Previous Article | Next Article ![]()
Journal of Virology, November 2001, p. 10670-10682, Vol. 75, No. 22
Heinrich-Pette-Institut, D-20251
Hamburg,1 and Abteilung Virologie,
Universität Heidelberg, D-69120
Heidelberg,2 Germany
Received 8 March 2001/Accepted 7 August 2001
Nuclear export of incompletely spliced RNAs is a
prerequisite for retroviral replication. Complex retroviruses like
human immunodeficiency virus (HIV) encode a viral transport factor
(Rev), which binds to its target sequence on the RNA genome and directs it into the Crm-1-mediated export pathway. Other retroviruses, like
Mason-Pfizer monkey virus, contain cis-acting
constitutive RNA transport elements (CTE) which achieve nuclear export
of intron-containing RNA via cellular transport factors. Here, we
describe the identification and characterization of a novel
cis-acting orientation-dependent RNA expression element
in the coding region of the murine intracisternal A-type particle (IAP)
MIA14. This IAP expression element (IAPE) can functionally replace the
Rev system in the expression of HIV-1 Gag proteins but functions
independently of Crm-1. The presence of this element is needed for the
expression of the IAP Gag proteins, indicating its biological
significance. The IAPE can be functionally replaced by placing a CTE on
the MIA14 RNA, further supporting its role in mRNA export. Northern
blot analysis revealed that total RNA, as well as cytoplasmic RNA, was
increased when the element was present. The element was mapped to a
predicted stem-loop structure in the 3' part of the pol
open reading frame. There was no overall homology between the
IAPE and the CTE, but there was complete sequence identity
between short putative single-stranded loops. Deletion of these loops
from the IAPE severely reduced Rev-independent Gag expression.
Gene expression is a highly ordered
process which is controlled at both the transcriptional and
posttranscriptional levels. Prior to their export to the cytoplasm,
most pre-mRNAs are modified by removal of intronic sequences, addition
of a cap structure to their 5'ends, and cleavage and polyadenylation of
their 3'ends (19). Completion of posttranscriptional
modifications is a prerequisite for nuclear export, and
intron-containing RNAs are generally retained and degraded in the
nucleus (24, 25, 53). Retroviruses, on the other hand,
require nuclear export of intron-containing RNAs and therefore have
devised several strategies to overcome this export block. Most
retroviruses produce a single primary transcript which corresponds to
the viral RNA genome. This primary transcript serves as mRNA for the
inner structural proteins (Gag) and replication enzymes (Pol) but also
undergoes one or several splicing events leading to distinct classes of
mRNAs. This mode of gene expression fulfils the need for genetic
economy but requires the presence of inefficient splice sites and a
mechanism for nuclear export of incompletely spliced RNAs (6, 24,
46, 53, 59).
According to their genome organizations, retroviruses are divided into
simple and complex viruses. Simple retroviruses encode Gag and Pol
proteins from the unspliced RNA and encode the glycoproteins of the
viral envelope (Env) from a singly spliced mRNA. Complex retroviruses,
like human immunodeficiency virus type 1 (HIV-1), contain several
additional open reading frames encoding regulatory proteins that are
synthesized from multiply spliced RNAs. Multiply spliced RNAs lack
introns and are normally exported from the nucleus, while other viral
mRNAs, and in particular the genomic RNA, would normally be retained in
the nucleus due to the continued presence of introns (6, 46,
59). To overcome this problem, HIV-1 and other complex
retroviruses make use of a posttranscriptional regulatory system
consisting of the viral Rev protein and its target RNA structure, the
Rev-responsive element (RRE). The RRE is located in the env
coding region and is present on all incompletely spliced transcripts
(11, 36). Complete removal of intronic sequences removes
the RRE, thus discriminating between Rev-dependent and
Rev-independent transcripts (46). Nuclear export of
RRE-containing RNAs requires Rev binding and multimerization. To
achieve its function, Rev contains two distinct domains: an RNA binding
domain, which recognizes the RRE and serves as a nuclear localization signal (NLS) (2, 35, 36), and a leucine-rich nuclear
export signal (NES) promoting binding to the cellular export receptor Crm-1, a member of the importin- The export problem is similar in the case of simple retroviruses, but
the solutions are different: the genomic RNAs of these viruses also
contain introns and have to be exported to the cytoplasm, but there is
no Rev-like factor. cis-acting RNA elements that promote
efficient nuclear export of viral RNAs in the absence of viral
trans-acting factors were first defined in the genomes of
viruses from the D-type subgroup of retroviruses (Mason-Pfizer monkey
virus [M-PMV] and simian retrovirus types 1 and 2) (4, 65). These elements are located in the intergenic region between env and the 3' long terminal repeat and have been termed
constitutive transport elements (CTE). The CTE are necessary for viral
replication and enable cytoplasmic accumulation of the unspliced RNA,
while the spliced env mRNA is CTE independent
(9). The CTE can functionally replace the export
system of complex retroviruses, leading to infectious virus lacking Rev
and the RRE, although replication is impaired compared to that of
wild-type virus (4, 65). The CTE corresponds to an
imperfect inverted repeat folding into a stable secondary structure
with two internal loops (8, 9, 55). Mutation of loop
sequences abrogated CTE function and inhibited nuclear export of
CTE-containing RNAs upon microinjection into Xenopus
oocytes, thus defining these regions as potential docking sites for
cellular export factors (44, 50). A cellular protein that
specifically interacts with the CTE is the Tip-associated protein Tap
(15, 63). Tap is a nucleocytoplasmic shuttling protein and
contains an RNA binding domain that specifically interacts only with
the functional CTE, indicating that Tap is indeed the cellular CTE export factor (3, 28, 29).
A functional CTE has also been observed in the case of the avian
retrovirus Rous sarcoma virus (RSV). The RSV genome contains two direct
repeats (DR) flanking the src oncogene which mediate cytoplasmic accumulation of unspliced RSV transcripts and weakly substitute for Rev function, as shown by analysis in avian cells (41, 42, 52). Recently, the DR sequences have been shown to mediate nucleocytoplasmic transport of a heterologous RNA in a
Crm-1-independent manner, confirming their intrinsic RNA export function (43). CTE-homologous sequences have been
suggested for other retroviruses on the basis of computer predictions,
but the majority of simple retroviruses do not appear to contain
CTE-homologous sequences (8, 54).
Posttranscriptional control elements have also been detected in
endogenous retroviruses and pararetroviruses (7, 8, 20,
54). Pararetroviruses, like hepatitis B virus (HBV) replicate via reverse transcription but without chromosomal integration. They
contain posttranscriptional regulatory RNA elements (PRE), which
substitute for Rev/RRE but appear to function by a different mechanism
exerting pleiotropic effects on RNA stability, modification, and export
(7, 20, 22). Endogenous retroviruses are stably integrated
into the cellular genome, mostly defective, and vertically transmitted
(31). A Rev/RRE-analogous system has been observed for the
HERV-K subgroup of human endogenous retroviruses (34, 62),
while sequences homologous to the CTE have been described for a few
members of the endogenous retrovirus group of intracisternal A-type
particles (IAPs) (54). Although IAPs are present in rodent cells at 1,000 to 2,000 copies per haploid genome (31),
only 10 CTE-like elements were identified by sequence comparison in IAPs and related sequences (8, 54). Only one of these
elements led to enhanced gene expression when introduced into a
heterologous context, indicating that most IAPs are not expressed via
CTE-mediated pathways.
Here, we report the identification and characterization of a new
cis-acting RNA element located in the pol region
of the murine IAP MIA14 (39). This element was termed the
IAP expression element (IAPE). It is required for expression of IAP Gag
proteins but can be functionally replaced by a CTE. It efficiently
substitutes for Rev/RRE in the expression of HIV-1 structural proteins
but shows no overall homology to the CTE. Enhanced expression appears to be due to pleiotropic effects on RNA stability and export. We have
mapped the IAPE to a putative stem-loop structure and identified
functional domains by mutational analysis. We also provide evidence for
the presence of functionally similar cis-acting elements in
the pol region of primate foamy virus, suggesting a
general role in retroviral gene expression which may be partly conserved in pararetroviruses.
Plasmids.
The eukaryotic expression plasmids pK-R-gpII (with
the RRE) and pK-gpII (without the RRE) have been described elsewhere
(38, 60). Both contain part of the 5' untranslated region
and the complete gag and protease (PR) region of HIV-1 under
control of the cytomegalovirus (CMV) promoter-enhancer with simian
virus 40 (SV40) splice and polyadenylation sequences. The
HIV-1-specific sequences were excised using flanking EcoRI
sites and cloned into pBluescript SK(+) to give pBSG. A 1.6-kb fragment
corresponding to nucleotides (nt) 4683 to 6291 of the MIA14 sequence
(39) was excised with NotI and SmaI
and cloned into pK-gpII (pK-gpII-M [Fig.
1]). A similar expression plasmid
containing the same 1.6-kb fragment in antisense orientation
(pK-gpII-Mas) was cloned by inserting the
SmaI-NotI fragment into pBSG and subsequent
cloning of an XhoI-NotI fragment into pKex
(47).
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.22.10670-10682.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
A New RNA Element Located in the Coding Region of a Murine
Endogenous Retrovirus Can Functionally Replace the Rev/Rev-Responsive
Element System in Human Immunodeficiency Virus Type 1 Gag Expression

and
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
superfamily of proteins
(12, 13, 58).
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

View larger version (22K):
[in a new window]
FIG. 1.
Schematic representation of expression plasmids and
analysis of HIV-1 Gag expression. (A) All expression plasmids contain
part of the 5' untranslated region of HIV-1 as well as the
gag and PR coding regions. RNA elements derived from
HIV-1 (RRE; pK-R-gpII) or from the IAP MIA14 (pK-M-gpII) were inserted
3' of the coding region and are depicted as shaded (RRE) or solid
(MIA14) boxes. At the top, the relative positions of the gag-PR region
and of the RRE, as well as the coding exons for Rev, are highlighted in
the HIV-1 genome. At the bottom, the relative position of the murine
element is highlighted in the IAP genome. (B) Immunoblot analysis of
transfected HeLa cells using antiserum against HIV-1 CA. Cells were
transfected with plasmid pK-R-gpII (in the absence or presence of Rev
[lanes 1 and 2]) or pK-gpII-M (containing the IAPE in sense or
antisense [as.] orientation [lanes 3 and 4]). The cell lysates were
normalized for transfection efficiency. The Gag polyprotein (Pr55) and
CA are marked on the right; molecular mass standards (in kilodaltons)
are given on the left. The additional proteins migrating between Pr55
and CA correspond to the Gag intermediate cleavage products MA-CA-NC
and MA-CA.
Sal and
Not were constructed by excising the respective coding region,
including the CMV promoter, from pL-MIA4 as an SpeI-SalI or SpeI-NotI
fragment and inserting it into pKex. For control plasmid 3-MIA4
Not
(Fig. 2B), the same
SpeI-Not fragment was inserted into pcDNA3.1
(Invitrogen), replacing the CMV promoter, and subsequently, the CTE
sequence was inserted into the 3' untranslated region in order to
generate 3-MIA4
Not-CTE. Plasmids pK-gpII-Fo sense and antisense
were constructed by PCR amplification of the region from nt 6128 to
6683 from the human foamy virus genome (GenBank accession number
U21247.1) with primers 5' Fo
(GGTCTAGAAACAACACCTATAGCCC), introducing an
XbaI site (underlined), and 3' Fo
(GGGCTAGCACAACAAGTATAAAGC), introducing an
NheI site (underlined). The resulting PCR fragment was
cleaved with XbaI and NheI and cloned into the
XbaI site (giving both orientations) of pBSG, and
SalI-NotI fragments from the resulting plasmids
were transferred into pKex.
|
Cells and transfection. Cos-7 cells and HeLa P4 cells were maintained in Dulbecco modified Eagle medium supplemented with 10% heat-inactivated fetal calf serum, 100 U of penicillin/ml, 100 µg of streptomycin/ml, and 2 mM glutamine. For transient transfection, 5 × 105 cells were seeded in a 10-cm-diameter dish and grown overnight. The medium was exchanged prior to transfection, and 10 µg of the respective plasmid and 1 µg of a reporter construct encoding enhanced green fluorescent protein (eGFP) were transfected using the modified calcium phosphate coprecipitation technique (5). To assess the transfection efficiency, coverslips were fixed for 10 min with 4% paraformaldehyde in phosphate-buffered saline (PBS) at 48 h posttransfection, and GFP-positive cells were counted.
Western blot analysis and enzyme-linked immunosorbent assay. Cells were harvested at 48 h posttransfection. The cell lysates were normalized for transfection efficiency according to the number of GFP-positive cells and analyzed on 17.5% sodium dodecyl sulfate-polyacrylamide gels (200:1 ratio of acrylamide to N,N-methylenebisacrylamide). The proteins were transferred to nitrocellulose (0.45 µm; Schleicher and Schuell) for 2 h at room temperature, and the membranes were blocked with 10% dry milk in PBS for 1 h and stained overnight with antiserum against HIV-1 capsid protein (CA; 1:2,500 in 5% dry milk in PBS containing 0.5% Triton X-100) or IAP Gag (diluted 1:2,000; kindly provided by K. Lueders). Following an additional blocking step, the blots were incubated for 2 h with peroxidase-conjugated anti-rabbit secondary antibody (diluted 1:10,000; Dianova). Enhanced chemiluminescence (Amersham) was used for detection of specific signals according to the manufacturer's protocol. The blots were exposed to Kodak X-Omat-AR films.
RNA preparation and analysis. Preparation of total or fractionated RNA was performed as described previously (60). The nuclear and cytoplasmic fractions were subjected to RNA extraction by the RNAzol B method (WAK chemicals) according to the manufacturer's protocol. The RNA content was determined photometrically or by gel analysis. Five micrograms of each RNA was loaded on denaturing formaldehyde gels containing 1% agarose and transferred to Biodyne B membrane (0.45 µm; Pall) by capillary blotting. The transfer efficiency was determined by staining the blot with methylene blue (0.04% in 0.5 M NaOAc, pH 5.2). The blots were prehybridized for >1 h at 42°C in 50% formamide-6× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate)-5× Denhardt solution-0.5% sodium dodecyl sulfate containing 100 µg of denatured salmon sperm DNA/ml and hybridized overnight at 42°C with the specific probes (activity, >107 cpm), which had been labeled by random priming using the Prime It II kit (Stratagene). The blots were washed, sealed, and exposed to X-ray films (Kodak X-Omat-AR) or quantified by phosphorimage analysis.
| |
RESULTS |
|---|
|
|
|---|
A sequence from the IAP MIA14 promotes Rev-independent production of the HIV-1 Gag polyprotein. Expression of HIV-1 structural (Gag) proteins requires binding of the viral Rev protein to the RRE, leading to nuclear export of the mRNA. In our analysis of HIV-1 assembly, we constructed chimeric expression plasmids fusing HIV-1 sequences to segments of the genome of the mouse IAP MIA14 (39) and observed that some of these constructs allowed Rev-independent expression of HIV-1 Gag. For a more detailed analysis, we inserted a 1.6 kb-fragment corresponding to the 3' part of the MIA14 pol open reading frame and part of the defective env gene in sense or antisense orientation downstream of the HIV-1 Gag-PR coding region into the eukaryotic expression plasmid pK-gpII (Fig. 1A). Cos-7 cells were transfected with these plasmids or with the RRE-containing plasmid pK-R-gpII (in the presence or absence of Rev), and cell lysates normalized for GFP were analyzed by immunoblotting them using antiserum specific for the HIV-1 CA. Cells transfected with pK-R-gpII exhibited a strong Rev-dependent signal corresponding to the Pr55gag polyprotein, the proteolytically cleaved CA protein, and two intermediate cleavage products (Fig. 1B, lanes 1 and 2). A comparable but slightly weaker signal was seen independent of Rev when the plasmid containing MIA14 sequences in sense orientation was transfected (Fig. 1B, lane 3). In contrast, no HIV-1-specific product was observed when the same sequences were present in antisense orientation (Fig. 1B, lane 4), indicating that MIA14 contains an orientation-dependent RNA element that can functionally substitute for the HIV-1 Rev/RRE system.
The MIA14 element is necessary for expression of the structural
proteins of the IAP and can be functionally replaced by a CTE.
In
order to test whether the sequences from MIA14 are important for
production of the virus' own structural proteins, we constructed expression vectors for MIA14 Gag proteins. Plasmid pL-MIA4 contains the
entire gag open reading frame with a modification in the 5' matrix region and the complete pol open reading frame,
including the 1.6-kb region (57) (Fig. 2A). Derivatives
truncated at SalI and NotI sites and
partially or completely lacking this 1.6-kb region were
termed
S and
N, respectively (Fig. 2A). Plasmids were
transfected into Cos-7 cells, and cell lysates normalized for
transfection rate were analyzed by immunoblotting them using a
polyclonal rabbit serum against purified IAP Gag. The MIA14 Gag
polyprotein and two cleavage products were readily observed in cells
transfected with pL-MIA4 (Fig. 2B, lane 2), as described by Welker et
al. (57). Cells transfected with pL-MIA4
S gave a weak
but detectable signal corresponding to the Gag polyprotein (Fig. 2B,
lane 3), while no specific signal was observed in the case of
pL-MIA4
N-transfected cells (Fig. 2B, lane 4). Similar observations were made when transfected cells were analyzed by immunofluorescence, where strong Gag-specific signals were seen for pL-MIA4 while pL-MIA4
S gave a weak signal and pL-MIA4
N
produced no Gag-specific signal (data not shown). Importantly, the
MIA14 Gag polyprotein is efficiently translated in vitro from an RNA truncated at the NotI site and thus corresponding to the
N construct (reference 10 and data not shown). IAP Gag
expression in transfected cells, therefore, appears to require an RNA
element which is not needed in vitro.
N construct (Fig. 2A). Cells were
transfected with the plasmids 3-IAP
N and 3-IAP
N-CTE and
analyzed for IAP Gag expression by immunoblot analysis. Figure 2B shows
that there was no IAP Gag expression in cells transfected with the
construct lacking the murine element and not containing a CTE (Fig. 2B, lane 5), while IAP Gag expression was efficiently restored in the
presence of the CTE (Fig. 2B, lane 6).
To analyze whether differences are also observed on the RNA level, we
performed Northern blot analysis of Cos-7 cells transfected with
pL-MIA4 or pL-MIA4
N. Total RNA from transfected cells normalized for
transfection rate was analyzed using a radiolabeled probe detecting the Gag coding region present in both constructs (Fig. 2A). A strong and specific RNA signal was observed for
pL-MIA4-transfected cells (Fig. 2C, lane 2), while
pL-MIA4
N-transfected cells gave a weak RNA signal which was only
detected on long-term exposure of the blot (Fig. 2C, lane 3, and data
not shown). Taken together, these results suggest that the MIA14
element is not directly needed for protein synthesis but rather for
stable intracellular RNA expression and export.
The MIA14 element maps to the pol region and
corresponds to a putative stable RNA structure.
In order to map
the newly discovered element more precisely, we constructed expression
vectors containing various subfragments of the MIA14 1.6-kb region
downstream of the HIV-1 gag gene (Fig. 3A) and analyzed their capacity to
promote Rev-independent Gag expression after transient transfection.
Cos-7 cells were transfected with the different pK-gpII derivatives,
and HIV-1 Gag expression was determined by immunoblotting using
CA-specific antiserum or by indirect immunofluorescence. At least three
independent experiments were performed for each construct. The results
of this analysis are summarized in Fig. 3A, and the relative activity
of each fragment is indicated as fluorescence intensity. In general,
all subfragments containing the central part of the 1.6-kb element led
to Rev-independent expression of HIV-1 Gag, albeit at different
efficiencies (Fig. 3A). In contrast, insertion of the
835-nt 5' NotI-BamHI fragment into pK-gpII
did not permit any Gag expression above background. Based on the
analysis presented in Fig. 3A, it can be concluded that the main
activity resides in the central BamHI-SalI
fragment (nt 5501 to 5700 of MIA14), which promoted Rev-independent
HIV-1 Gag expression by itself but was enhanced when flanking sequences were present in addition (data not shown). Interestingly, the nonoverlapping 3' BglII-HindIII
fragment also promoted weak, orientation-dependent Gag expression,
but this phenotype was not analyzed in more detail.
|
|
The IAPE shares functionally important sequence motifs with the CTE. Since the newly recognized element promotes Rev-independent expression of HIV-1 Gag, similar to the CTE of D-type retroviruses, we searched for sequence homologies between these elements. This was of particular importance, since a CTE-like element had previously been identified in the genome of the IAP osteocalcin-related gene (ORG) by sequence homology search (54). This analysis revealed no overall homology between the 360-base sequence from MIA14 and the CTE from D-type retroviruses. However, many RNA elements function through short single-stranded regions containing sequence-specific factor binding sites which are embedded in a structured region with no need for sequence conservation. We therefore analyzed the folding potential of the IAPE in more detail, with particular attention to predicted single-stranded regions. This analysis revealed several short regions of complete sequence identity in the single-stranded loops of the CTE and in the predicted single-stranded regions of the IAPE (Fig. 4). These single-stranded regions have been termed loops A1, B1, A2, and B2 (5'-3') in the case of the CTE (Fig. 4, inset), and the IAPE contains all four motifs in or very close to predicted single-stranded loops (Fig. 4). Furthermore, the orders of these four putative loop regions, as well as the localization of a predicted splice donor (Fig. 4), are also identical in the IAPE and the CTE. These observations suggest that the elements may share binding motifs for the same or related cellular factors, while their overall sequences are highly divergent.
In order to analyze whether the predicted loop motifs are functionally relevant, we introduced mutations into the IAPE. In construct DI, the sequence corresponding to loop B1 was deleted (Fig. 5A, right), which should also affect the folding potential of loop A2 (not shown). A predicted purine-rich single-stranded region without homology to the CTE (Fig. 4) was deleted in construct DII, while the predicted single-stranded region corresponding to the A1 and B2 loops was converted into a stable stem structure in construct MI by introducing several point mutations (Fig. 5A, left). The variant IAPEs were inserted into pK-gpII, and the resulting plasmids were transiently transfected into HeLa P4 cells. Cell lysates normalized for GFP were subjected to Western and Northern blot analysis. Deletion of the purine-rich loop without homology to the CTE had no effect on IAPE-dependent HIV-1 Gag expression (Fig. 5B, lanes 2 and 4). In contrast, deletion of the B1 sequence in construct DI dramatically reduced HIV-1 Gag expression (Fig. 5B, lane 3), and conversion of the A1-B2 region into a predicted stable stem structure in construct MI led to a severe reduction as well (Fig. 5B, lane 5). Quantitative Western blot analysis of the respective cell lysates revealed ca. 20-fold-reduced Gag levels in the case of the DI construct and ca. 6-fold-reduced Gag levels in the case of the MI construct compared to the wild type (data not shown). Northern blot analysis of total RNA preparations from the same experiment showed a strong signal for the gag-specific RNA in the case of pK-gpII-IAPE (Fig. 5C, lane 2), while no specific RNA was detected in cells transfected with the antisense control (Fig. 5C, lane 3). Cells transfected with constructs DI (Fig. 5C, lane 4) and MI (lane 5) also revealed significantly smaller amounts of gag-RNA, but the observed differences (5-fold reduction for DI and 2.5-fold reduction for MI compared to the wild type; normalized for GAPDH [glyceraldehyde-3-phosphate dehydrogenase] levels) were less than those observed at the protein level.
|
The IAPE functions independently of the export receptor Crm-1.
Nuclear RNA export by the Rev/RRE system uses the cellular export
receptor Crm-1, which binds to the NES of Rev (13, 14, 37). CTE-dependent nuclear export, on the other hand, occurs independently of Crm-1. To test whether the IAPE uses the Crm-1 pathway, we performed competition experiments using an artificial fusion protein as a Crm-1 competitor. To this end, HIV-1 Gag expression vectors containing the RRE (with or without Rev), the M-PMV CTE, or the
IAPE were cotransfected with an expression plasmid encoding a fusion
protein carrying the NLS of SV40 and the NES of the human T-cell
leukemia virus Rex protein (Fig. 6A)
(30, 49). The resulting NLS-NES protein is expected to
continuously shuttle between nucleus and cytoplasm and thereby titrate
factors of the Crm-1-dependent export pathway (49, 56). A
vector encoding the same fusion protein with an inactivating mutation
in the NES sequence (M90) was used as a control. As expected,
cotransfection of the NLS-NES competitor completely abrogated
Rev-dependent Gag expression (Fig. 6B, lane 3), and this effect was
dependent on a functional NES (lane 4). In contrast, CTE-mediated HIV-1
Gag expression was not affected by the NLS-NES competitor (Fig. 6B, lanes 5 to 7), confirming that the CTE functions independently of
Crm-1. Similarly, HIV-1 Gag expression promoted by the IAPE was not
inhibited by the NLS-NES competitor (Fig. 6B, lanes 8 to 10). Thus, the
IAPE functions independently of Crm-1, similar to the CTE. This result
was confirmed in an independent experiment using a truncated variant of
the nucleoporin CAN (also called Nup 214), which also blocks
Crm-1-dependent RNA export (1, 48). Cotransfection of the
corresponding expression plasmid also abrogated Rev-dependent Gag
expression but had no effect on CTE- or IAPE-dependent Gag expression
(data not shown). In addition to genetic competition experiments, we
also analyzed inhibition of Crm-1-dependent nuclear export by
leptomycin B, a drug that specifically binds and inactivates Crm-1
(13). Similar to the results of genetic competition,
Rev-dependent HIV-1 Gag expression was abolished in the presence of
leptomycin B (Fig. 6C, lanes 3 and 6) while IAPE-dependent Gag
expression remained completely unaffected (Fig. 6C, lanes 1 and 4).
|
A functionally similar element is present in the same region of the
primate foamy virus genome.
A database search for homologous
sequences in other retroviral pol genes was not informative,
because the pol genes are generally rather conserved due to
selection pressure on the coding sequence. Considering that RNA
elements may correspond to stable stem-loop structures, we performed a
computer-based analysis of the folding potential of different
retroviral pol sequences using the Mulfold program as
described above. A stable RNA structure in the 3' region of the
pol gene was predicted for the genome of the primate foamy virus (data not shown). The sequence corresponding to the
predicted structured region was PCR amplified and cloned into pK-gpII
in sense or antisense orientation (Fig.
7A). The corresponding plasmids were
transiently transfected into HeLa P4 cells, and HIV-1 Gag expression
was determined by Western blot analysis of cell lysates normalized for
GFP. Efficient expression of the Pr55gag
polyprotein, the cleaved CA, and the two intermediate products was
observed when the IAPE (Fig. 7B, lane 4) or the corresponding region
from the foamy virus genome (lane 2) was present in sense, but not in
antisense, orientation (Fig. 7B, lanes 3 and 5).
|
| |
DISCUSSION |
|---|
|
|
|---|
In this report, we describe the identification and characterization of a new posttranscriptional expression element (IAPE) in the 3' part of the pol open reading frame of the IAP MIA14 which is required for expression of the virus' own structural proteins. In addition, this element can functionally substitute for the Rev/RRE system of HIV and permits Rev-independent expression of HIV-1 structural proteins. The IAPE functions independently of the Rev export factor Crm-1 but appears to share binding sites with the CTE of D-type viruses, suggesting a partial overlap in function. Accordingly, the IAPE can be functionally replaced by the CTE in the expression of the virus' own structural proteins. However, the IAPE appears to exert additional effects on RNA stability in addition to a presumed role in nuclear RNA export, making it more akin to the PRE of pararetroviruses.
To date, three different mechanisms facilitating RNA export and expression have been characterized for different retro- and pararetroviruses: (i) the Rev/RRE system of primate lentiviruses and the homologous system of the HERV-K family of human endogenous retroviruses; (ii) the CTE of D-type viruses, binding to the cellular export factor Tap, and the functionally homologous DR element from RSV; and (iii) the PRE of HBV and woodchuck HBV, which appear to make use of a different but presently insufficiently characterized cellular pathway. It appears likely that each of these systems is adapted to the particular requirements of the respective virus or virus group, and related posttranscriptional elements are observed in other viruses, as in the thymidine kinase gene of herpes simplex virus (33), and possibly also in cellular gene expression (21). Consistent with their functional differences, insertion of the various elements into heterologous expression vectors leads to different effects on production of the respective proteins, and the relative enhancement of expression mediated by each element may depend on the specific gene of interest as well as the vector context (22, 51).
Our results clearly show that the newly identified IAPE does not belong to the Rev/RRE family of export systems. There is no evidence for a trans-acting export factor encoded by the MIA14 genome, and the IAPE functions in a heterologous context independent of IAP gene expression. Furthermore, IAPE function cannot be blocked by titrate factors of the Crm-1 export pathway or by biochemical inactivation of Crm-1 with the drug leptomycin B, which both completely and specifically abolished Rev-dependent protein production. There is also no obvious overall homology between the IAPE and the CTE of D-type viruses or of RSV. This element could not be predicted by homology searches based on the CTE sequence, which had been possible for the CTE-like element identified in a different IAP genome (IAP ORG) (54). Furthermore, the predicted structure of the IAPE is quite different from the determined structure of the CTE (Fig. 4), although both regions, as well as the RRE and the PRE, correspond to areas with secondary structure significantly more stable than that of the remainder of the genome (7, 11, 36, 45). However, the observation that there is almost complete sequence identity between predicted single-stranded regions of the IAPE and the four single-stranded loops of the M-PMV CTE, as well as the fact that the CTE could efficiently replace the IAPE in expression of the IAP structural proteins (Fig. 2B), suggests that both elements are likely to share binding sites for common cellular factors, which may include the Tap protein. The loop sequences have been shown to be essential for CTE function in nuclear export (15, 44, 50), and accordingly, deletion of one of these sequences in the IAPE abolished its function as well.
In addition to these analogies, there are also significant differences between the IAPE and the CTE. Most importantly, the presence of the IAPE leads to significantly increased total and nuclear RNA levels as well as increasing cytoplasmic RNA. Considering that enhanced transcription has not been sufficient to overcome Rev dependence in previous experiments (23), it appears unlikely that this increase in total RNA is the sole cause of Rev-independent HIV-1 Gag expression, and an export function is needed in addition to overcome nuclear restriction of gag RNA. Importantly, however, no effect on total or nuclear RNA levels was observed for the CTE, and even multimeric versions of the CTE, which provided multiple factor binding sites and significantly enhanced gene expression, did not cause any increase in total RNA (60). An additional difference between the CTE and the IAPE concerns the observation that the IAPE is fully functional in a vector harboring an intron in the 3' untranslated region (pK-gpII-IAPE), while the presence of a CTE in an identical context did not yield Rev-independent HIV-1 Gag expression (60). The presence of an intron in the 3' untranslated region of an mRNA has been shown to direct this RNA into the pathway of nonsense-mediated decay, and virtually all cellular RNAs therefore lack introns in this position (18, 40). It appears likely, therefore, that the IAPE can overcome the restriction of nonsense-mediated decay, a function which is not shared by the CTE.
An increase in steady-state levels of RNA, as observed for the IAPE, has previously been shown for other posttranscriptional control elements. The PRE of the pararetroviruses HBV and woodchuck HBV direct efficient cytoplasmic accumulation of intron-containing transcripts (7, 20) by using a pathway that differs, at least in part, from those of Rev/RRE and CTE (64). In addition, the presence of the PRE significantly increases the half-life of the viral RNA, and this effect is also observed for heterologous (spliced and unspliced) RNAs harboring this element (22, 51, 66). Thus, the PRE appears to function by a dual effect on RNA stability and on RNA nuclear export, and this may be similar to the observed effects of the IAPE. A dual effect on RNA export and stability has also been reported for the RSV DR element (41, 42), which functions as a CTE (43) but in addition appears to increase the stability of the unspliced viral transcript (16, 42).
Intriguingly, the IAPE function of mediating Rev-independent HIV-1 Gag expression is conserved in the same position of the genome of a primate foamy virus and may also be shared by a murine leukemia virus (unpublished observation). Insertion of a predicted structured region from the 3' end of the pol gene of foamy virus also provided orientation-dependent enhancement of Gag expression and increase of gag RNA levels. The functional significance of this finding and the importance of this region for replication of the respective virus are supported by previously published experiments. Retroviral vectors based on foamy viruses have been constructed by several groups, and transduction by these vectors is absolutely dependent on sequences corresponding to the 3' part of the pol gene (17, 61), overlapping the region used in our study. In fact, this is the only cis-acting RNA sequence required for transduction besides the viral long terminal repeats and a short stretch in the 5' gag region (17). Furthermore, insertion of the foamy virus-derived RNA element into murine leukemia virus-based retroviral vectors led to significantly enhanced expression of the transduced genes (61). This effect was also observed for marker genes (e.g., the GFP gene), which were unaffected by the presence of a CTE but could be enhanced by the PRE of pararetroviruses. It can be speculated, therefore, that this functional element may be evolutionarily linked to the PRE of pararetroviruses. Foamy viruses are classified as retroviruses because their genomes are integrated into a host cell chromosome, but foamy virus replication shares many features with pararetrovirus replication, and foamy viruses have been considered an evolutionary link between retro- and pararetroviruses (32). Intriguingly, the PRE, as well as the IAPE and the Fo element, are all localized in the same region of the respective genomes, overlapping the 3' part of the pol reading frame.
| |
ACKNOWLEDGMENTS |
|---|
We thank M. Dobbelstein for plasmids and helpful suggestions and K. Lueders for antisera. We also thank B. Henkel for help with tissue culture and M. Dittmar for critically reading the manuscript.
This work was supported in part by grants from the Deutsche Forschungsgemeinschaft to H.-G.K. (SFB545 and Ri192/21-1-1). J. Bohne was supported by the Boehringer Ingelheim Fonds
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Abteilung Virologie, Universität Heidelberg, Im Neuenheimer Feld 324, D-69120 Heidelberg, Germany. Phone: 49 6221 56-5001. Fax: 49 6221 56-5003. E-mail: Hans-Georg_Kraeusslich{at}med.uni-heidelberg.de.
Present address: The Scripps Research Institute, Department of Cell
Biology, La Jolla, CA 92037.
Present address: Bayer AG, Virologie, D-42069 Wuppertal, Germany.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Bogerd, H. P.,
A. Echarri,
T. M. Ross, and B. R. Cullen.
1998.
Inhibition of human immunodeficiency virus Rev and human T-cell leukemia virus Rex function, but not Mason-Pfizer monkey virus constitutive transport element activity, by a mutant human nucleoporin targeted to Crm1.
J. Virol.
72:8627-8635 |
| 2. |
Bohnlein, E.,
J. Berger, and J. Hauber.
1991.
Functional mapping of the human immunodeficiency virus type 1 Rev RNA binding domain: new insights into the domain structure of Rev and Rex.
J. Virol.
65:7051-7055 |
| 3. | Braun, I. C., E. Rohrbach, C. Schmitt, and E. Izaurralde. 1999. TAP binds to the constitutive transport element (CTE) through a novel RNA-binding motif that is sufficient to promote CTE-dependent RNA export from the nucleus. EMBO J. 18:1953-1965[CrossRef][Medline]. |
| 4. |
Bray, M.,
S. Prasad,
J. W. Dubay,
E. Hunter,
K. T. Jeang,
D. Rekosh, and M. L. Hammarskjold.
1994.
A small element from the Mason-Pfizer monkey virus genome makes human immunodeficiency virus type 1 expression and replication Rev-independent.
Proc. Natl. Acad. Sci. USA
91:1256-1260 |
| 5. | Chen, C. A., and H. Okayama. 1988. Calcium phosphate-mediated gene transfer: a highly efficient transfection system for stably transforming cells with plasmid DNA. BioTechniques 6:632-638[Medline]. |
| 6. | Cullen, B. R. 1998. Retroviruses as model systems for the study of nuclear RNA export pathways. Virology 249:203-210[CrossRef][Medline]. |
| 7. |
Donello, J. E.,
J. E. Loeb, and T. J. Hope.
1998.
Woodchuck hepatitis virus contains a tripartite posttranscriptional regulatory element.
J. Virol.
72:5085-5092 |
| 8. | Ernst, R. K., M. Bray, D. Rekosh, and M. L. Hammarskjold. 1997. Secondary structure and mutational analysis of the Mason-Pfizer monkey virus RNA constitutive transport element. RNA 3:210-222[Abstract]. |
| 9. | Ernst, R. K., M. Bray, D. Rekosh, and M. L. Hammarskjold. 1997. A structured retroviral RNA element that mediates nucleocytoplasmic export of intron-containing RNA. Mol. Cell. Biol. 17:135-144[Abstract]. |
| 10. | Fehrmann, F., R. Welker, and H. G. Krausslich. 1997. Intracisternal A-type particles express their proteinase in a separate reading frame by translational frameshifting, similar to D-type retroviruses. Virology 235:352-359[CrossRef][Medline]. |
| 11. |
Felber, B. K.,
M. Hadzopoulou-Cladaras,
C. Cladaras,
T. Copeland, and G. N. Pavlakis.
1989.
Rev protein of human immunodeficiency virus type 1 affects the stability and transport of the viral mRNA.
Proc. Natl. Acad. Sci. USA
86:1495-1499 |
| 12. | Fischer, U., J. Huber, W. C. Boelens, I. W. Mattaj, and R. Luhrmann. 1995. The HIV-1 Rev activation domain is a nuclear export signal that accesses an export pathway used by specific cellular RNAs. Cell 82:475-483[CrossRef][Medline]. |
| 13. | Fornerod, M., M. Ohno, M. Yoshida, and I. W. Mattaj. 1997. CRM1 is an export receptor for leucine-rich nuclear export signals. Cell 90:1051-1060[CrossRef][Medline]. |
| 14. | Fukuda, M., S. Asano, T. Nakamura, M. Adachi, M. Yoshida, M. Yanagida, and E. Nishida. 1997. CRM1 is responsible for intracellular transport mediated by the nuclear export signal. Nature 390:308-311[CrossRef][Medline]. |
| 15. | Gruter, P., C. Tabernero, C. von Kobbe, C. Schmitt, C. Saavedra, A. Bachi, M. Wilm, B. K. Felber, and E. Izaurralde. 1998. TAP, the human homolog of Mex67p, mediates CTE-dependent RNA export from the nucleus. Mol. Cell 1:649-659[CrossRef][Medline]. |
| 16. |
Guo, W.,
S. C. Winistorfer, and C. M. Stoltzfus.
2000.
Selective inhibition of splicing at the avian sarcoma virus src 3' splice site by direct-repeat posttranscriptional cis elements.
J. Virol.
74:8513-8523 |
| 17. |
Heinkelein, M.,
M. Schmidt,
N. Fischer,
A. Moebes,
D. Lindemann,
J. Enssle, and A. Rethwilm.
1998.
Characterization of a cis-acting sequence in the Pol region required to transfer human foamy virus vectors.
J. Virol.
72:6307-6314 |
| 18. | Hentze, M. W., and A. E. Kulozik. 1999. A perfect message: RNA surveillance and nonsense-mediated decay. Cell 96:307-310[CrossRef][Medline]. |
| 19. |
Hirose, Y., and J. L. Manley.
2000.
RNA polymerase II and the integration of nuclear events.
Genes Dev.
14:1415-1429 |
| 20. |
Huang, J., and T. J. Liang.
1993.
A novel hepatitis B virus (HBV) genetic element with Rev response element-like properties that is essential for expression of HBV gene products.
Mol. Cell. Biol.
13:7476-7486 |
| 21. |
Huang, Y., and G. G. Carmichael.
1997.
The mouse histone H2a gene contains a small element that facilitates cytoplasmic accumulation of intronless gene transcripts and of unspliced HIV-1-related mRNAs.
Proc. Natl. Acad. Sci. USA
94:10104-10109 |
| 22. | Huang, Y., K. M. Wimler, and G. G. Carmichael. 1999. Intronless mRNA transport elements may affect multiple steps of pre-mRNA processing. EMBO J. 18:1642-1652[CrossRef][Medline]. |
| 23. | Iacampo, S., and A. Cochrane. 1996. Human immunodeficiency virus type 1 Rev function requires continued synthesis of its target mRNA. J. Virol. 70:8332-8339[Abstract]. |
| 24. | Izaurralde, E., and S. Adam. 1998. Transport of macromolecules between the nucleus and the cytoplasm. RNA 4:351-364[Abstract]. |
| 25. | Izaurralde, E., and I. W. Mattaj. 1995. RNA export. Cell 81:153-159[CrossRef][Medline]. |
| 26. |
Jaeger, J. A.,
D. H. Turner, and M. Zuker.
1989.
Improved predictions of secondary structures for RNA.
Proc. Natl. Acad. Sci. USA
86:7706-7710 |
| 27. | Jaeger, J. A., D. H. Turner, and M. Zuker. 1990. Predicting optimal and suboptimal secondary structure for RNA. Methods Enzymol. 183:281-306[Medline]. |
| 28. | Kang, Y., H. P. Bogerd, J. Yang, and B. R. Cullen. 1999. Analysis of the RNA binding specificity of the human tap protein, a constitutive transport element-specific nuclear RNA export factor. Virology 262:200-209[CrossRef][Medline]. |
| 29. |
Kang, Y., and B. R. Cullen.
1999.
The human Tap protein is a nuclear mRNA export factor that contains novel RNA-binding and nucleocytoplasmic transport sequences.
Genes Dev.
13:1126-1139 |
| 30. | Katahira, J., T. Ishizaki, H. Sakai, A. Adachi, K. Yamamoto, and H. Shida. 1995. Effects of translation initiation factor eIF-5A on the functioning of human T-cell leukemia virus type I Rex and human immunodeficiency virus Rev inhibited trans dominantly by a Rex mutant deficient in RNA binding. J. Virol. 69:3125-3133[Abstract]. |
| 31. | Kuff, E. L., and K. K. Lueders. 1988. The intracisternal A-particle gene family: structure and functional aspects. Adv. Cancer Res. 51:183-276[Medline]. |
| 32. |
Linial, M. L.
1999.
Foamy viruses are unconventional retroviruses.
J. Virol.
73:1747-1755 |
| 33. |
Liu, X., and J. E. Mertz.
1995.
HnRNP L binds a cis-acting RNA sequence element that enables intron-dependent gene expression.
Genes Dev.
9:1766-1780 |
| 34. |
Magin, C.,
R. Lower, and J. Lower.
1999.
cORF and RcRE, the Rev/Rex and RRE/RxRE homologues of the human endogenous retrovirus family HTDV/HERV-K.
J. Virol.
73:9496-9507 |
| 35. |
Malim, M. H.,
S. Bohnlein,
J. Hauber, and B. R. Cullen.
1989.
Functional dissection of the HIV-1 Rev trans-activator derivation of a trans-dominant repressor of Rev function.
Cell
58:205-214[CrossRef][Medline].
|
| 36. | Malim, M. H., J. Hauber, S. Y. Le, J. V. Maizel, and B. R. Cullen. 1989. The HIV-1 Rev trans-activator acts through a structured target sequence to activate nuclear export of unspliced viral mRNA. Nature 338:254-257[CrossRef][Medline]. |
| 37. | Mattaj, I. W., and L. Englmeier. 1998. Nucleocytoplasmic transport: the soluble phase. Annu. Rev. Biochem. 67:265-306[CrossRef][Medline]. |
| 38. | Mergener, K., M. Facke, R. Welker, V. Brinkmann, H. R. Gelderblom, and H. G. Krausslich. 1992. Analysis of HIV particle formation using transient expression of subviral constructs in mammalian cells. Virology 186:25-39[CrossRef][Medline]. |
| 39. |
Mietz, J. A.,
Z. Grossman,
K. K. Lueders, and E. L. Kuff.
1987.
Nucleotide sequence of a complete mouse intracisternal A-particle genome: relationship to known aspects of particle assembly and function.
J. Virol.
61:3020-3029 |
| 40. | Nagy, E., and L. E. Maquat. 1998. A rule for termination-codon position within intron-containing genes: when nonsense affects RNA abundance. Trends Biochem. Sci. 23:198-199[CrossRef][Medline]. |
| 41. |
Ogert, R. A., and K. L. Beemon.
1998.
Mutational analysis of the Rous sarcoma virus DR posttranscriptional control element.
J. Virol.
72:3407-3411 |
| 42. | Ogert, R. A., L. H. Lee, and K. L. Beemon. 1996. Avian retroviral RNA element promotes unspliced RNA accumulation in the cytoplasm. J. Virol. 70:3834-3843[Abstract]. |
| 43. |
Paca, R. E.,
R. A. Ogert,
C. S. Hibbert,
E. Izaurralde, and K. L. Beemon.
2000.
Rous sarcoma virus DR posttranscriptional elements use a novel RNA export pathway.
J. Virol.
74:9507-9514 |
| 44. | Pasquinelli, A. E., R. K. Ernst, E. Lund, C. Grimm, M. L. Zapp, D. Rekosh, M. L. Hammarskjold, and J. E. Dahlberg. 1997. The constitutive transport element (CTE) of Mason-Pfizer monkey virus (MPMV) accesses a cellular mRNA export pathway. EMBO J. 16:7500-7510[CrossRef][Medline]. |
| 45. | Patzel, V., and G. Sczakiel. 1997. The hepatitis B virus posttranscriptional regulatory element contains a highly stable RNA secondary structure. Biochem. Biophys. Res. Commun. 231:864-867[CrossRef][Medline]. |
| 46. | Pollard, V. W., and M. H. Malim. 1998. The HIV-1 Rev protein. Annu. Rev. Microbiol. 52:491-532[CrossRef][Medline]. |
| 47. |
Rittner, K., and G. Sczakiel.
1991.
Identification and analysis of antisense RNA target regions of the human immunodeficiency virus type 1.
Nucleic Acids Res.
19:1421-1426 |
| 48. | Rosorius, O., B. Reichart, F. Kratzer, P. Heger, M. C. Dabauvalle, and J. Hauber. 1999. Nuclear pore localization and nucleocytoplasmic transport of eIF-5A: evidence for direct interaction with the export receptor CRM1. J. Cell Sci. 112:2369-2380[Abstract]. |
| 49. |
Roth, J., and M. Dobbelstein.
1997.
Export of hepatitis B virus RNA on a Rev-like pathway: inhibition by the regenerating liver inhibitory factor I B .
J. Virol.
71:8933-8939[Abstract].
|
| 50. | Saavedra, C., B. Felber, and E. Izaurralde. 1997. The simian retrovirus-1 constitutive transport element, unlike the HIV-1 RRE, uses factors required for cellular mRNA export. Curr. Biol. 7:619-628[CrossRef][Medline]. |
| 51. | Schambach, A., H. Wodrich, M. Hildinger, J. Bohne, H. G. Krausslich, and C. Baum. 2000. Context dependence of different modules for posttranscriptional enhancement of gene expression from retroviral vectors. Mol. Ther. 2:435-445[CrossRef][Medline]. |
| 52. | Simpson, S. B., L. Zhang, R. C. Craven, and C. M. Stoltzfus. 1997. Rous sarcoma virus direct repeat cis elements exert effects at several points in the virus life cycle. J. Virol. 71:9150-9156[Abstract]. |
| 53. |
Stutz, F., and M. Rosbash.
1998.
Nuclear RNA export.
Genes Dev.
12:3303-3319 |
| 54. | Tabernero, C., A. S. Zolotukhin, J. Bear, R. Schneider, G. Karsenty, and B. K. Felber. 1997. Identification of an RNA sequence within an intracisternal-A particle element able to replace Rev-mediated posttranscriptional regulation of human immunodeficiency virus type 1. J. Virol. 71:95-101[Abstract]. |
| 55. | Tabernero, C., A. S. Zolotukhin, A. Valentin, G. N. Pavlakis, and B. K. Felber. 1996. The posttranscriptional control element of the simian retrovirus type 1 forms an extensive RNA secondary structure necessary for its function. J. Virol. 70:5998-6011[Abstract]. |
| 56. |
Weigel, S., and M. Dobbelstein.
2000.
The nuclear export signal within the E4orf6 protein of adenovirus type 5 supports virus replication and cytoplasmic accumulation of viral mRNA.
J. Virol.
74:764-772 |
| 57. | Welker, R., A. Janetzko, and H. G. Krausslich. 1997. Plasma membrane targeting of chimeric intracisternal A-type particle polyproteins leads to particle release and specific activation of the viral proteinase. J. Virol. 71:5209-5217[Abstract]. |
| 58. | Wen, W., J. L. Meinkoth, R. Y. Tsien, and S. S. Taylor. 1995. Identification of a signal for rapid export of proteins from the nucleus. Cell 82:463-473[CrossRef][Medline]. |
| 59. | Wodrich, H., and H.-G. Kraeusslich. 2001. Nucleocytoplasmic RNA transport in retroviral replication. Results Probl. Cell Differ. 34:197-217[Medline]. |
| 60. |
Wodrich, H.,
A. Schambach, and H. G. Krausslich.
2000.
Multiple copies of the Mason-Pfizer monkey virus constitutive RNA transport element lead to enhanced HIV-1 Gag expression in a context-dependent manner.
Nucleic Acids Res.
28:901-910 |
| 61. |
Wu, M.,
S. Chari,
T. Yanchis, and A. Mergia.
1998.
cis-acting sequences required for simian foamy virus type 1 vectors.
J. Virol.
72:3451-3454 |
| 62. |
Yang, J.,
H. P. Bogerd,
S. Peng,
H. Wiegand,
R. Truant, and B. R. Cullen.
1999.
An ancient family of human endogenous retroviruses encodes a functional homolog of the HIV-1 Rev protein.
Proc. Natl. Acad. Sci. USA
96:13404-13408 |
| 63. | Yoon, D. W., H. Lee, W. Seol, M. DeMaria, M. Rosenzweig, and J. U. Jung. 1997. Tap: a novel cellular protein that interacts with Tip of herpesvirus saimiri and induces lymphocyte aggregation. Immunity 6:571-582[CrossRef][Medline]. |
| 64. | Zang, W. Q., and T. S. Yen. 1999. Distinct export pathway utilized by the hepatitis B virus posttranscriptional regulatory element. Virology 259:299-304[CrossRef][Medline]. |
| 65. |
Zolotukhin, A. S.,
A. Valentin,
G. N. Pavlakis, and B. K. Felber.
1994.
Continuous propagation of RRE( ) and Rev( )RRE( ) human immunodeficiency virus type 1 molecular clones containing a cis-acting element of simian retrovirus type 1 in human peripheral blood lymphocytes.
J. Virol.
68:7944-7952 |
| 66. |
Zufferey, R.,
J. E. Donello,
D. Trono, and T. J. Hope.
1999.
Woodchuck hepatitis virus posttranscriptional regulatory element enhances expression of transgenes delivered by retroviral vectors.
J. Virol.
73:2886-2892 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»