundle Configuration into the Six-Helix Bundle. J. Virol.
79: 106-115
[Abstract]
[Full Text]
-
Dehghani, H., Puffer, B. A., Doms, R. W., Hirsch, V. M.
(2003). Unique Pattern of Convergent Envelope Evolution in Simian Immunodeficiency Virus-Infected Rapid Progressor Macaques: Association with CD4-Independent Usage of CCR5. J. Virol.
77: 6405-6418
[Abstract]
[Full Text]
-
Lin, G., Baribaud, F., Romano, J., Doms, R. W., Hoxie, J. A.
(2002). Identification of gp120 Binding Sites on CXCR4 by Using CD4-Independent Human Immunodeficiency Virus Type 2 Env Proteins. J. Virol.
77: 931-942
[Abstract]
[Full Text]
-
Lin, G., Simmons, G., Pohlmann, S., Baribaud, F., Ni, H., Leslie, G. J., Haggarty, B. S., Bates, P., Weissman, D., Hoxie, J. A., Doms, R. W.
(2002). Differential N-Linked Glycosylation of Human Immunodeficiency Virus and Ebola Virus Envelope Glycoproteins Modulates Interactions with DC-SIGN and DC-SIGNR. J. Virol.
77: 1337-1346
[Abstract]
[Full Text]
-
Ryzhova, E., Whitbeck, J. C., Canziani, G., Westmoreland, S. V., Cohen, G. H., Eisenberg, R. J., Lackner, A., Gonzalez-Scarano, F.
(2002). Rapid Progression to Simian AIDS Can Be Accompanied by Selection of CD4-Independent gp120 Variants with Impaired Ability To Bind CD4. J. Virol.
76: 7903-7909
[Abstract]
[Full Text]
-
Reeves, J. D., Doms, R. W.
(2002). Human immunodeficiency virus type 2. J. Gen. Virol.
83: 1253-1265
[Full Text]