Previous Article | Next Article 
Journal of Virology, November 2001, p. 10612-10622, Vol. 75, No. 22
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.22.10612-10622.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Structural Analysis of the
1 Ribosomal
Frameshift Elements in Giardiavirus mRNA
Lei
Li,
Alice L.
Wang, and
Ching C.
Wang*
Department of Pharmaceutical Chemistry,
School of Pharmacy, University of California San Francisco, San
Francisco, California 94143-0446
Received 11 May 2001/Accepted 13 August 2001
 |
ABSTRACT |
The RNA polymerase of giardiavirus (GLV) is synthesized as a fusion
protein through a
1 ribosomal frameshift in a region where
gag and pol open reading frames (ORFs) overlap.
A heptamer, CCCUUUA, and a potential pseudoknot found in the
overlap were predicted to be required for the frameshift. A
68-nucleotide (nt) cDNA fragment containing these elements was inserted
between the GLV 5' 631-nt cDNA and the out-of-frame luciferase gene
that required a
1 frameshift within the 68-nt fragment for
expression. Giardia lamblia trophozoites transfected with
the transcript of this construct showed a frameshift frequency at
1.7%, coinciding with the polymerase-to-capsid protein ratio in GLV.
The heptamer is required for the frameshift but can be replaced with
other sequences of the same motif. Mutations placing stop codons in the
0 or
1 frame, located directly before or after the heptamer,
implicated the latter as the site for the
1 frameshift. Shortening or
destroying the putative stem decreased the frameshift efficiency
threefold; the efficiency was fully recovered by mutations to restore
the stem. Deleting 18 nt from the 3' end of the 68-nt fragment, which
formed the second stem in the putative pseudoknot, had no effect on the
frequency of the frameshift. Chemical probing of the RNA secondary
structure in the frameshift region showed that bases resistant to
chemical modification were clustered in the putative stem structures,
thus confirming the presence of the postulated stem-loop, while all the
bases in the loop were chemically modified, thus ruling out their
capability of forming a pseudoknot. These results confirmed the
conclusion based on data from the mutation study that there is but a
simple stem-loop downstream from the heptamer. Together, they
constitute the structural elements for a
1 ribosomal frameshift in
the GLV transcript.
 |
INTRODUCTION |
Although faithful reading of open
reading frames (ORFs) in mRNA is most critical for the production of
functional proteins, programmed ribosomal frameshifts have been
increasingly reported as the means of regulating gene expression
(2, 11, 13). An efficient
1 ribosomal frameshift is one
of such examples of a programmed posttranscriptional regulation of gene
expression. In response to certain specific structural signals in the
mRNA, the ribosomes are induced to slip back 1 nucleotide (nt) at a fixed frequency, move into the
1 reading frame at a specific site in
the mRNA, and continue translating the rest of the mRNA in the
1
frame (19, 20).
Many viruses are known to depend on this mechanism of
1 ribosomal
frameshift to generate the RNA polymerase gene (pol) product in the form of a fusion protein (Gag-Pol) with the capsid protein (Gag)
at its N terminus and polymerase (Pol) at its C terminus (2). The production of Gag and Gag-Pol at a fixed ratio
during translation enables the inclusion of RNA polymerase in the
assembled virus particles at a constant level (42). This
inclusion, in turn, makes it possible for continuous replication and
transcription of the viral genome inside viral particles within the
infected cells.
The
1 ribosomal frameshift was first observed in the retrovirus Rous
sarcoma virus, in which the viral polymerase was translated from two
overlapping gag and pol ORFs requiring a
1
ribosomal frameshift within the overlapping region (20).
This phenomenon of the
1 ribosomal frameshift has since been observed
among translations of gene transcripts from a large number of viruses
(2), certain Escherichia coli genetic insertion
elements (11), and a conventional cellular dnaX
gene from E. coli (35, 36). The structural
motifs in mRNA that are important for an efficient
1 ribosomal
frameshift have been characterized in several viral systems primarily
by in vitro translation assays (2, 7, 13). Two structural components have been confirmed to induce such activity. A homopolymeric "slippery" heptamer sequence (X XXY YYZ) is required,
where XXX can be any three identical nucleotides, YYY can be either AAA or UUU, and Z can be A, U, or C (4, 8, 9). The second component consists of a stem-loop or a pseudoknot, which is defined as
two intertwined stem-loops where a region in the first loop forms base
pairs with a downstream sequence to produce a second stem
(32). A pseudoknot is essential for the
1 ribosomal
frameshift in infectious bronchitis virus (IBV) (3, 5),
human coronavirus (16), and yeast killer virus (ScV/L-A)
(7). However, among other viruses including human
immunodeficiency virus (HIV) (29), human T-cell leukemia
virus type 2 (10), human astrovirus serotype 1 (23), potato leaf roll virus (30), and red
clover necrotic mosaic virus (21), a pseudoknot is
apparently not essential for the
1 ribosomal frameshift. All that is
required is a slippery heptamer and a stem-loop located a few
nucleotides downstream from it.
Giardiavirus (GLV) is a small (36-nm diameter) icosahedral virus of the
Totiviridae family that specifically infects the
trophozoites of Giardia lamblia, an anaerobic protozoan that
causes diarrhea and malnutrition in human (26, 38, 39).
Its 6,277-nt double-stranded RNA genome contains gag and
pol-like ORFs that overlap by 220 nt and are separated by a
1 frameshift (40). Immunostudies with antipeptide sera
targeted to regions in the respective ORFs indicated that the 100-kDa
capsid protein is encoded by ORF1. They also showed that the N terminus
of the 190-kDa GLV minor protein is encoded by ORF1 while its C
terminus has all the consensus sequence motifs of the
RNA-dependent RNA polymerase (RDRP) family. The 190-kDa protein is
therefore most probably a Gag-Pol fusion protein produced by a
1
ribosomal frameshift that is predicted to occur in the 220-nt
overlapping region (40). Within this region, we found a
putative slippery heptamer, CCCUUUA, at nt 2836 to 2842 and
a downstream stem-loop structure at nt 2848 to 2876 as predicted by
MFOLD (25). A potential second stem could be also formed
between the GAUC at nt 2860 to 2863 in the loop and the downstream GAUC
at nt 2885 to 2888 (see Fig. 1), resulting in a pseudoknot
(32). Together, they were predicted to constitute the
structural requirements for the ribosomal
1 frameshift that lead to
the formation of the GLV Gag-Pol fusion protein (40).
To verify this assumption, a 68-bp cDNA fragment from nt 2828 to 2895 of the GLV genome containing the two postulated frameshift structural
motifs was inserted in front of an out-of-frame luciferase gene in a
GLV-based viral vector, pC631-luc (44). This construct requires a
1 frameshift within the 68-nt region for luciferase expression, and the efficiency of the
1 ribosomal frameshift can then
be determined by monitoring the luciferase activity in transfected,
GLV-infected Giardia trophozoites. We made a large number of
mutants with site-directed mutations in the 68-nt region to examine the
function of the postulated heptamer and the putative downstream
pseudoknot. RNA bases in this putative frameshift region were also
probed by chemical modifications to reveal the secondary structures in
this region. Results from these two lines of studies helped to
delineate the structural requirements for inducing a
1 ribosomal
frameshift in the GLV transcript.
 |
MATERIALS AND METHODS |
Construction of the recombinant cDNA plasmids.
Based on the
GLV genome sequence (GenBank accession number L13218), three primers,
each having a HindIII site (underlined) at the 5' end,
were synthesized; fs1, TGGCAAGCTTTGGTACTCAGACAC; fs2, AAAGCTTTGTGTAGGATCCC; and fs3,
AAAGCTTCTGTGTAGGATCCC. Using pGEM-GLV, which
contains the full-length GLV cDNA (44), as the template,
fs1 and fs2 were included in PCR for synthesis of the 68-nt cDNA
fragment (nt 2828 to 2895), whereas fs1 and fs3 were used for
synthesizing the same cDNA fragment with an extra G added to the 3' end
(a 69-nt cDNA fragment). The 68- and 69-nt PCR fragments were then each
inserted into the HindIII-restricted pC631-luc vector
(44) between the 5' 631-nt GLV cDNA and the
full-length luciferase gene to constitute pC631(68)luc or pC631(69)luc.
The orientation and the fidelity of each fragment were determined by
DNA sequencing. The ORFs in both fragments are fused with that of the
5' 631-nt GLV cDNA. However, the luciferase gene in pC631(68)luc is out
of frame and requires a
1 frameshift for its expression, whereas the
pC631(69)luc is an in-frame construct.
In vitro site-directed mutagenesis of the recombinant
plasmid.
Site-directed mutagenesis was performed with QuickChange
as directed by the manufacturer (Life Technologies BRL). For each mutation, two complementary oligonucleotide primers were synthesized with the intended mutation introduced in the midportion of each primer.
The PCR-synthesized mutant DNA fragment was amplified in E. coli DH5
cells and purified. Each specific mutation was verified by directly sequencing the cloned mutant plasmid.
In vitro synthesis of chimeric RNA.
Wild-type and mutant
plasmids were each restricted with NruI at the 3' end of the
GLV cDNA. In vitro transcription of each linearized plasmid with T7 RNA
polymerase was performed in a 20-µl reaction mixture containing 0.5 µg of linearized plasmid DNA as described by the manufacturer
(Ambion). The RNA thus synthesized was purified by LiCl precipitation
and examined by electrophoresis in a 1.0% agarose-formaldehyde gel
for integrity. The concentration of each RNA sample was estimated by
measuring its absorption at 260 nm in a Beckman DU7 spectrophotometer.
Transfection of G. lamblia trophozoites and
luciferase assay.
In vitro culture of GLV-infected G. lamblia WB trophozoites (WBI) was maintained as described
previously (38). Serial passages of the in vitro culture
were performed at an inoculation ratio of 1:13 every 3 days into fresh
medium to maintain a continuous logarithmic cell growth. Transfection
of Giardia trophozoites with RNA was performed by
electroporation, and assay of the luciferase activity in the lysate of
transfectants was performed as previously described (45).
Probing the RNA structure by chemical modification and primer
extension.
The RNA molecule used for chemical probing was the in
vitro transcript of pC631(68)luc. It was prepared using a T7 RNA
polymerase kit (MegaScript from Ambion) and the
NruI-restricted pC631(68)luc as template. The RNA was
quantified by spectrophotometry, and its integrity was checked by
electrophoresis on a 1% agarose-formaldehyde gel. Approximately 5 µg of the in vitro-synthesized RNA was used in each reaction mixture
containing either 0.5% dimethyl sulfate (DMS), 21 mg of
1-cyclohexyl-3-(2-morpholinoethyl)-carbodiimide (CMCT) per ml, or 3.5 mg of kethoxal (KE) per ml as previously described (12).
Prior to the probing analysis, the RNA was heated at 70°C for 15 min
and cooled slowly to room temperature over a 45-min period in a
200-µl nondenaturing probing buffer, HMK (80 mM HEPES-KOH [pH 7.8],
10 mM MgCl2, 270 mM KCl). The reaction mixtures were
incubated at 37°C for 0, 10, and 20 min. The reactions with
the DMS and CMCT modifications were terminated by adding 75 µl of the
stop buffer (1 M Tris-acetate [pH 7.5], 1 M
-mercaptoethanol, 1.5 M sodium acetate, 0.1 mM EDTA). The KE modification was stabilized by
adding 0.5 volume of 250 mM potassium borate (pH 7.0). Chemically modified RNA was precipitated by adding 3 volumes of 100% ethanol.
Sites of RNA modification were mapped by primer extension using the
reverse transcriptase Superscript (Life Technologies BRL) with
radiolabeled oligonucleotides targeted to the region either 22 nt
downstream from stem-loop 1 or 31 nt downstream from stem-loop 2 (see
Fig. 4). Briefly, 32P-end-labeled primers were annealed to
approximately 1 µg of the chemically modified RNA by incubating the
mixture for 15 min at 75°C followed by 10 min on ice. Primer
extension was carried out at 50°C for 1 h as specified by the
manufacturer. Reaction products were analyzed on a 10% denaturing
acrylamide gel along with sequencing ladders prepared by the fmol
cycle-sequencing system (Promega).
 |
RESULTS |
In vivo efficiency of the
1 ribosomal frameshift mediated by the
68-nt fragment in the ORF overlapping region of GLV mRNA.
The RNA
transcript of pC631(68)luc or pC631(69)luc was introduced into
Giardia WBI trophozoites by electroporation, and the luciferase activity in the cell lysates of the two transfectants was
monitored. Since the in vitro transcript from pC631(69)luc contained
only one continuous ORF, the luciferase activity found in the lysate of
its transfectant, which demonstrated a specific activity of
408,890 ± 71,250 relative light units (RLU)/25 µg of protein in
repeated independent experiments, is defined as 100% luciferase
expression (Table 1). In comparison, the
luciferase activity in the lysate of Giardia trophozoites
transfected with the in vitro transcript of pC631(68)luc was 6,768 ± 608 RLU/25 µg of protein and constituted 1.7% of that of the
in-frame construct pC631(69)luc (Table 1). Since luciferase
expression in the pC631(68)luc transcript transfectant relies on the
1 ribosomal frameshift in the 68-nt overlapping region, the results
indicate that this 68-nt fragment in mRNA is indeed capable of causing
1 ribosomal frameshift at a frequency of 1.7%.
Identification of the site for the
1 ribosomal frameshift.
If the postulated heptamer CCCUUUA is indeed one of the
structural elements causing the frameshift, then it would also be the
site of the frameshift as predicted by the widely accepted simultaneous-slippage model (19). By site-directed
mutagenesis, we placed stop codon UAA in 0 frame at nt 2831 to 2833, 2843 to 2845, 2846 to 2848, 2879 to 2881, or 2891 to 2893 in
pC631(68)luc (Fig. 1). If the
1
ribosomal frameshift indeed occurs on top of the heptamer, the first
UAA upstream from it in the 0 frame is expected to disrupt luciferase
expression whereas the other four downstream stop codons in the 0 frame
will no longer be read as stop codons and should not significantly
affect luciferase expression. Our data derived from corresponding
transfectants of the mutant transcripts (Fig.
2) indicate that the first UAA caused a
precipitous drop in luciferase expression to 8.6% ± 1.7% of the
wild-type frequency of the frameshift or 0.15% of the expression by
the in-frame construct pC631(69)luc, while the other four 0 frame stop
codons downstream of the heptamer showed luciferase expression at
37.8% ± 8.4%, 52.1% ± 6.0%, 57.3% ± 3.1%, and 72.3% ± 4.0%
of the wild-type frameshift frequency (Fig. 2; Table 1). A
negative-control pC631(69R)luc, which has the 69-nt fragment reversed
and thus lacks the structural features of the 69-nt fragment, showed
8.2% ± 4.0% of the wild-type frameshift frequency or 0.13% ± 0.06% of the in-frame expression. This value is thus regarded as the
noise or background in our assay system.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 1.
The two overlapping ORFs in GLV mRNA. The shaded box
represents the 68-nt region within the 220-nt overlap containing the
putative structures required for the 1 ribosomal frameshift, which is
detailed below. The underlined heptamer is the putative slippery
sequence. The stem-loop secondary structure is predicted by MFOLD. The
two GAUC regions (linked by dashed lines) may be involved in the
formation of an RNA pseudoknot structure.
|
|

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 2.
Mutational analysis via generation of stop codons in
different reading frames at different locations to identify the
slippery site of 1 ribosomal frameshift. The putative slippery
heptamer CCCUUUA sequence is underlined. The predicted
peptide sequences in the 0 and 1 frames are shown in the one-letter
amino acid code. Individual termination codons in either the 0 frame or
the 1 frame are created by site-directed mutagenesis. The luciferase
activities expressed in the mutant transcript transfectants were
determined from three independent experiments, with data within 10% of
experimental error. The frequencies of the 1 ribosomal frameshift
relative to the wild-type frequency (100%) in the mutant transfectants
are each shown at the corresponding position of the termination codon
(see Table 1 for actual data).
|
|
We further examined the question in an opposite way. When a stop codon
is introduced into the

1 frame, one would expect that
codons placed
upstream from the site of frameshift will cause
little disruption
whereas those placed downstream from the shift
will have a significant
effect. Figure
2 indicates that UAA at
nt 2833 to 2835 upstream
from the heptamer has a frequency 53.8%
± 1.0% of that of the
wild-type frameshift whereas a UGA at nt
2845 to 2847 and a UAA at nt
2887 to 2889, both downstream from
the heptamer, lead to 17.9% ± 6.2% and 9.6% ± 5.0% frequencies,
i.e., nearly the background level
of the frameshift (see Table
1).
Data from Fig.
2 and Table
1 thus provide a strong indication that a

1 ribosomal frameshift may indeed occur at the putative
slippery
heptamer site CCCUUUA between nt 2836 and 2842 in GLV
mRNA.
To find if the sequence of this particular heptamer is unique
in
causing a

1 translation frameshift in
Giardia, we replaced
it with a slippery heptamer UUUUUUA identified previously in
HIV
(
19) and an engineered UUUUUUU which showed
excellent frameshifting
activity in vitro in a previous study
(
4).
Giardia trophozoites
transfected with each
of the mutant transcripts indicated that
UUUUUA and
UUUUUUU led to 131.2% ± 10.7% and 433.9% ± 40.6% of
the wild-type frequency of frameshift, respectively, both of which
significantly exceeded the effect from the original heptamer in
GLV
mRNA. Thus, heptamers functioning well in causing

1 ribosomal
frameshift in mammalian cells also worked well in
Giardia
trophozoites.
The advantage in retaining a less efficient slippery
heptamer
in the mRNA by GLV is not entirely clear. One possible
explanation
is the need for a rigid molar ratio between the RDRP and
the capsid
protein in the viral particles for stable maintenance of the
virus
inside
Giardia cells, such as that observed in yeast
killer virus
(
9).
While the CCCUUUA sequence identified in GLV mRNA conforms
to the generally accepted structural rule for a slippery heptamer
(
4,
8,
9), alteration of individual nucleotides in the
heptamer invariably reduces the frequency of the frameshift but
never
abolishes it. For instance, CCCUAUA led to 60% of the
wild-type
frameshift frequency whereas UCCUUUA, CCCAUUA, and
CCCUUUG led
to 78, 85, and 98% of the frameshift frequency,
respectively (data
not shown). Thus, although some of the heptamers may
be more slippery
for the ribosome than are the others, depending on the
nucleotide
sequences, there may not be an absolutely non-slippery
heptamer.
Initiation of a ribosomal frameshift may be dependent
primarily
on the presence of a ribosome-blocking secondary structure
downstream
from the
heptamer.
A simple stem-loop structure, but not a pseudoknot, constitutes the
second structural element for the
1 ribosomal frameshift on GLV
mRNA.
The heptamer and a putative pseudoknot-like structure were
previously identified within the overlapping region between
gag and pol ORFs in GLV mRNA (Fig. 1)
(40). To verify whether the putative second stem formation
between the two GAUC tetranucleotides at nt 2860 to 2863 and 2885 to
2888 in the 68-nt region is essential for the frameshift (Fig. 1), we
altered the sequence at nt 2860 to 2863 from GAUC to CUAG to eliminate
the possible pseudoknot formation from the transcript. The resulting
mutant retained 70.8% ± 2.5% of the wild-type frameshift frequency,
suggesting that the putative pseudoknot structure is not essential for
the frameshift. To further confirm this conclusion, an 18-nt deletion
from the 3' end of the 68-nt fragment was performed on the encoding
cDNA, which also removed the downstream GAUC tetranucleotide involved in the putative pseudoknot formation. The transfectant containing such
a mutant mRNA demonstrated 93.8% ± 14.8% of the wild-type frameshift
frequency (Table 1). It is thus clear that neither the pseudoknot
structure nor the 3'-end 18 nt of the 68-nt fragment is needed for the
occurrence of the
1 ribosomal frameshift. The 50-nt fragment from nt
2828 to 2877 in GLV mRNA thus contains both the essential and
sufficient structural elements for the frameshift.
To examine if the loop in the putative stem-loop between nt 2848 and
2876 (Fig.
1) can form a second stem with the downstream
sequences
elsewhere within the 220-nt ORF overlap outside of the
68-nt fragment
that were replaced by the luciferase sequence in
our construct, we
replaced the 68-nt insert in pC631(68)luc with
a fragment including a
215-nt fragment from this 220-nt overlap.
The frameshift frequency was
the same as in pC631(68)luc (data
not shown). It is therefore most
likely that all the structural
elements required for inducing the

1
ribosomal frameshift are
contained within the 50-nt
fragment.
Mutations that shorten the stem in the putative stem-loop in the
68-nt overlapping region decrease the efficiency of the
1 ribosomal
frameshift.
A putative stem-loop at nt 2848 to 2876, consisting of
a 9-bp stem and a loop of 11 nt, is the only secondary structure
predicted by MFOLD (25) in the 68-nt RNA fragment (Fig.
1). To investigate the functional importance of this structure,
mutations to shorten the stem were performed on the encoding cDNA.
Firstly, AUUA at nt 2868 to 2871 from the top part of the stem was
replaced with UAGU, resulting in a shortened stem from 9 to 5 bp and an
enlarged loop from 11 to 19 nt (Fig. 3,
structure 2). The in vivo luciferase activity derived from this mutant
mRNA amounted to 41.8% ± 5.9% of the wild-type frequency of the
frameshift. When the tetranucleotide CGUG (nt 2849 to 2852) at the
bottom of the stem was changed to GCGC, resulting in reducing the stem
to 4 bp and lengthening its distance to the slippery heptamer from 5 to
10 nt, the frameshift frequency was reduced to 38.2% ± 7.7% of the
wild-type frequency (Fig. 3, structure 3). Similarly, a mutation from
CGCG (nt 2872 to 2875) at the bottom of the stem to GUGC, resulting in
a 4-bp stem 10 nt away from the heptamer, changed the frameshift
efficiency to 32.3% ± 4.0% of the wild-type frequency (Fig. 3,
structure 4). The length of the stem is thus playing an important role
in maintaining the efficiency of frameshift. A decrease from 9 to 5 bp
results in a two-third loss of the efficiency. However, a comparison of
the results in Fig. 3 indicates that the distance between the stem-loop
and the slippery heptamer is of somewhat less importance. There is only
a moderate effect on the efficiency of frameshift when it is increased
from 5 to 10 nt. Restoration of the stem back to 9 bp through a
combination of the two previous mutations resulted in a wild-type
frameshift frequency at 102.5% ± 8.8% (Fig. 3, structure 5). These
data demonstrate the important role of the stem-loop structure in
causing the frameshift whereas the actual nucleotide sequences in the
stem structure are apparently less important. Further, our earlier
alteration of the loop sequence at nt 2860 to 2863 from GAUC to CUAG,
which resulted in a 70.8% ± 2.5% frameshift efficiency compared to
the wild type, suggested a lack of importance of the actual nucleotide
sequence of the loop as well. We thus conclude that it is the stem-loop
secondary structure per se that plays an important function in inducing the frameshift (Table 1).

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 3.
Alteration of the putative stem-loop structure
downstream from the slippery site by site-directed mutagenesis and
assay of the effect from the alteration on the 1 ribosomal
frameshift. The five transcripts used for transfecting
Giardia trophozoites are as follows: 1, wild type; 2, the
AUUA/uagu mutant at nt 2868 to 2871 that shortens the stem from its top
by 4 bp and enlarges the loop from 11 to 19 nt without altering its
distance from the slippery heptamer; 3, the CGUG/gcgc mutant at nt 2849 to 2852 that shortens the stem from its bottom by 5 bp and increases
its distance from the slippery heptamer from 5 to 10 nt without
altering the loop; 4, the CGUG/gcgc mutant at nt 2872 to 2875 that
shortens the stem from its bottom by 5 bp and increases its distance
from the slippery heptamer to 10 nt without altering its loop
structure; and 5, the double mutant of CGUC/gcgc (nt 2849 to 2852) and
CGCG/gugc (nt 2872 to 2875) that restored the wild-type stem structure
with altered nucleotide sequence. The upper panel presents relative
frequencies of the 1 ribosomal frameshift derived from luciferase
expression in mutant transcript-transfected Giardia
trophozoites in triplicate experiments (see Table 1 for actual data).
|
|
In a final experiment to verify the essential role played by the
stem-loop in causing the frameshift, we deleted the sequence
from nt
2848 to 2877 that contains the entire stem-loop structure.
Surprisingly, the expression of luciferase amounted to 85.5% ±
8.6%
of the wild-type frameshift frequency. Subsequent analysis
by the MFOLD
program revealed that, serendipitously, a new stem-loop
is formed
between nucleotides at the 3' end of the 68-nt fragment
and the 5'
terminus of the luciferase mRNA. It has a 6-bp stem
and a 14-nt loop
located 4 nt downstream from the first stem-loop
(Fig.
4). On deletion of the wild-type
stem-loop, the downstream
stem-loop acquires an additional 1 bp at the
bottom of the stem
to form a 7-bp stem that is 7 nt downstream from the
slippery
heptamer (Fig.
4). This distance is within the functional
range
that we found with our mutants in Fig.
3 (structures 3 and 4).
The functional competence of this serendipitous stem-loop, which
was an
artifact in the chimeric mRNA from pC631(68)luc, nevertheless
confirms
our conclusion that it is the structure of the stem-loop,
and not the
sequence therein, that is important in inducing the
frameshift.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 4.
RNA secondary structure predicted by MFOLD on deletion
of the first stem-loop structure between nt 2848 and 2876 (stem-loop
1). A 30-bp fragment from nt 2848 to 2877 in the 68-nt region was
deleted by site-directed mutagenesis, thus removing stem-loop 1 predicted by MFOLD. The downstream second stem-loop structure
predicted between nt 2880 and 2907 (stem-loop 2) in the deletion mutant
including the first luciferase codon AUG at the base of the stem
contains a 7-bp stem and is 7 nt downstream from the slippery site. The
relative frequency of the 1 ribosomal frameshift is not significantly
changed from that of the wild type in the mutant transcript
transfectant (see Table 1 for actual data). Bold type represents the
sequence from GLV mRNA, whereas normal type represents the sequence
from the luciferase mRNA.
|
|
For the sake of clarity, the actual luciferase activities expressed by
transfectants from all the in vivo mutational analysis
discussed above
are summarized in Table
1.
Probing the secondary structures in the 68-nt region by chemical
modifications.
In an attempt to verify the actual secondary
structures in the 68-nt RNA fragment under native conditions, we made a
4.6-kb T7 RNA polymerase transcript from pC631(68)luc linearized by
NruI. We treated this RNA, containing the GLV 5' 631-nt RNA,
the 68-nt frameshift region, and the entire coding region of the
luciferase, with KE, DMS, or CMCT to modify the unpaired bases that are
accessible to alkylation by these agents. KE modifies unpaired G
residues at the N-1 position. DMS methylates unpaired A residues at N-1 and, much more weakly, the unpaired C residues at N-3, whereas CMCT
modifies the N-3 group of unpaired U residues and the N-1 group of
unpaired G residues (12). The bases thus modified can no
longer be recognized by reverse transcriptase in a primer extension reaction, and each can be identified as a reverse transcriptase stop in
subsequent gel electrophoresis (27, 33). A modified base
in RNA can be thus readily identified. The oligonucleotide terminating
at the modified base moves 1 nt ahead of the corresponding DNA ladder,
because primer extension stops immediately before the modified
base. Thus, we can expect relatively few stops in stems where the bases
are aligned in Watson-Crick pairs and much more stops in loops and
unpaired regions free of base-base interaction. The radiolabeled stops
often differ in their intensities, presumably due to a partial
dissociation among some of the Watson-Crick pairings during the
incubation period of chemical probing. The relatively poor efficiency
in DMS modification of unpaired C residues also makes unlabeled C's
less meaningful in data interpretation.
Results from a chemical probing and primer extension experiment on the
in vitro transcript of pC631(68)luc are shown in Fig.
5. When the chemically
modified region involving the heptamer
and the first putative stem-loop
(stem-loop 1) was examined by
primer extension (Fig.
5A), bases in the
heptamer and its immediate
surrounding areas all showed up as
transcriptional stops, suggesting
that they were all chemically
modified. In the region of loop
1, essentially all of the nucleotides
were also modified (Fig.
5A). This finding, suggesting that all the
bases in the heptamer
and loop 1 are unpaired, provides the most direct
evidence verifying
the secondary structure predicted by MFOLD (Fig.
1).
It also rules
out the potential involvement of GAUC (nt 2860 to 2863)
in loop
1 in forming a pseudoknot as originally postulated in Fig.
1.
Regions predicted to form stem 1 (nt 2848 to 2856 and 2868 to
2876)
were found largely free of chemical modification except
for G-2854,
A-2855, and UUA (nt 2869 to 2871), which all form
the weaker G-U or A-U
pairs in the postulated stem structure,
raising the possibility that
these base pairs may become partially
dissociated during the chemical
probing reactions (
24). G-2850,
G-2852, and G-2875 in stem
1 became lightly labeled after prolonged
treatment with KE, which could
be attributed to partial denaturation
of the stem structure on
incubation. Taken together, the results
lend strong support to our
conclusion from the MFOLD program and
the mutational analysis of the
predicted secondary structure of
stem-loop 1.


View larger version (147K):
[in this window]
[in a new window]
|
FIG. 5.
Chemical probings of the pC631(68)luc transcript and
structural analysis of the 68-nt frameshift region by primer extension.
Chemical modifications of A and C (by DMS), U (by CMCT), and G (by KE)
were monitored by reverse transcription using end-labeled primers
complementary to the nucleotides either 22 nt downstream of the last
residue of stem-loop 1 (A) or 31 nt downstream of the last U residue of
stem-loop 2 (B). The durations of incubation in each chemical reaction
are indicated in minutes above each lane of gel electrophoresis. The
left side of the gel labeled CUAG at the top represents the
corresponding sequencing ladder of the cDNA. Arrows indicate
transcriptional stops from primer extension representing the chemically
modified bases in the treated RNA molecule, which migrate at a distance
1 nt short of that in the corresponding DNA ladder.
|
|
We also examined the region in the transcript which encompasses the 3'
end of the 68-nt fragment and the 5' end of the luciferase
mRNA in
search of the serendipitous stem-loop structure (stem-loop
2) predicted
from MFOLD and the mutational analysis (Fig.
4).
Results from primer
extension presented in Fig.
5B show that all
the bases in the predicted
loop 2 region were modified except
for the three C's at nt 2888 to
2889 and 2899. However, bases
in the postulated stem 2 structure
remained largely unmodified,
except for G-2985, 2 U's at nt 2901 to
2902, A-2905, and U-2906,
all of which are involved in A-U or G-U
pairings (Fig.
6). The
tetranucleotide
GAUC (nt 2885 to 2888), which was originally assumed
to be a part of
the pseudoknot structure (Fig.
1), has the G and
U residues chemically
modified. However, since the first two nucleotides,
GA, in the
tetranucleotide are actually included in the stem 2
structure and
unpaired C is usually poorly modified by DMS, the
present results are
more consistent with the inclusion of this
tetranucleotide in the
stem-loop 2 structure rather than in a
pseudoknot formation (see
Discussion). Overall, data from chemical
probing have verified the
presence of the artifact stem-loop 2
in the chimeric mRNA transcribed
from pC631(68)luc.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 6.
Summary of the results of primer extension on chemically
modified RNA presented in Fig. 5. For the 68-nt frameshift region in
GLV mRNA and the downstream 17-nt sequence of the luciferase mRNA,
bases clearly modified by various chemicals are shown by large
arrowheads. Chemical modifications becoming only gradually detectable
with incubation time are indicated by small arrowheads. The numbers
indicate the nucleotide positions relative to the 5' end of GLV RNA.
Bold type represents the sequence in GLV mRNA, whereas normal type
indicates the sequence in luciferase mRNA.
|
|
 |
DISCUSSION |
A programmed
1 ribosomal frameshift is adopted by many small RNA
viruses to generate viral RNA polymerase (Gag-Pol) as fusion protein
with the capsid protein (Gag) at its N terminus and RDRP at the C
terminus (reviewed in reference 2). Not only does this strategy ensure
that Gag and Gag-Pol proteins are synthesized at a fixed ratio during
translation, but also the presence of the Gag domain in the fusion
protein provides a recognition signal for the RNA polymerase to be
incorporated into the newly assembled virus at a fixed ratio
(31). GLV apparently also uses the same strategy, which
has an estimated ratio of about 1 in 60 between the Gag-Pol
fusion protein and the Gag protein in sodium dodecyl sulfate-polyacylanide gel electophoresis of purified GLV particles (40), which is in close agreement with the 1.7%
frameshift frequency estimated from the present study. Among the
viruses that depend on the
1 ribosomal frameshift for a well-balanced
viral protein synthesis, their transcripts have the common structural
elements of the slippery heptamer but differ in the structure of a
second requirement. Some viruses, such as IBV (3, 5) and
ScV/L-A (7), need the structure of a pseudoknot, while
others, such as HIV (29, 43), require only a simple
stem-loop. Our studies showed that the
1 ribosomal frameshift in GLV
transcript translation also requires a slippery heptamer where the
actual frameshift takes place but that only a simple downstream
stem-loop, rather than a pseudoknot, is required for inducing the
shift. This conclusion has been supported by two original observations
from the mutational studies. First, a mutation changing nt 2860 to 2863 in loop 1, the tetranucleotide postulated to be involved in a
pseudoknot formation (Fig. 1), from GAUC to CUAG did not significantly
affect the frequency of the frameshift (Table 1). This suggests that the tetranucleotide is not involved in forming a pseudoknot that plays
an important role in inducing ribosomal frameshift. Second, there is
support from the MFOLD identification of stem-loop 2 in the chimeric
mRNA (Fig. 4), which is formed serendipitously by joining the 5'
luciferase sequence with the 3' end of the 68-nt fragment. This
postulated artifact stem-loop can function at 86% of the wild-type
efficiency when brought into the proximity of the heptamer by deleting
stem-loop 1 (Fig. 4; Table 1). Since stem-loop 2 contains a loop
sequence that cannot form a predicted pseudoknot with the rest of the
sequences of the mRNA, a pseudoknot is again ruled out as a requirement
for the frameshift. The presence of stem-loops 1 and 2 in the chimeric
mRNA was subsequently confirmed by the data from chemical probing and
primer extension experiments (Fig. 5). The extensive chemical
modifications of essentially all the bases in the two loop regions also
indicate that neither loop forms a pseudoknot with another sequence in
the mRNA under the native in vitro conditions. There is thus little
doubt that no pseudoknot is present in the region where frameshift
takes place and that there is no need of for pseudoknot to cause the frameshift.
There could be always some doubt about whether observations made on a
chimeric mRNA can fully represent the
1 ribosomal frameshift occurring during translation of GLV mRNA in GLV-infected
Giardia. The downstream sequences from the region of
frameshift differ widely between the chimeric and GLV mRNA. There is no
stem-loop 2 structure predicted within this proximal region in GLV mRNA (data not shown). The presence of an extra stem-loop 2 in the chimeric
mRNA may amount to a frameshift enhancer element forcing a translating
ribosome to pause and the following ribosome to stack behind it at the
frameshift signal, resulting in an increased amount of time required
for ribosome slipping. This ribosome stacking has been shown to have an
effect on programmed
1 frameshift frequencies (22).
However, we do not think that there is a discrepancy in frameshift
frequency between the chimeric and GLV mRNA because of the estimated
ratio of 2% between the Gag-Pol fusion protein and the Gag protein in
sodium dodecyl sulfate-polyacrylanide gel electrophoresis analysis of
purified GLV particles (40), which is quite close to the
1.7% frequency derived from the investigation on chimeric mRNA. The
stoichiometry of Gag and Gag-Pol maintained by a 1.7% frameshift
frequency also closely agrees with the prediction that in a small
icosahedral virion such as GLV, RDRP is expected to be packaged with
identical capsid subunits at a ratio of 1:60 (15).
There is also the possibility that some downstream sequence in GLV
mRNA, which is absent from the chimeric mRNA, could form a pseudoknot
with loop 1 resulting in enhancement of the frameshift frequency. This
enhancing effect could compensate for the enhancement attributed
to the artifact stem-loop 2 in the chimeric mRNA that is absent
from GLV mRNA. Existing evidence does, however, argue against such a
possibility; an extension of the 68-nt fragment to a 215-nt portion of
the 220-nt overlapping region between the two ORFs in GLV mRNA failed
to alter the frequency of frameshift in the chimeric mRNA transfected
Giardia. Formation of a pseudoknot between loop 1 and its
immediate downstream viral sequence that could enhance the frameshift
is therefore unlikely. Although pseudoknot formation between loop 1 and
the sequences further downstream in the viral mRNA is still possible,
the probability decreases with increasing distance. We think that our
current results obtained from studying the chimeric mRNA in
Giardia reflect accurately the
1 ribosomal frameshift on
GLV mRNA during its translation.
We also showed in this study that all the necessary structural features
for a
1 ribosomal frameshift in GLV transcript could be confined
within a 50-nt fragment (from nt 2828 to 2877) (Fig. 1). This short
fragment of mRNA contains a CCCUUUA heptamer, where the
actual
1 frameshift takes place, and a stem-loop 1 5 nt downstream from the heptamer, which presumably retards the movement of the ribosome during mRNA translation and allows a
1-nt slippage of ribosome on the slippery heptamer site of mRNA (14, 20).
The heptamer CCCUUUA can be replaced with other heptamers,
resulting in changed frameshift frequencies in the deceasing order of
UUUUUUU, UUUUUUC, and CCCUUUA. A similar order of
decreasing frameshift efficiencies was also observed by Brierley et al.
in the IBV system (4), suggesting a hierarchy of
efficiency that is innate to the sequences of these heptamers
regardless of the viruses or the host cells involved.
Studies of the sites of frameshift in plant viruses and retroviruses
have shown that stop codons located within the frameshift region can
influence the frameshift efficiency (1, 14, 19, 21, 28).
In this work, a termination codon placed before the heptamer but in the
1 frame showed 53.8% of the wild-type frameshift frequency. This was
consistent with the results obtained by Honda and Nishimura
(17), where an upstream stop codon in the
1 frame before
the slippery site suppressed the frameshift by about 50%. Three stop
codons in the 0 frame downstream from the heptamer also have lower
framshift efficiencies, at 52.1, 57.3, and 72.3% of the wild-type
efficiency respectively (Fig. 2). A plausible explanation for the
decreased frameshift could be attributed to the nonsense-mediated mRNA
decay pathway (6, 34), even though it is not yet known
whether such a pathway exists in a lineage as ancient as
Giardia. The repressive effect also appeared to be
decreasing as the stop codons were placed farther away from the
heptamer (41). The stop codon placed at nt 2843 to 2845 in
the 0 frame at the immediate 3' end of the heptamer (Fig. 2) reduced
the ribosomal frameshifting to 37.8%. A stop codon placed at the same
location in HIV (18) repressed the frameshift by the
prokaryote ribosome to a similar extent. Most interestingly, the
recoding event was further depressed when the level of the peptide
release factors (RF) in vivo was increased, directly linking the
decrease in frequency of frameshift with the recruitment of RF by the
termination codon (37). It remains to be determined whether repression of the frameshift is also mediated by RF in our case.
In summary, we have succeeded in using the experimental approaches of
site-directed mutagenesis and chemical modifications of mRNA to dissect
the structural basis of the programmed
1 ribosomal frameshift during
translation of GLV mRNA in Giardia. The conclusion, indicating the mere requirement of a heptamer and a downstream stem-loop in the ORF overlapping region, provides to our knowledge the
first example of such a mechanism of frameshifting among totiviruses.
 |
ACKNOWLEDGMENTS |
We thank Srinivas Garlapati for instructions on how to perform
chemical probings of RNA.
This work was supported by grant AI-30475 from the National Institutes
of Health.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Pharmaceutical Chemistry, School of Pharmacy, University of California San Francisco, San Francisco, CA 94143-0446. Phone: (415) 476-1321. Fax: (415) 476-3382. E-mail: ccwang{at}cgl.ucsf.edu.
 |
REFERENCES |
| 1.
|
Brault, V., and W. A. Miller.
1992.
Translational frameshifting mediated by a viral sequence in plant cells.
Proc. Natl. Acad. Sci. USA
89:2262-2266[Abstract/Free Full Text].
|
| 2.
|
Brierley, I.
1995.
Ribosomal frameshifting viral RNAs.
J. Gen. Virol.
76:1885-1892[Abstract/Free Full Text].
|
| 3.
|
Brierley, I.,
P. Digard, and S. C. Inglis.
1989.
Characterization of an efficient coronavirus ribosomal frameshifting signal: requirement for an RNA pseudoknot.
Cell
57:537-547[CrossRef][Medline].
|
| 4.
|
Brierley, I.,
A. J. Jenner, and S. C. Inglis.
1992.
Mutational analysis of the "slippery-sequence" component of a coronavirus ribosomal frameshifting signal.
J. Mol. Biol.
227:463-479[CrossRef][Medline].
|
| 5.
|
Brierley, I.,
N. J. Rolley,
A. J. Jenner, and S. C. Inglis.
1991.
Mutational analysis of the RNA pseudoknot component of a coronavirus ribosomal frameshifting signal.
J. Mol. Biol.
220:889-902[CrossRef][Medline].
|
| 6.
|
Culbertson, M. R.
1999.
RNA surveillance. Unforeseen consequences for gene expression, inherited genetic disorders and cancer.
Trends Genet.
15:74-80[CrossRef][Medline].
|
| 7.
|
Dinman, J. D.
1995.
Ribosomal frameshifting in yeast viruses.
Yeast
11:1115-1127[CrossRef][Medline].
|
| 8.
|
Dinman, J. D.,
T. Icho, and R. B. Wickner.
1991.
A 1 ribosomal frameshift in a double-stranded RNA virus of yeast forms a gag-pol fusion protein.
Proc. Natl. Acad. Sci. USA
88:174-178[Abstract/Free Full Text].
|
| 9.
|
Dinman, J. D., and R. B. Wickner.
1992.
Ribosomal frameshifting efficiency and gag/gag-pol ratio are critical for yeast M1 double-stranded RNA virus propagation.
J. Virol.
66:3669-3676[Abstract/Free Full Text].
|
| 10.
|
Falk, H.,
N. Mador,
R. Udi,
A. Panet, and A. Honigman.
1993.
Two cis-acting signals control ribosomal frameshift between human T-cell leukemia virus type II gag and pro genes.
J. Virol.
67:6273-6277[Abstract/Free Full Text].
|
| 11.
|
Farabaugh, P. J.
1996.
Programmed translational frameshifting.
Microbiol. Rev.
60:103-134[Free Full Text].
|
| 12.
|
Garlapati, S.,
J. Chou, and C. C. Wang.
2001.
Specific secondary structures in the capsid-coding region of Giardiavirus transcript are required for its translation in Giardia lamblia.
J. Mol. Biol.
308:623-638[CrossRef][Medline].
|
| 13.
|
Gesteland, R. F., and J. F. Atkins.
1996.
Recoding: dynamic reprogramming of translation.
Annu. Rev. Biochem.
65:741-768[CrossRef][Medline].
|
| 14.
|
Gramstat, A.,
D. Prufer, and W. Rohde.
1994.
The nucleic acid-binding zinc finger protein of potato virus M is translated by internal initiation as well as by ribosomal frameshifting involving a shifty stop codon and a novel mechanism of P-site slippage.
Nucleic Acids Res.
22:3911-3917[Abstract/Free Full Text].
|
| 15.
|
Harrison, S. C.
1984.
Multiple modes of subunit associationin the structures of simple spherical viruses.
Trends Biochem. Sci.
9:345-351[CrossRef].
|
| 16.
|
Herold, J., and S. G. Siddell.
1993.
An `elaborated' pseudoknot is required for high frequency frameshifting during translation of HCV 229E polymerase mRNA.
Nucleic Acids Res.
21:5838-5842[Abstract/Free Full Text].
|
| 17.
|
Honda, A., and S. Nishimura.
1996.
Suppression of translation frameshift by upstream termination codon.
Biochem. Biophys. Res. Commun.
221:602-608[CrossRef][Medline].
|
| 18.
|
Horsfield, J. A.,
D. N. Wilson,
S. A. Mannering,
F. M. Adamski, and W. P. Tate.
1995.
Prokaryotic ribosomes recode the HIV-1 gag-pol-1 frameshift sequence by an E/P site post-translocation simultaneous slippage mechanism.
Nucleic Acids Res.
23:1487-1494[Abstract/Free Full Text].
|
| 19.
|
Jacks, T.,
M. D. Power,
F. R. Masiarz,
P. A. Luciw,
P. J. Barr, and H. E. Varmus.
1988.
Characterization of ribosomal frameshifting in HIV-1 gag-pol expression.
Nature
331:280-283[CrossRef][Medline].
|
| 20.
|
Jacks, T., and H. E. Varmus.
1985.
Expression of the Rous sarcoma virus pol gene by ribosomal frameshifting.
Science
230:1237-1242[Abstract/Free Full Text].
|
| 21.
|
Kim, K. H., and S. A. Lommel.
1994.
Identification and analysis of the site of 1 ribosomal frameshifting in red clover necrotic mosaic virus.
Virology
200:574-582[CrossRef][Medline].
|
| 22.
|
Lopinski, J. D.,
J. D. Dinman, and J. A. Bruenn.
2000.
Kinetics of ribosomal pausing during programmed 1 translational frameshifting.
Mol. Cell. Biol.
20:1095-1103[Abstract/Free Full Text].
|
| 23.
|
Marczinke, B.,
A. J. Bloys,
T. D. Brown,
M. M. Willcocks,
M. J. Carter, and I. Brierley.
1994.
The human astrovirus RNA-dependent RNA polymerase coding region is expressed by ribosomal frameshifting.
J. Virol.
68:5588-5595[Abstract/Free Full Text].
|
| 24.
|
Marczinke, B.,
R. Fisher,
M. Vidakovic,
A. J. Bloys, and I. Brierley.
1998.
Secondary structure and mutational analysis of the ribosomal frameshift signal of Rous sarcoma virus.
J. Mol. Biol.
284:205-225[CrossRef][Medline].
|
| 25.
|
Mathews, D. H.,
J. Sabina,
M. Zuker, and D. H. Turner.
1999.
Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure.
J. Mol. Biol.
288:911-940[CrossRef][Medline].
|
| 26.
|
Miller, R. L.,
A. L. Wang, and C. C. Wang.
1988.
Purification and characterization of the Giardia lamblia double-stranded RNA virus.
Mol. Biochem. Parasitol.
28:189-195[CrossRef][Medline].
|
| 27.
|
Moazed, D.,
S. Stern, and H. F. Noller.
1986.
Rapid chemical probing of conformation in 16S ribosomal RNA and 30S risosomal subunits using primer extension.
J. Mol. Biol.
187:399-416[CrossRef][Medline].
|
| 28.
|
Morikawa, S., and D. H. Bishop.
1992.
Identification and analysis of the gag-pol ribosomal frameshift site of feline immunodeficiency virus.
Virology
186:389-397[CrossRef][Medline].
|
| 29.
|
Parkin, N. T.,
M. Chamorro, and H. E. Varmus.
1992.
Human immunodeficiency virus type 1 gag-pol frameshifting is dependent on downstream mRNA secondary structure: demonstration by expression in vivo.
J. Virol.
66:5147-5151[Abstract/Free Full Text].
|
| 30.
|
Prufer, D.,
E. Tacke,
J. Schmitz,
B. Kull,
A. Kaufmann, and W. Rohde.
1992.
Ribosomal frameshifting in plants: a novel signal directs the 1 frameshift in the synthesis of the putative viral replicase of potato leafroll luteovirus.
EMBO J.
11:1111-1117[Medline].
|
| 31.
|
Ribas, J. C., and R. B. Wickner.
1998.
The Gag domain of the Gag-Pol fusion protein directs incorporation into the L-A double-stranded RNA viral particles in Saccharomyces cerevisiae.
J. Biol. Chem.
273:9306-9311[Abstract/Free Full Text].
|
| 32.
|
ten Dam, E. B.,
C. W. Pleij, and L. Bosch.
1990.
RNA pseudoknots: translational frameshifting and readthrough on viral RNAs.
Virus Genes
4:121-136[CrossRef][Medline].
|
| 33.
|
Stern, S.,
D. Moazed, and H. F. Noller.
1998.
Structural analysis of RNA using chemical and enzymatic probing monitored by primer extension.
Methods Enzymol.
164:481-489.
|
| 34.
|
Sun, X.,
X. Li,
P. M. Moriarty,
T. Henics,
J. P. LaDuca, and L. E. Maquat.
2001.
Nonsense-mediated decay of mRNA for the selenoprotein phospholipid hydroperoxide glutathione peroxidase is detectable in cultured cells but masked or inhibited in rat tissues.
Mol. Biol. Cell
12:1009-1017[Abstract/Free Full Text].
|
| 35.
|
Tsuchihashi, Z., and P. O. Brown.
1992.
Sequence requirements for efficient translational frameshifting in the Escherichia coli dnaX gene and the role of an unstable interaction between tRNA(Lys) and an AAG lysine codon.
Genes Dev.
6:511-519[Abstract/Free Full Text].
|
| 36.
|
Tsuchihashi, Z., and A. Kornberg.
1990.
Translational frameshifting generates the gamma subunit of DNA polymerase III holoenzyme.
Proc. Natl. Acad. Sci. USA
87:2516-2520[Abstract/Free Full Text].
|
| 37.
|
Tumer, N. E.,
B. A. Parikh,
P. Li, and J. D. Dinman.
1998.
The pokeweed antiviral protein specifically inhibits Ty1-directed +1 ribosomal frameshifting and retrotransposition in Saccharomyces cerevisiae.
J. Virol.
72:1036-1042[Abstract/Free Full Text].
|
| 38.
|
Wang, A. L., and C. C. Wang.
1986.
Discovery of a specific double-stranded RNA virus in Giardia lamblia.
Mol. Biochem. Parasitol.
21:269-276[CrossRef][Medline].
|
| 39.
|
Wang, A. L., and C. C. Wang.
1991.
Viruses of the protozoa.
Annu. Rev. Microbiol.
45:251-63[CrossRef][Medline].
|
| 40.
|
Wang, A. L.,
H. M. Yang,
K. A. Shen, and C. C. Wang.
1993.
Giardiavirus double-stranded RNA genome encodes a capsid polypeptide and a gag-pol-like fusion protein by a translation frameshift.
Proc. Natl. Acad. Sci. USA
90:8595-8599[Abstract/Free Full Text].
|
| 41.
|
Weiss, R. B.,
D. M. Dunn,
M. Shuh,
J. F. Atkins, and R. F. Gesteland.
1989.
E. coli ribosomes re-phase on retroviral frameshift signals at rates ranging from 2 to 50 percent.
New Biol.
1:159-169[Medline].
|
| 42.
|
Wickner, R. B.
1996.
Double-stranded RNA viruses of Saccharomyces cerevisiae.
Microbiol. Rev.
60:250-265[Free Full Text].
|
| 43.
|
Yelverton, E.,
D. Lindsley,
P. Yamauchi, and J. A. Gallant.
1994.
The function of a ribosomal frameshifting signal from human immunodeficiency virus-1 in Escherichia coli.
Mol. Microbiol.
11:303-313[CrossRef][Medline].
|
| 44.
|
Yu, D.-C.,
A. L. Wang, and C. C. Wang.
1996.
Amplification, expression, and packaging of a foreign gene by giardiavirus in Giardia lamblia.
J. Virol.
70:8752-8757[Abstract].
|
| 45.
|
Yu, D.-C.,
A. L. Wang,
C.-H. Wu, and C. C. Wang.
1995.
Virus-mediated expression of firefly luciferase in the parasitic protozoan Giardia lamblia.
Mol. Cell. Biol.
15:4867-4872[Abstract].
|
Journal of Virology, November 2001, p. 10612-10622, Vol. 75, No. 22
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.22.10612-10622.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Nibert, M. L.
(2007). '2A-like' and 'shifty heptamer' motifs in penaeid shrimp infectious myonecrosis virus, a monosegmented double-stranded RNA virus. J. Gen. Virol.
88: 1315-1318
[Abstract]
[Full Text]
-
Garlapati, S., Wang, C. C.
(2005). Structural Elements in the 5'-Untranslated Region of Giardiavirus Transcript Essential for Internal Ribosome Entry Site-Mediated Translation Initiation. Eukaryot Cell
4: 742-754
[Abstract]
[Full Text]
-
Li, L., Wang, C. C.
(2004). Capped mRNA with a Single Nucleotide Leader Is Optimally Translated in a Primitive Eukaryote, Giardia lamblia. J. Biol. Chem.
279: 14656-14664
[Abstract]
[Full Text]
-
Garlapati, S., Wang, C. C.
(2004). Identification of a Novel Internal Ribosome Entry Site in Giardiavirus That Extends to Both Sides of the Initiation Codon. J. Biol. Chem.
279: 3389-3397
[Abstract]
[Full Text]
-
Chen, C., Montelaro, R. C.
(2003). Characterization of RNA Elements That Regulate Gag-Pol Ribosomal Frameshifting in Equine Infectious Anemia Virus. J. Virol.
77: 10280-10287
[Abstract]
[Full Text]