Previous Article | Next Article ![]()
Journal of Virology, November 2001, p. 10573-10581, Vol. 75, No. 22
ENEA, Divisione Biotecnologie e Agricoltura,
C. R. Casaccia, 00060 Rome,1 and
Istituto di Fitovirologia Applicata, CNR, 10135 Turin,2 Italy
Received 24 May 2001/Accepted 13 August 2001
We have previously shown that transgenic expression of a truncated
C1 gene of Tomato yellow leaf curl Sardinia virus (TYLCSV), expressing the first 210 amino acids of the replication-associated protein (T-Rep) and potentially coexpressing the C4 protein, confers resistance to the homologous virus in Nicotiana benthamiana
plants. In the present study we have investigated the role of T-Rep and C4 proteins in the resistance mechanism, analyzing changes in virus
transcription and replication. Transgenic plants and protoplasts were
challenged with TYLCSV and the related TYLCSV Murcia strain (TYLCSV-ES[1]). TYLCSV-resistant plants were susceptible to
TYLCSV-ES[1]; moreover, TYLCSV but not TYLCSV-ES[1] replication was
strongly inhibited in transgenic protoplasts as well as in wild-type
(wt) protoplasts transiently expressing T-Rep but not the C4 protein. Viral circular single-stranded DNA (cssDNA) was usually undetectable in
transgenically and transiently T-Rep-expressing protoplasts, while
viral DNAs migrating more slowly than the cssDNA were observed. Biochemical studies showed that these DNAs were partial duplexes with
the minus strand incomplete. Interestingly, similar viral DNA forms
were also found at early stages of TYLCSV replication in wt N. benthamiana protoplasts. Transgenically expressed T-Rep repressed
the transcription of the GUS reporter gene up to 300-fold when fused to
the homologous (TYLCSV) but not to the heterologous (TYLCSV-ES[1]) C1
promoter. Similarly, transiently expressed T-Rep but not C4 protein
strongly repressed GUS transcription when fused to the C1 promoter of
TYLCSV. A model of T-Rep interference with TYLCSV
transcription-replication is proposed.
Geminiviruses are a family of plant
viruses possessing a small genome of either one or two circular
single-stranded DNAs (cssDNAs) of about 2.8 kb packaged in geminate
particles (44). They replicate in the nucleus through a
double-stranded intermediate using a rolling-circle replication (RCR)
mechanism (44, 48). Following infection and uncoating of
the viral genome, the complementary minus-strand DNA is synthesized on
the cssDNA; this process is believed to be entirely under the control
of host-encoded proteins. The new double-stranded circular DNA is also
assembled in a minichromosome (41) and acts as a template
for bidirectional gene expression directed by divergent promoters
present on the intergenic region (IR) of the viral genome (49,
50). The RCR requires a site-specific nick on the plus-strand of
the DNA to prime synthesis of the plus-sense cssDNA. In the geminiviral
genome the nick ( Rep, which is encoded by open reading frame (ORF) C1 (also called AL1
or AC1 in geminiviruses with bipartite genomes), is a multifunctional
protein involved in viral replication (12, 13, 16, 32),
autoregulation of its own gene transcription (9, 51), and
activation and recruitment of host-encoded proteins related to host DNA
synthesis (35). Rep is the only viral protein that is
absolutely required for viral replication (10, 11); genetic and biochemical studies have shed light on the functions of its
different domains. The amino-terminal domain mediates (i) virus-specific origin of DNA replication and transcriptional repression (4, 5, 15, 25) and (ii) the nicking and joining activity required for initiation and termination of plus-strand DNA synthesis (19, 39). The central portion of Rep has a role in
oligomerization (39), while the carboxy-terminal portion
contains a nucleoside triphosphate (NTP)-binding domain required for
viral replication (7, 18).
The C1 gene of geminiviruses infecting dicotyledonous plants contains
in a different frame the small ORF C4. Mutation of ORF C4 impacts viral
movement of monopartite but not bipartite geminiviruses in a
host-dependent fashion (24, 42, 43), possibly by altering the ability to induce host replication machinery (29). The
C4 protein of bipartite Tomato golden mosaic virus (TGMV)
weakly represses the transcription of the C1 gene (8).
We have previously shown that expression in Nicotiana
benthamiana and Lycopersicon esculentum plants of a
truncated C1 gene of Tomato yellow leaf curl Sardinia virus
(TYLCSV), encoding the first 210 amino acids (aa) of the Rep protein
(T-Rep) and potentially coexpressing the C4 protein, confers resistance
to TYLCSV (2, 36). Using a Nicotiana tabacum
transient expression system, we showed that inhibition of TYLCSV
replication can be achieved by expressing T-Rep and presented indirect
evidence that the internal ORF C4 does not inhibit TYLCSV replication
(36). T-Rep contains the domains involved in specific
recognition of its own origin of replication (ori)
(25) and in nicking and joining (19) but it
lacks the nucleoside triphosphate (NTP)-binding domain required for
viral replication (7).
To investigate the molecular mechanism of T-Rep-mediated interference
and to establish the role of C4 protein, we used N. benthamiana stably or transiently expressing T-Rep and C4. We have
analyzed the effects of expressing these proteins on viral transcription and replication. We show that T-Rep is alone responsible for the resistance and acts as a trans-dominant-negative
mutant by repressing TYLCSV C1 gene transcription and viral replication and inducing accumulation of a heterogeneous population of partially duplex cssDNA possessing incomplete minus strands.
Virus resistance assays in plants.
Transgenic plants were
agroinoculated with Agrobacterium tumefaciens strains
LBA4404/pBin19/TYLCV (27) and LBA4404/pBin19/SP98 (37), containing the infectious clone of TYLCSV and TYLCSV
Murcia strain (TYLCSV-ES[1]), respectively. For the sake of brevity, TYLCSV-ES[1] will hereafter be called ES[1]. After inoculation, plants were observed for disease symptoms and assayed weekly by tissue
print assay, essentially as described (36). Membranes were
hybridized with a digoxigenin-labeled capsid protein-specific probe.
Plasmid constructs. (i) TYLCSV gene expression vectors.
The
plant expression vectors pTOM100 and pTOM100NT have been described
(36); both can potentially express C4 protein from the
overlapping ORF C4, but only pTOM100 can express T-Rep. The putative
expression of the C4 protein from the internal ATG codon in both
pTOM100 and pTOM100NT will be indicated hereafter as C4?. Plasmid
pTOM100C4( (ii) GUS reporter vectors.
The transcriptional reporter
plasmids pIntS/GUS and pIntS-ES[1]/GUS, containing the GUS ORF under
the control of the TYLCSV or ES[1] complementary-sense promoter,
respectively, were constructed as follow. The
BamHI-SacI fragment of pBI121 (22),
encompassing the GUS gene, was cloned in pSP65 (Promega), and the
filled-in EcoRI-SmaI fragment of this subclone
was introduced into SalI-digested and filled-in pJIT61
(obtained from pJIT60 by removal of the SacI site upstream
the E35S promoter), producing pJIT61GUS. A fragment encompassing the
TYLCSV complementary-sense promoter was PCR amplified from pTOM6 using
primers TTTTGCTGTCGTTCTGAATC (nucleotides [nt] 2615 to
2634) and CACGAATGACGGAGATGAGA (nt 278 to 297). Similarly, a
fragment encompassing the ES[1] complementary-sense promoter was PCR
amplified from pSP97 (a 1.8-mer of ES[1] in pBluescript SK)
(37) using primers TTGGTCAATGGGTACCAATTGAC (nt
2620 to 2642) and TGCAAGCATACAACGGAGAC (nt 192 to 211). The
PCR products were digested with BamHI (generating fragments
with one BamHI extremity and the other blunt-ended) and
cloned in HincII-BamHI-digested pGEM4Z (Promega).
The KpnI-PstI fragments of these subclones were then cloned in the corresponding sites of pJIT61GUS (replacing the
Cauliflower mosaic virus [CaMV] 35S promoter
sequence) to obtain pIntS/GUS and pIntS-ES[1]/GUS. pTOM202 is a
translational fusion construct carrying the TYLCSV complementary-sense
promoter (nt 2606 to 152) fused to the GUS gene
(NcoI-HindIII fragment from pV668 (kindly
provided by J. M. Bonneville, Grenoble, France) in pUC118. Its
translation product consisted of the first five amino acids of Rep and
six additional residues derived from the cloning procedure fused to the
GUS protein sequence.
Replication assays in protoplasts.
N. benthamiana
protoplasts were isolated as described (34), and 5 × 105 protoplasts were used for each transfection, with 2 µg of the viral infectious clone (pTOM6 or pSP97); cotransfections
were obtained using 1 µg of either pTOM6 or pSP97 together with 5 µg of one of the TYLCSV gene expression vectors. Transfected
protoplasts were grown in the dark at 24°C in K3 medium
(38) containing vancomycin and cefotaxime (50 µg/ml
each). Transfections were performed in duplicate or triplicate in at
least three independent experiments.
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.22.10573-10581.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Transgenically Expressed T-Rep of Tomato Yellow
Leaf Curl Sardinia Virus Acts as a trans-Dominant-Negative
Mutant, Inhibiting Viral Transcription and Replication
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
) has been mapped to the conserved sequence
TAATATT
AC in the IR (31, 47) and is introduced by the
viral replication-associated protein (Rep), which remains covalently
linked to the 5' end of the original plus-strand, while the 3' hydroxyl
is used to start plus-strand cssDNA synthesis (30).
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
) was derived from pTOM100 by introducing a stop codon in
ORF C4 without altering the amino acid sequence of T-Rep. A premature
TGA stop codon, truncating the C4 protein after 9 amino acids, was
created by a C-to-G mutation at position 339 of the complementary
strand of TYLCSV (27); a C-to-T change at position 337 restored a leucine codon in the overlapping sequence of T-Rep.
Site-directed mutagenesis was performed by PCR using Pfu DNA
polymerase (Stratagene) (20). The template for the PCRs was pGEM102, obtained by subcloning the
EcoRI-BamHI fragment of pTOM100 in pGEM4Z
(Promega). Two PCRs were primed with the following oligonucleotide
pairs: C4plus
(CTCATCTCCATATTTTGATCCAATTCGAAG) and
M13/pUC sequencing primer
47; C4minus
(CTTCGAATTGGATCAAAATATGGAGATGAG) and
M13/pUC reverse sequencing primer
48. Bold letters indicate introduced mutations. The two overlapping PCR fragments obtained were
mixed and used as templates for a PCR with the external M13/pUC
47
and
48 primers. This PCR product was digested with EcoRI and BamHI, and the resulting fragment was cloned in pJIT60
(kindly provided by P. Mullineaux), giving pTOM100C4(
). Plasmids
pTOM120 and pTOM120C4(
) were constructed as follows: pTOM100 and
pTOM100C4(
) were digested with EcoRI and subsequently
partially digested with SacI, recovering the 4,030-bp
fragments. The SacI-BglII fragment of TYLCSV from
pTOM6 (a dimeric clone of TYLCSV in the SacI site of
pBluescript SK) was cloned in SacI-BamHI-digested
pBluescript SK (Stratagene), and the SacI-EcoRI
fragment of this subclone was ligated into the
EcoRI-SacI 4,030-bp fragment from pTOM100 or
pTOM100C4(
), obtaining pTOM120 and pTOM120C4(
), respectively. Plasmids pTOM111 and pTOM110 are two different constructs for expression of C4 protein; they contain the C4 ORF from the first ATG
(position 2463 of the complementary strand of TYLCSV) and from the
second ATG (position 2457), respectively. C4 coding sequences were
obtained by PCR from pGEM102 (see above), using the M13/pUC sequencing
primer
47 in association with SarC4leader
(AAACAATGGGGAACCTCATCTCCATAT) for pTOM110 or with
SarC4leader1 (ACAAAAATGAAAATGGGGAACCTCATCTC) for pTOM111.
PCR products were digested with EcoRI, generating fragments
with an EcoRI and a blunt-ended extremity, which were cloned
in EcoRI-PstI-blunt-ended pJIT60.
Characterization of viral DNA forms. TNAs extracted from transfected N. benthamiana protoplasts were subjected to one of the following treatments and analysed by Southern blotting, as described above unless otherwise stated.
(i) Treatment with proteinase K. From 400 to 800 ng of TNAs was incubated in 10 mM Tris-HCl (pH 8.0)-5 mM EDTA-0.5% sodium dodecyl sulfate with 8.4 µg of proteinase K (Losung-Boehringer Mannheim) in a final volume of 50 µl at 56°C for 1 h. An additional 50 µl of buffer containing 8.4 µg of proteinase K was then added, and incubation was continued for 1 h. TNAs were then extracted with phenol-chloroform and ethanol precipitated.
(ii) Denaturation with alkali. TNAs (1 µg) were incubated in 20 µl of 50 mM NaOH at 37°C for 30 min, neutralized with 2 µl of 0.5 N HCl, and buffered with 2.5 µl of 1 M Tris-HCl (pH 8.0). TNAs were then purified through Microcon 100 (Millipore). Blots were hybridized with the digoxigenin-labeled TYLCSV C1 sense RNA probe (minus probe) and reprobed with a digoxigenin-labeled C1 antisense RNA probe (plus probe).
(iii) T4 DNA polymerase reactions. Samples were appropriately diluted to contain similar amounts of viral DNA, and the amounts of TNAs were equalized by adding TNAs from wt N. benthamiana protoplasts. Reactions were carried out at 37°C for 30 min in a final volume of 20 µl containing 400 ng of TNAs, 100 µM each dNTP, and 2 U of T4 DNA polymerase (Boehringer Mannheim) in the incubation buffer supplied, then the concentration of each dNTP was brought to 200 µM, and incubation was prolonged for another 30 min. Reactions were stopped at 75°C for 15 min.
(iv) Taq DNA polymerase reactions. Samples were diluted as described above for T4 DNA polymerase reactions. Reactions were carried out at 72°C for 5 or 10 min in a final volume of 20 µl containing 400 ng of TNAs, 250 µM each dNTP, and 0.5 U of Taq DNA polymerase (Qiagen) in the incubation buffer supplied. Reactions were stopped by adding gel-loading buffer.
Transcriptional repression assays. Total proteins were extracted from protoplasts 24 h posttransfection, and GUS activity was determined according to Jefferson et al. (22). Protein concentrations were determined using a Bradford protein assay kit (Bio-Rad), and GUS activity was corrected for protein concentration. For each experiment, background GUS activity of untransfected protoplasts was subtracted. Each construct was assayed in triplicate in at least three independent experiments. Mean values obtained in independent experiments and standard errors of the means were calculated. For analysis of gene expression in the transgenic system, protoplasts were transfected with 10 µg of each GUS reporter construct. GUS activities in transgenic and wt protoplasts were normalized through transfection of both with pJIT61GUS. For each construct, GUS activity in transgenic protoplasts was calculated as a percentage of the activity recorded from transfection of wt protoplasts. For the analysis of gene expression in the transient system, wt protoplasts were cotransfected with 10 µg of pTOM202 together with 10 µg of one of the TYLCSV gene expression vectors or 8.5 µg of pGEM-P, a pGEM7Zf(+) vector (Promega) carrying the E35S promoter; in each case, the molar ratio between the two cotransfected plasmids was 1:1. For each construct, GUS activity was expressed as a percentage of the activity recorded from cotransfection of pTOM202 with pGEM-P. A two-tailed Student's t test was used to compare the mean GUS activities obtained with the various constructs.
| |
RESULTS |
|---|
|
|
|---|
Resistance mechanism operating in 102.22 plants discriminates between two virus strains, acting at single-cell level. Transgenic N. benthamiana plants from line 102.22 (36), expressing T-Rep, were agroinoculated with TYLCSV or with ES[1], and virus infection was monitored weekly. The amino acid sequence identity between TYLCSV and ES[1] individual genes ranges from 80 to 100%, with Rep showing 90% identity (37). In 8 of 11 transgenic plants agroinoculated with TYLCSV, viral infection was delayed at least a week compared to infection on wt N. benthamiana plants. On the contrary, only 1 transgenic plant of the 10 agroinoculated with ES[1] showed a 1-week delay of infection, suggesting that the resistance mechanism operating in 102.22 plants was discriminating between the two strains.
To evaluate the level of inhibition of viral replication, protoplasts were isolated from 102.22 and wt plants and transfected with infectious clones of TYLCSV and ES[1], pTOM6 and pSP97 (Table 1), respectively. TYLCSV replication was inhibited more than 100-fold in 102.22 protoplasts, as assessed by dilution experiments of TNAs of wt protoplasts transfected with pTOM6 (Fig. 1 and data not shown). Moreover, TYLCSV cssDNA was undetectable in 102.22 protoplasts transfected with pTOM6, while a heterogeneous population of viral DNAs migrating slower than cssDNA was repeatedly observed (Fig. 1). Only slight inhibition of ES[1] replication was observed (Fig. 1, panel 1), in agreement with the results of agroinoculations. Interestingly, in one of the six transfection experiments done with pSP97, consistent inhibition of ES[1] replication (about eightfold reduction) coupled with the presence of the slow-migrating DNAs was observed (Fig. 1, panel 2). These data indicate that the resistance in T-Rep plants operates at the single-cell level and that inhibition of viral replication is accompanied by the presence of viral DNAs migrating more slowly than the cssDNA.
|
|
Transient expression of T-Rep but not of C4 protein confers virus
inhibition similar to that in 102.22 transgenic protoplasts.
Wt
N. benthamiana protoplasts were cotransfected with pTOM6 or
pSP97 together with the plant expression vector pTOM100 (Table 1),
which contains the expression cassette used in plant transformation. Transiently expressed T-Rep inhibited replication of TYLCSV but not
ES[1] (Fig. 2); inhibition was coupled
with the presence of slowly migrating DNAs (Fig. 2). These data show
that transient and transgenic expression leads to similar results.
|
) (T-Rep), pTOM110 (only C4, from the second ATG), and pTOM111 (only C4, from the
first ATG). Transiently expressed C4 protein did not inhibit TYLCSV
replication either directly (pTOM110 or pTOM111) or indirectly, by
cooperating with T-Rep (pTOM100) (Fig. 2). In fact pTOM100C4(
)
inhibited TYLCSV replication as well as or even better than pTOM100
(Fig. 2).
Altogether, these results indicate that T-Rep is alone responsible for
inhibiting TYLCSV replication and that inhibition is coupled with the
presence of slowly migrating DNAs.
Slowly migrating DNAs are partial duplexes.
The slowly
migrating DNAs were investigated further. In a first experiment, TNAs
extracted from wt protoplasts cotransfected with pTOM6 and pTOM100 were
hybridized with a minus probe, corresponding to the region of the C1
gene, or a plus probe, corresponding to the V1 gene of TYLCSV. As shown
in Fig. 3A, only the minus probe detected
the slowly migrating DNAs. These results, the migration pattern of the
DNAs, the functional domains present on T-Rep, and the replication
mechanism of geminiviruses suggested that they could be (i) positive
ssDNAs covalently linked to T-Rep or Rep, (ii) positive ssDNAs
longer than unit length, or (iii) partial duplexes. Gel migration
patterns of TYLCSV DNA in T-Rep-expressing protoplasts did not change
after proteinase K treatment (Fig. 3B), excluding the hypothesis of
DNA-protein complexes.
|
)
or pTOM100NT were treated with Taq DNA polymerase for
increasing times (Fig. 4A). Indeed, in
TNAs of wt protoplasts cotransfected with pTOM6 together with
pTOM100C4(
), ocDNAs appeared and the partial duplexes disappeared
following incubation with Taq polymerase. A fraction of
viral DNA from pTOM6-pTOM100NT-cotransfected protoplasts also reacted
with Taq DNA polymerase, generating ocDNA. This fraction was
already present after 5 min of treatment and did not increase after a
further 5 min, indicating that the ocDNA was not generated by enzyme
self-priming. Similarly, only a minor fraction of TYLCSV DNA from
protoplasts transfected with pTOM6 alone reacted with Taq
polymerase, generating ocDNA (Fig. 4A). As mentioned previously, in one
case inhibition of ES[1] replication together with the presence of
slowly migrating DNAs was observed following transfection of transgenic
protoplasts with pSP97. When TNAs of this sample were incubated with T4
DNA polymerase and analyzed by Southern blot (Fig. 4B), the slowly
migrating DNAs were efficiently converted to ocDNA, as in transiently
T-Rep-expressing protoplasts.
|
Viral DNAs accumulating early after transfection of wt protoplasts
with pTOM6 resemble those observed in T-Rep-expressing transfected
ones.
Partially duplex cssDNAs are natural intermediates of RCR.
At 72 h after protoplast transfection with pTOM6, only a fraction of the total viral DNA was in partial duplex form, as shown above (Fig.
4A). Time course experiments showed that TYLCSV amplification reached a
plateau around 72 h posttransfection (data not shown). However,
the ratio between the viral DNA forms would be expected to change
during viral replication. In particular, viral replication intermediates should accumulate at lower levels late in viral replication. Thus, we asked if, early in TYLCSV replication, partial duplexes resembling those observed in T-Rep-expressing protoplasts would accumulate. Figure 5A shows a
Southern blot of TNAs extracted from wt protoplasts at 16, 20, 24, and
72 h posttransfection with pTOM6. Samples at 72 h were diluted
20-fold to give signals of similar intensity on the autoradiography
film. Interestingly, at 20 and 24 h posttransfection, a
heterogeneous class of viral DNAs migrating slower than cssDNA was
observed. Similar results were obtained in four independent
experiments. This pattern clearly resembled that in T-Rep-expressing
protoplasts. To verify the nature of these slowly migrating molecules,
TNAs extracted from the samples at 24 and 72 h were incubated with
Taq DNA polymerase and analyzed by Southern blot (Fig. 5B).
The slowly migrating DNAs present at 24 h were converted into
ocDNA. These data suggest that accumulation of a discrete population of
partial duplexes is an early event in viral replication and does not
require the expression of T-Rep.
|
Both transgenic and transient expression of T-Rep strongly
represses the homologous C1 promoter.
To see if virus resistance
is correlated with the ability of T-Rep to inhibit C1 gene
transcription, 102.22 and wt protoplasts were transfected with
constructs containing the GUS reporter gene coding sequence fused to
the C1 promoter of TYLCSV or ES[1]. In pTOM202, a GUS gene cassette
was fused in frame to the fifth codon of the TYLCSV C1 gene,
whereas in pIntS/GUS and pIntS-ES[1]/GUS, the untranslated
C1 leader sequences of TYLCSV and ES[1], respectively, were
transcriptionally fused to a GUS gene cassette (Table 1). All the
constructs contained the complete viral IR. In wt protoplasts, GUS
activity of pIntS/GUS was about 15-fold less than that observed with
pTOM202 (Fig. 6A). In transgenic
protoplasts, the GUS activity of pIntS/GUS and pTOM202 was repressed
83- and 333-fold, respectively, compared with the activity in wt
protoplasts, while only a 1.3-fold reduction of activity was observed
with the pIntS-ES[1]/GUS construct (Fig. 6A). These results show that
the TYLCSV but not ES[1] C1 promoter was strongly repressed in T-Rep
transgenic protoplasts.
|
) (T-Rep), pTOM110 (C4),
pTOM120 (Rep + C4), pTOM120C4(
) (Rep), or pGEMp (negative control).
The TYLCSV C1 promoter was repressed by pTOM100 and pTOM120 77- and
53-fold, respectively. Repression of GUS activities by pTOM100 and
pTOM120 were not statistically different when compared by the Student
t test (P > 0.1). C4 protein did not
inhibit GUS activity either directly (pTOM110) or indirectly by
cooperating with T-Rep or Rep [pTOM100C4(
) and
pTOM120C4(
)]. On the contrary, pTOM100C4(
) repressed the C1
promoter fourfold more than pTOM100. The fourfold difference in GUS
repression was statistically significant (P < 0.0001).
However, no statistical difference in GUS activity (P > 0.1) was shown between pTOM120 and pTOM120C4(
). The overall results of these experiments suggest that T-Rep was a powerful and
specific inhibitor of the TYLCSV C1 promoter and was the only viral
protein responsible for the tight C1 transcriptional repression displayed in transgenic protoplasts.
| |
DISCUSSION |
|---|
|
|
|---|
Our data show that TYLCSV-resistant 102.22 plants are susceptible
to ES[1] and that a direct correlation exists between the virus
resistance specificity in plants and the ability of single transgenic
cells to strongly inhibit TYLCSV but not ES[1] replication. We also
showed that inhibition of viral replication is characterized by reduced
levels or absence of cssDNAs and concomitant appearance of a
heterogeneous class of DNAs migrating more slowly than cssDNA. These
data strongly suggest that the mechanism of resistance operating in
transgenic T-Rep-expressing plants acts at the single-cell level
through the repression of viral replication. Moreover, we showed that
the C4 protein, directly expressed using an enhanced CaMV 35S promoter,
is not able to inhibit TYLCSV replication and that pTOM100C4(
),
expressing only T-Rep, represses TYLCSV amplification even better than
pTOM100, expressing T-Rep and potentially the C4 protein (Fig. 2).
The bona fide ability of a transient expression system to mimic what happens in stable transgenics was evident at two different levels. First, both systems showed the same virus specificity. Second, the inhibition of TYLCSV replication was coupled in both systems with the presence of slowly migrating DNAs. Moreover, using the same plant species (N. benthamiana) for both the transient and stable expression assays, we avoided possible misinterpretations due to host-specific behavior of the C1 and C4 proteins. Indeed, TGMV Rep-mediated C1 transcriptional repression was shown to be 10-fold more effective in N. benthamiana than in N. tabacum protoplasts (9), and TYLCSV ORFC4 mutants were able to infect N. benthamiana but not tomato plants (24).
Altogether, these data demonstrate that T-Rep is responsible for the
strong and specific inhibition of viral replication, while the C4
protein, if expressed, has no role in this activity. Supporting this
conclusion, there is preliminary evidence that tomato plants
transformed with the pTOM100C4(
) construct are resistant to TYLCSV
(M. Tavazza and G. P. Accotto, unpublished data).
As mentioned above, a distinctive aspect of the altered viral DNA pattern found in transgenically and transiently T-Rep-expressing protoplasts was the presence of a slowly migrating and heterogeneous population of DNAs. Three orders of evidence clarified the nature of these molecules. First, proteinase K treatment did not increase their mobility (Fig. 3B), and we did not detect a preferential partition of these molecules in the organic-aqueous interphase, as expected for stable DNA-protein complexes (26) (data not shown). Second, alkaline treatment converted them into a sharp band migrating as the cssDNA, which hybridized only with a minus TYLCSV probe; therefore, the hybridization signal cannot derive from denatured scDNA or ocDNA. Third, the in vitro assays with DNA polymerases (Taq, T4, and Pfu; Fig. 4A and 4B and data not shown) showed that, independent of the T-Rep protoplast system used (transgenic or transient expression), the slowly migrating DNAs were converted into ocDNA. The overall data demonstrate that these DNAs are partial duplexes, with the minus strand incomplete and heterogeneous in length, suggesting that they do not derive from interference with nicking and joining activities during virus replication.
The occurrence of partial duplexes is actually expected in the RCR mechanism (44); however, it should be noted that if synthesis of minus-strand DNA proceeds at a constant rate, we should not expect to see a discrete population but rather a smear of partial duplexes migrating between the cssDNA and the ocDNA. Interestingly, time course experiments of TYLCSV replication in wt protoplasts showed that a discrete population of partial duplexes resembling that found in transgenically and transiently T-Rep-expressing protoplasts is abundant in the initial phase of replication. From this, two conclusions can be drawn. First, the presence of partial duplexes in T-Rep-expressing protoplasts does not result from direct interference of T-Rep with complementary-strand synthesis. Second, there are two phases in complementary-strand synthesis, the first phase or the switch between them being rate limiting. The hypothesis of two phase would be in agreement with the presence of heterogeneous RNA/DNA molecules of complementary polarity during African cassava mosaic virus (ACMV) infection (45) and with the minus-strand replication of some bacteriophages (1, 14).
A key element of virus-specific recognition of the viral plus-strand origin is the binding of Rep, through its amino-terminal domain, to an iterative sequence located between the TATA box and the transcription start site of the C1 gene (3, 12, 15). Binding of Rep to the same sequence also mediates virus-specific repression of its own gene (9, 15). Our results show that transgenic protoplasts were able to tightly control TYLCSV but not ES[1] C1 transcription. This is in accordance with the virus-specific inhibition of viral replication at the single-cell level and with the virus-specific resistance observed in plants. Moreover, using a transient-expression system, we showed that T-Rep alone is responsible for the transcriptional repression of C1, while the C4 protein has no role in this activity. These data indirectly suggest that T-Rep is able to bind to the iterative sequence required for viral plus-strand origin.
Truncated Reps of geminiviruses show different abilities to repress C1 gene transcription. The determinants of TGMV Rep-mediated virus-specific transcriptional repression have been mapped to the first 93 amino acids (15), but deletion of as few as 39 residues from the carboxy terminus abolishes in vivo transcriptional repression (17). On the contrary, a truncated version of ACMV Rep containing only the first 57 amino acids is fully active in repressing its own gene transcription (21). Thus, besides the importance of the Rep amino-terminal domain for binding specificity, different Reps appear to require different additional carboxy-terminal portions for a productive interaction with the cis-acting sequences and perhaps with transcription factors in repressing C1 gene transcription.
The ability of T-Rep to repress C1 transcription fivefold more than Rep suggests that the carboxy-terminal part (151 aa) of wt Rep could have a role in downregulating C1 repression. However, when the same proteins were expressed from plasmids potentially coexpressing the C4 protein (pTOM100 and pTOM120), no difference in C1 transcriptional repression was observed. Differences in GUS activities between pIntS/GUS and pTOM202 can be explained by the observation that in pTOM202 the start codon of the GUS gene is in an optimal translational initiation context derived from the untranslated C1 gene leader sequence (23), whereas in pIntS/GUS the same leader sequence is separated from the start codon of the GUS gene by an intervening sequence derived from the cloning procedure. Similarly, an unfavorable translational initiation context occurs in the pIntS-ES[1]/GUS construct.
Our data suggest a model of TYLCSV resistance conferred by T-Rep. After entry into the cell and uncoating of the viral genome, the complementary-sense strand is synthesized on the plus-strand cssDNA, generating double-stranded circular DNA. At this time T-Rep can recognize and bind to the cognate DNA, inhibiting but not abolishing C1 transcription. The limited amount of newly synthesized Rep will not be able to properly synthesize the viral plus-strand, since it will be in competition with T-Rep for utilization of the required sequence; as a result, viral replication will be inhibited. This double action of T-Rep lowers the rate of TYLCSV replication, mimicking the early phase of wt virus infection, characterized by the prevalent accumulation of a discrete population of partial duplexes. We cannot exclude that T-Rep can bind Rep, forming a dysfunctional multimeric complex. However, since Tomato golden mosaic virus (TGMV) Rep can form heterooligomers with Bean golden mosaic virus (BGMV) Rep, but transient expression of TGMV Rep does not inhibit BGMV replication (46), it is unlikely that a mechanism based on T-Rep/Rep dysfunctional multimeric complexes can substantially contribute to the strain-specific resistance observed. The high level of T-Rep required to confer resistance, together with our inability to detect Rep in wt TYLCSV infection (2) and with the evidence that repression of C1 gene transcription close to background level is not able to abolish TYLCSV replication, suggests that a small amount of Rep can efficiently compete with T-Rep. Viral replication and transcriptional repression could require different states of aggregation of Rep (33, 40), and we do not know if T-Rep and Rep have the same ability to form multimeric complexes. However, the ability of geminiviruses to induce posttranscriptional gene silencing (28) should also be considered as an added mechanism to overcome the tight transcriptional repression observed.
| |
ACKNOWLEDGMENTS |
|---|
We thank R. G. Milne for critical reading of the manuscript.
A. Brunetti was the recipient of an Accademia Nazionale dei Lincei fellowship. Supported in part by a grant from the Programma Nazionale di Ricerca, Biotecnologie Avanzate II.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Divisione Biotecnologie e Agricoltura, ENEA C. R. Casaccia, Via Anguillarese 301, Rome CP2400, Italy. Phone: 39-06-30486373. Fax: 39-06-30484808. E-mail: tavazza_m{at}casaccia.enea.it.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Bouche, J. P.,
L. Rowen, and A. Kornberg.
1978.
The RNA primer synthesized by primase to initiate phage G4 DNA replication.
J. Biol. Chem.
253:765-769 |
| 2. | Brunetti, A., M. Tavazza, E. Noris, R. Tavazza, P. Caciagli, G. Ancora, S. Crespi, and G. P. Accotto. 1997. High expression of truncated viral Rep protein confers resistance to tomato yellow leaf curl virus in transgenic tomato plants. Mol. Plant-Microbe Interact. 10:571-579[CrossRef]. |
| 3. | Chatterji, A., U. Chatterji, R. N. Beachy, and C. M. Fauquet. 2000. Sequence parameters that determine specificity of binding of the replication-associated protein to its cognate site in two strains of tomato leaf curl virus-New Delhi. Virology 273:341-350[CrossRef][Medline]. |
| 4. |
Chatterji, A.,
M. Padidam,
R. N. Beachy, and C. M. Fauquet.
1999.
Identification of replication specificity determinants in two strains of tomato leaf curl virus from New Delhi.
J. Virol.
73:5481-5489 |
| 5. | Choi, I. R., and D. C. Stenger. 1995. Strain-specific determinants of beet curly top geminivirus DNA replication. Virology 206:904-912[CrossRef][Medline]. |
| 6. | Dellaporta, S. L., J. Wood, and J. B. Hicks. 1983. A plant DNA minipreparation: version II. Plant Mol. Biol. Rep. 4:19-21. |
| 7. |
Desbiez, C.,
C. David,
A. Mettouchi,
J. Laufs, and B. Gronenborn.
1995.
Rep protein of tomato yellow leaf curl geminivirus has an ATPase activity required for viral DNA replication.
Proc. Natl. Acad. Sci. USA
92:5640-5644 |
| 8. | Eagle, P. A., and L. Hanley-Bowdoin. 1997. cis elements that contribute to geminivirus transcriptional regulation and the efficiency of DNA replication. J. Virol. 71:6947-6955[Abstract]. |
| 9. | Eagle, P. A., B. M. Orozco, and L. Hanley-Bowdoin. 1994. A DNA sequence required for geminivirus replication also mediates transcriptional regulation. Plant Cell. 6:1157-1170[Abstract]. |
| 10. |
Elmer, J. S.,
L. Brand,
G. Sunter,
W. E. Gardiner,
D. M. Bisaro, and S. G. Rogers.
1988.
Genetic analysis of the tomato golden mosaic virus. II. The product of the AL1 coding sequence is required for replication.
Nucleic Acids Res.
16:7043-7060 |
| 11. |
Etessami, P.,
K. Saunders,
J. Watts, and J. Stanley.
1991.
Mutational analysis of complementary-sense genes of African cassava mosaic virus DNA A.
J. Gen. Virol.
72:1005-1012 |
| 12. |
Fontes, E. P.,
P. A. Eagle,
P. S. Sipe,
V. A. Luckow, and L. Hanley-Bowdoin.
1994.
Interaction between a geminivirus replication protein and origin DNA is essential for viral replication.
J. Biol. Chem.
269:8459-8465 |
| 13. |
Fontes, E. P.,
V. A. Luckow, and L. Hanley-Bowdoin.
1992.
A geminivirus replication protein is a sequence-specific DNA binding protein.
Plant Cell.
4:597-608 |
| 14. |
Geider, K.,
E. Beck, and H. Schaller.
1978.
An RNA transcribed from DNA at the origin of phage fd single strand to replicative form conversion.
Proc. Natl. Acad. Sci. USA
75:645-649 |
| 15. | Gladfelter, H. J., P. A. Eagle, E. P. Fontes, L. Batts, and L. Hanley-Bowdoin. 1997. Two domains of the AL1 protein mediate geminivirus origin recognition. Virology 239:186-197[CrossRef][Medline]. |
| 16. |
Hanley-Bowdoin, L.,
J. S. Elmer, and S. G. Rogers.
1990.
Expression of functional replication protein from tomato golden mosaic virus in transgenic tobacco plants.
Proc. Natl. Acad. Sci. USA
87:1446-1450 |
| 17. | Hanley-Bowdoin, L., S. B. Settlage, B. M. Orozco, S. Nagar, and D. Robertson. 1999. Geminiviruses: models for plant DNA replication, transcription, and cell cycle regulation. Crit. Rev. Plant Sci. 18:71-106[CrossRef]. |
| 18. | Hanson, S. F., R. A. Hoogstraten, P. Ahlquist, R. L. Gilbertson, D. R. Russell, and D. P. Maxwell. 1995. Mutational analysis of a putative NTP-binding domain in the replication-associated protein (AC1) of bean golden mosaic geminivirus. Virology 211:1-9[CrossRef][Medline]. |
| 19. |
Heyraud-Nitschke, F.,
S. Schumacher,
J. Laufs,
S. Schaefer,
J. Schell, and B. Gronenborn.
1995.
Determination of the origin cleavage and joining domain of geminivirus Rep proteins.
Nucleic Acids Res.
23:910-916 |
| 20. | Ho, S. N., H. D. Hunt, R. M. Horton, J. K. Pullen, and L. R. Pease. 1989. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51-59[CrossRef][Medline]. |
| 21. |
Hong, Y., and J. Stanley.
1995.
Regulation of African cassava mosaic virus complementary-sense gene expression by N-terminal sequences of the replication-associated protein AC1.
J. Gen. Virol.
76:2415-2422 |
| 22. | Jefferson, R. A., T. A. Kavanagh, and M. W. Bevan. 1987. GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6:3901-3907[Medline]. |
| 23. | Joshi, C. P., H. Zhou, X. Huang, and V. L. Chiang. 1997. Context sequences of translation initiation codon in plants. Plant Mol. Biol. 35:993-1001[CrossRef][Medline]. |
| 24. | Jupin, I., F. De Kouchkovsky, F. Jouanneau, and B. Gronenborn. 1994. Movement of tomato yellow leaf curl geminivirus (TYLCV): involvement of the protein encoded by ORF C4. Virology 204:82-90[CrossRef][Medline]. |
| 25. | Jupin, I., F. Hericourt, B. Benz, and B. Gronenborn. 1995. DNA replication specificity of TYLCV geminivirus is mediated by the amino-terminal 116 amino acids of the Rep protein. FEBS Lett. 362:116-120[CrossRef][Medline]. |
| 26. |
Keeney, S., and N. Kleckner.
1995.
Covalent protein-DNA complexes at the 5' strand termini of meiosis-specific double-strand breaks in yeast.
Proc. Natl. Acad. Sci. USA
92:11274-11278 |
| 27. |
Kheyr-Pour, A.,
M. Bendahmane,
V. Matzeit,
G. P. Accotto,
S. Crespi, and B. Gronenborn.
1991.
Tomato yellow leaf curl virus from Sardinia is a whitefly-transmitted monopartite geminivirus.
Nucleic Acids Res.
19:6763-6769 |
| 28. | Kjemtrup, S., K. S. Sampson, C. G. Peele, L. V. Nguyen, M. A. Conkling, W. F. Thompson, and D. Robertson. 1998. Gene silencing from plant DNA carried by a geminivirus. Plant 14:91-100. |
| 29. | Latham, J. R., K. Saunders, M. S. Pinner, and J. Stanley. 1997. Induction of plant cell division by beet curly top virus gene C4. Plant J. 11:1273-1283[CrossRef]. |
| 30. | Laufs, J., S. Schumacher, N. Geisler, I. Jupin, and B. Gronenborn. 1995. Identification of the nicking tyrosine of geminivirus Rep protein. FEBS Lett. 377:258-262[CrossRef][Medline]. |
| 31. |
Laufs, J.,
W. Traut,
F. Heyraud,
V. Matzeit,
S. G. Rogers,
J. Schell, and B. Gronenborn.
1995.
In vitro cleavage and joining at the viral origin of replication by the replication initiator protein of tomato yellow leaf curl virus.
Proc. Natl. Acad. Sci. USA
92:3879-3883 |
| 32. |
Lazarowitz, S. G.,
L. C. Wu,
S. G. Rogers, and J. S. Elmer.
1992.
Sequence-specific interaction with the viral AL1 protein identifies a geminivirus DNA replication origin.
Plant Cell
4:799-809 |
| 33. | Missich, R., E. Ramirez-Parra, and C. Gutierrez. 2000. Relationship of oligomerization to DNA binding of wheat dwarf virus RepA and Rep proteins. Virology 273:178-188[CrossRef][Medline]. |
| 34. | Molinari, P., C. Marusic, A. Lucioli, R. Tavazza, and M. Tavazza. 1998. Identification of artichoke mottled crinkle virus (AMCV) proteins required for virus replication: complementation of AMCV p33 and p92 replication-defective mutants. J. Gen. Virol. 79:639-647[Abstract]. |
| 35. | Nagar, S., T. J. Pedersen, K. M. Carrick, L. Hanley-Bowdoin, and D. Robertson. 1995. A geminivirus induces expression of a host DNA synthesis protein in terminally differentiated plant cells. Plant Cell 7:705-719[Abstract]. |
| 36. | Noris, E., G. P. Accotto, R. Tavazza, A. Brunetti, S. Crespi, and M. Tavazza. 1996. Resistance to tomato yellow leaf curl geminivirus in Nicotiana benthamiana plants transformed with a truncated viral C1 gene. Virology 224:130-138[CrossRef][Medline]. |
| 37. | Noris, E., E. Hidalgo, G. P. Accotto, and E. Moriones. 1994. High similarity among the tomato yellow leaf curl virus isolates from the west Mediterranean basin: the nucleotide sequence of an infectious clone from Spain. Arch. Virol. 135:165-170[CrossRef][Medline]. |
| 38. | Ordas, R. J., R. Tavazza, and G. Ancora. 1991. Callus formation from isolated globe artichoke (Cynara scolymus L.) suspension protoplasts. Plant Sci. 77:253-259[CrossRef]. |
| 39. |
Orozco, B. M.,
A. B. Miller,
S. B. Settlage, and L. Hanley-Bowdoin.
1997.
Functional domains of a geminivirus replication protein.
J. Biol. Chem.
272:9840-9846 |
| 40. |
Orozco, B. M.,
L. J. Kong,
L. A. Batts,
S. Elledge, and L. Hanley-Bowdoin.
2000.
The multifunctional character of a geminivirus replication protein is reflected by its complex oligomerization properties.
J. Biol. Chem.
275:6114-6122 |
| 41. | Pilartz, M., and H. Jeske. 1992. Abutilon mosaic geminivirus double-stranded DNA is packed into minichromosomes. Virology 189:800-802[CrossRef][Medline]. |
| 42. |
Pooma, W., and I. T. Petty.
1996.
Tomato golden mosaic virus open reading frame AL4 is genetically distinct from its C4 analogue in monopartite geminiviruses.
J. Gen. Virol.
77:1947-1951 |
| 43. | Rigden, J. E., L. R. Krake, M. A. Rezaian, and I. B. Dry. 1994. ORF C4 of tomato leaf curl geminivirus is a determinant of symptom severity. Virology 204:847-850[CrossRef][Medline]. |
| 44. |
Saunders, K.,
A. Lucy, and J. Stanley.
1991.
DNA forms of the geminivirus African cassava mosaic virus consistent with a rolling circle mechanism of replication.
Nucleic Acids Res.
19:2325-2330 |
| 45. |
Saunders, K.,
A. Lucy, and J. Stanley.
1992.
RNA-primed complementary-sense DNA synthesis of the geminivirus African cassava mosaic virus.
Nucleic Acids Res.
20:6311-6315 |
| 46. |
Settlage, S. B.,
A. B. Miller, and L. Hanley-Bowdoin.
1996.
Interactions between geminivirus replication proteins.
J. Virol.
70:6790-6795 |
| 47. | Stanley, J. 1995. Analysis of African cassava mosaic virus recombinants suggests strand nicking occurs within the conserved nonanucleotide motif during the initiation of rolling circle DNA replication. Viriology 206:707-712. |
| 48. |
Stenger, D. C.,
G. N. Revington,
M. C. Stevenson, and D. M. Bisaro.
1991.
Replicational release of geminivirus genomes from tandemly repeated copies: evidence for rolling-circle replication of a plant viral DNA.
Proc. Natl. Acad. Sci. USA
88:8029-8033 |
| 49. | Sunter, G., and D. M. Bisaro. 1989. Transcription map of the B genome component of tomato golden mosaic virus and comparison with A component transcripts. Virology 173:647-655[CrossRef][Medline]. |
| 50. | Sunter, G., W. E. Gardiner, and D. M. Bisaro. 1989. Identification of tomato golden mosaic virus-specific RNAs in infected plants. Virology 170:243-250[CrossRef][Medline]. |
| 51. | Sunter, G., M. D. Hartitz, and D. M. Bisaro. 1993. Tomato golden mosaic virus leftward gene expression: autoregulation of geminivirus replication protein. Virology 195:275-280[CrossRef][Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»