Previous Article | Next Article 
Journal of Virology, October 2001, p. 9966-9976, Vol. 75, No. 20
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.20.9966-9976.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Murine Cytomegalovirus CC Chemokine Homolog MCK-2 (m131-129) Is a
Determinant of Dissemination That Increases Inflammation at Initial
Sites of Infection
Noah
Saederup,1
Shirley A.
Aguirre,1
Timothy E.
Sparer,1
Donna M.
Bouley,2 and
Edward S.
Mocarski1,*
Department of Microbiology and
Immunology1 and Department of
Comparative Medicine,2 Stanford University
School of Medicine, Stanford, California 94305-5124
Received 26 March 2001/Accepted 3 June 2001
 |
ABSTRACT |
The murine cytomegalovirus CC chemokine homolog MCK-2 (m131-129) is
an important determinant of dissemination during primary infection.
Reduced peak levels of viremia at day 5 were followed by reduced levels
of virus in salivary glands starting at day 7 when mck
insertion (RM461) and point (RM4511) mutants were compared to
mck-expressing viruses. A dramatic MCK-2-enhanced
inflammation occurred at the inoculation site over the first few days
of infection, preceding viremia. The data further reinforce the role of
MCK-2 as a proinflammatory signal that recruits leukocytes to increase the efficiency of viral dissemination in the host.
 |
TEXT |
Primary infection with human
cytomegalovirus (CMV) is associated with shedding in saliva and other
body fluids (42). This virus encodes functions that
modulate the host immune response (22, 23) and that
influence host cell or tissue tropism (39). Due to the
strict species specificity of CMVs, murine CMV has been used to gain
insights into viral pathogenesis and latency (24), host
immune control of virus infection (27), and viral modulation of the host immune response (22, 23). Human and murine CMVs have a colinear genome organization (46) and
encode immunomodulatory functions that carry out analogous functions during infection (22, 23). Gene products that function in similar ways sometimes retain little amino acid sequence similarity in
these two viruses. For example, murine and human CMVs rely on
nonhomologous gene products to downmodulate major histocompatibility complex class I gene expression (1, 22, 23, 25, 61), and
both have major histocompatibility complex class I homologs that are
nonhomologous themselves, although both influence natural killer cell
behavior (17, 31, 47).
The chemokine receptor US28 (20, 41, 56) is not conserved
in murine CMV, although two other seven-transmembrane-spanning G-protein-coupled receptor homologs, M33 and M78, are
(46). Both murine and human CMVs encode gene products with
chemokine-like activities (35, 36, 43, 49); however, they
represent different chemokine classes and lack amino acid sequence
similarity. The human CMV UL146 gene encodes vCXC-1, a CXC chemokine
(43), and the murine CMV m131-129 gene encodes MCK-2, a CC
chemokine homolog (19, 35, 36, 49). Viral chemokine
homologs (3, 14, 30, 33, 40, 67) may function as
chemokines to increase leukocyte migration or may act as antagonists
that block the migration of leukocyte subsets (6, 13, 15, 16, 26,
28, 43, 49, 54) to host chemokines (4, 7, 48, 63).
Chemokines regulate cell effector functions such as granule release and
cytokine expression, contributing to both the quality and the magnitude of inflammatory responses (2, 11, 34, 50, 58, 66). Human
CMV vCXC-1 activates neutrophils via CXCR2 very much like interleukin 8 (43) and could influence neutrophil behavior (21, 51). Murine CMV open reading frame (ORF) m131 was initially predicted to encode an 81-aminio-acid (aa) chemokine,
designated MCK-1, based on the presence of C spacing motifs typically
conserved in CC chemokines (36). A predicted processed
63-aa synthetic form of MCK-1 was found to induce calcium flux on
murine peritoneal macrophages and THP-1 cells but to
neither bind to nor inhibit the binding of host chemokines to other
leukocyte populations (49). This behavior led us to
propose a model where MCK-1 recruits a subset of mononuclear leukocytes
during viral infection (49; N. Saederup, Y. C. Lin, T. Schall, and E. S. Mocarski, Abstr. 23rd International
Herpesvirus Workshop, York, England, abstr. 340, 1998).
The principal transcript arising from the m131 region was found to
contain an intron such that the spliced mRNA created an in-frame fusion
between MCK-1 and 199 codons that included the entire m129 ORF
(19, 35). This m131-129 fusion was denoted MCK-2
(35) and was shown to be expressed as a true late
(
2) gene product (60) secreted
into the medium during infection (35). Although
functional evaluation of MCK-2 has not been undertaken, studies of
synthetic MCK-1 (49) predicted that MCK-2 would be proinflammatory because all 81 aa of MCK-1 are contained in MCK-2. Consistent with this prediction, mck mutant viruses
exhibited reduced levels of viremia and poor dissemination to salivary
glands (19, 49, 55) without having an impact on
dissemination to other organs, such as the spleen, liver, and lungs.
Reduced dissemination to salivary glands appeared independent of the
capacity to mount an adaptive immune response (55) but may
be influenced by the natural killer cell response (19).
Murine CMV disseminates in two distinct phases (12) via
peripheral blood mononuclear leukocytes (5, 55). Primary
viremia within 2 days after inoculation (12) is believed
to seed sites such as the spleen, liver, lungs, and brown fat
(12, 55). A readily detected secondary viremia peaks at 5 days after inoculation (12, 49, 55); from this the
salivary glands, a major site of murine CMV replication and
shedding, become seeded (55). Five recombinant
viruses, RM461 (8, 55) (Fig.
1), RM
461-1 (8),
m131Z
(19),
m131ns (19), and RM4485
(49), all of which carry mutations in the mck
gene, have been shown to exhibit reduced peak titers in salivary
glands. RM461 and RM4485 were shown to exhibit reduced peak levels of
viremia (49). It has been found that dissemination of
mck mutant viruses to other organs, including the spleen,
liver, lungs, adrenal glands, kidneys, and brown fat, remains largely
unaltered (8, 49, 55). Latency and reactivation
characteristics of mck mutants are similar to those of
wild-type viruses (8). We undertook the current study to
investigate the nature of the impact of mck expression on
the behavior of virus or host cells at the site of inoculation. Our study shows that mck expression is associated with a strong
cellular inflammatory response at the site of inoculation and that this activity is dependent on the conserved CC chemokine motif in
mck gene products.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic representation of mutant virus genomes. The
top line represents a restriction map of the HindIII K,
L, and J DNA fragments in murine CMV strain K181+,
corresponding to nts 173170 to 195847 of the Smith strain genome
(46) (GenBank accession number U68299). Restriction
sites for HindIII and selected BssHI,
HpaI, and BbrPI sites are indicated above
the line, and a 1-kbp scale marker is indicated by a double-headed
arrow below the line. Open boxes with arrowheads depict the positions
of viral ORFs, with m131 and m129 contributing the coding sequences for
MCK-2 (35). m130 overlaps mck on the
opposite DNA strand (46). Solid arrows depict transcripts
(ie1, ie3, ie2,
mck, and sgg1) encoded by wild-type
viruses. The mutations introduced into mutant viruses
RM427+, RM4503, RM461, and RM4511 are depicted below the
transcripts. The 3.9-kbp lacZ insert carried by
RM427+ and RM461 (open box) is controlled by a 199-bp human
CMV ie1-ie2 promoter fragment (shaded
box) encompassing positions 219 to 19 relative to the transcription
start site (8, 37, 55). The 1.7-kbp EGFP-puro insert in
RM4503 and RM4511 (open box) is controlled by a 248-bp human CMV
ie1-ie2 promoter fragment (hatched box)
encompassing positions 242 to +7 relative to the transcription start
site (59). The expanded region shows aa 25 to 30 of m131
and aa 142 to 147 of m130, including the two nucleotide point mutations
(denoted by asterisks) introduced into RM4511, generating a new
BbrPI site (underlined) and altering the MCK-2 amino
acid sequence (C27R and C28G; bold type).
Wild-type strain K181+ nucleotide and amino acid sequences
are shown at the bottom.
|
|
Construction of recombinant viruses to assess the
mck chemokine motif.
First, we isolated RQ461, a
rescue of the mck mutation in RM461 (49, 55).
Then, we constructed mutant virus RM4511, with a mutation in the
conserved CC chemokine motif (Fig. 1). Rescued virus RQ461 was
constructed by transfecting MluI-linearized pON4457 into
RM461-infected cells by use of Superfect (Qiagen, Valencia, Calif.)
and, after harvesting at 72 hours postinfection, expanding viral
progeny at a low multiplicity of infection (<0.1) on NIH 3T3 cells.
pON4457 (59) carries a wild-type murine CMV
DraI/EcoRI fragment (nucleotides [nts] 183086 to 189674), spanning the sgg1, mck, and
ie2 genes, as well as the major immediate-early enhancer, cloned into pGEM-2 (Promega, Milwaukee, Wis.).
To select for recombinants and to reduce the likelihood of isolating
viruses with adventitious mutations (
55), the virus
pool
was passaged twice through mice by inoculating footpads and
screening
salivary gland sonicates 14 days later for
lacZ-deficient
plaques. Viruses were isolated and subjected to three rounds of
limiting dilution purification. White plaques were observed with
pON4457 but not with control plasmid pME18S (
57).
Initially,
two independent isolates of RQ461 were selected based on
replacement
of the
lacZ insert with a wild-type copy of the
mck gene (Fig.
1). Both of these isolates exhibited growth
properties similar
to those of the wild-type parental virus, and one of
these was
designated
RQ461.
The RQ461 genome structure was compared to those of RM461 and
K181
+ by separation of
[

-
32P]dCTP-end-labeled
HindIII-digested virion DNA by agarose gel
electrophoresis. Virion DNA (0.5 to 1.0 µg) was digested with
HindIII,
BssHII,
AflII, or
SpeI (New England Biolabs, Beverly,
Mass.) and end labeled
in the presence of 2.5 µCi of [

-
32P]dCTP
(Amersham), 125 µM each dATP, dGTP, and dTTP, and 0.5 U
of
Klenow polymerase (Roche, Indianapolis, Ind.) for 15 min at
room
temperature in 20 µl of restriction enzyme buffer. Restriction
fragments were separated on a 0.6% agarose gel, which was fixed
in
95% ethanol and vacuum dried at 80°C, followed by autoradiography.
RQ461 displayed a restriction pattern distinct from that of mutant
RM461 but similar to that of wild-type K181
+
(Fig.
2). Restriction digest analysis
using
AflII,
HpaI, or
SspI
showed that
the genome of the rescued virus did not contain detectable
adventitious deletions or rearrangements (data not shown).

View larger version (67K):
[in this window]
[in a new window]
|
FIG. 2.
Restriction digestion analysis of RQ461 DNA.
Autoradiograph of 32P-end-labeled HindIII
fragments from K181+, RM461, and RQ461 DNA following
electrophoretic separation on a 0.7% agarose gel.
|
|
All previously characterized
mck mutant viruses (
19,
49), including RM461, disrupt the m130 ORF located on the cDNA
strand
in addition to the intended disruption of m131. The m130 ORF,
predicted from genome sequence analysis of murine CMV
(
46),
completely overlapped the chemokine domain of m131
(Fig.
1); however,
m130 has not been subjected to evaluation. In
order to establish
that the phenotype of
mck mutant viruses
was independent of m130,
point mutations were introduced to disrupt the
two adjacent conserved
amino-terminal cysteines of m131. These would be
expected to eliminate
the chemokine activity of
mck gene
products based on the well-established
role of this conserved CC motif
in forming disulfide bonds that
are critical for chemokine function
(
9,
10,
45). We changed
these two adjacent cysteines in
m131 to arginine and glycine (C
27R
and
C
28G) in a way that did not alter the sequence of
m130 (A
144 and T
145; Fig.
1) or any other known ORF within the murine CMV
genome
(
46).
pON4511 was constructed by replacing a 393-bp
AflII/
BssHII fragment of pON4503 which spans the
amino terminus of
mck (murine
CMV nts 188185 to
188577) with a PCR-generated
AflII/
BssHII
fragment
containing T
79C and
T
82G mutations of
mck, resulting in
C
27R and
C
28G mutations of
the MCK-2 protein. PCR was conducted with primers
5'GAGGCTATCTTAAGACTATC3' and
5'GCGCGCCACGTGGCTCGCGGAGGTCC3', pON4457
as a template, and
an Expand high-fidelity PCR system (Roche)
according to the
manufacturer's protocol. The PCR fragment was
cloned into
pGEMT-EZ (Promega), and the sequences of both DNA
strands were
determined prior to ligation into
AflII/
BssHII-digested
pON4503. This mutation
created a
BbrPI site (CACGTG) that was
used to aid in the
isolation of plasmid pON4511 and recombinant
virus RM4511. In addition
to the mutation, RM4511 was engineered
to carry an enhanced green
fluorescent protein (EGFP)-puromycin
(EGFP-puro) cassette
(
59) within the
ie2 gene to facilitate
selection (Fig.
1).
ie2 mutant viruses have been repeatedly
found
to exhibit wild-type growth patterns in cell cultures as well
as
after experimental infection of mice (
8,
32,
59; S.
A. Aguirre, unpublished data). The
mck CC mutant virus
RM4511
was made by the same protocol as RQ461, except that
RM427
+ virus (
32,
49) was the
parent and
AflII/
PacI-linearized pON4511
contained the mutation in addition to the EGFP-puro marker
(
59).
After two rounds of selection, RM4511 transfection
pools were
expanded under low-multiplicity-of-infection conditions in
tissue
cultures and passaged through mice as described for RQ461.
Individual
RM4511 clones (designated RM4511.1 and RM4511.2) were
isolated
from independent pools by two rounds of limiting dilution and
two rounds of plaque purification using a

-galactosidase substrate
5-bromo-4-chloro-3-indolyl-

-
D-galactopyranoside
(X-Gal) overlay
(
37) to confirm the absence of parental
virus RM427
+ (<1
plaque/10
6 PFU).
RM4511 DNA was subjected to blot hybridization analysis to detect the
introduced
BbrPI site by following established protocols
(
37,
44,
60). A
HindIII/
AflII
fragment from pON4457 (murine
CMV nts 187890 to 188578) was
radiolabeled with [

-
32P]dCTP as an
mck probe (
18). This detected 1,097 and 591-bp
BbrPI restriction fragments in RM4511
DNA. DNA from parental virus
RM427
+ or
EGFP control virus RM4503 (
59) had only the expected
1,688-bp
BbrPI fragment (Fig.
3A) of the wild-type
mck gene.
Thus, the
substitution mutations had been introduced at the correct
genomic
locations. To confirm the position of the EGFP-puro
insert, end-labeled
BssHII DNA fragments were generated from
all viruses, separated
by agarose gel electrophoresis, and subjected to
autoradiography
to reveal a 7.9-kbp RM4511 fragment in place of
the 8.3-kbp fragment
observed in parental virus
RM427
+ (Fig.
3B). Thus, the EGFP-puro cassette
was inserted within the
ie2 gene of RM4511 in a manner
similar to that in RM4503 (
59).
RM4511 DNA was also
digested with
HindIII, generating the expected
8.5-kbp
fragment instead of the two fragments (3.7 and 7.3 kbp)
found in
RM427
+ DNA. No adventitious genomic
deletions or rearrangements were
detected in RM4503 or either of the
RM4511 isolates when subjected
to
HindIII,
SpeI, or
BssHII restriction analysis (Fig.
3C and
data not shown). Together, these results demonstrated that both
independent RM4511 isolates carried the intended substitution
mutations
in
mck and the marker gene insert in
ie2. As
expected
from extensive analyses of previous
ie2
mck double mutants in
cultures and in mice (
8),
the two independent RM4511 isolates
produced peak titers in NIH 3T3
cells that were indistinguishable
from those of
K181
+ and RM427
+ (data not
shown).

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 3.
Restriction digestion analysis of RM4511 DNA. (A)
Detection of the RM4511 mck mutation by
BbrPI digestion. Autoradiograph of
BbrPI-digested (Roche) virion DNA from parental
RM427+, RM4503, and two isolates of RM4511 (RM4511.1 and
RM4511.2) following electrophoretic separation on a 1% agarose gel and
hybridization with a HindIII/AflII
fragment mck probe. (B) Detection of the EGFP-puro
insert in RM4503 and RM4511. Autoradiograph of electrophoretically
separated, BssHII-digested 32P-end-labeled
DNA fragments. (C) Autoradiograph of electrophoretically separated
32P-end-labeled HindIII fragments of DNA
from RM427+, RM4503, and two isolates of RM4511.
|
|
Role of mck in peripheral blood mononuclear
cell-associated viremia.
Previous studies of mck mutant
viruses in mice suggested that this gene affected the behavior of host
mononuclear cells in a way that resulted in poor dissemination to
salivary glands (8, 19, 49, 55). Although our studies have
discounted any impact on the adaptive immune response or viral latency,
one study suggested that mck modulated the host immune
response (19). To date, precise m131-specific mutations
have not been studied, so differences in the behavior of mutant viruses
may have resulted from an impact on viral genes, such as m130, that
overlap m131 (19, 49). We compared the growth properties
of mck mutants and control viruses, initially evaluating
peak levels of viremia at 5 days postinoculation (106 PFU, intraperitoneal [i.p.] route).
PBLs were collected from CO2-asphyxiated
mice for coculturing with permissive NIH 3T3 cells. Peripheral blood
leukocytes (PBLs) were washed, suspended in growth medium at
106 cells/ml, serially diluted, and subjected to
an infectious-center assay on NIH 3T3 cells overlaid with complete
growth medium (37) containing 0.75% carboxymethyl
cellulose. For this and all other experiments, groups of female mice (3 to 5 weeks of age) were used with the approval of the Stanford
Administrative Panel on Laboratory Animal Care.
Peak viremia was reduced 50- to 100-fold in mice infected with RM461
compared to either rescued virus RQ461 or parental wild-type
virus
K181
+ (Fig.
4A),
consistent with previous observations (
49). To investigate
the contribution of the conserved chemokine sequence motif in
m131,
mice were inoculated with RM461, RM4511.1, RM4511.2, RM4503,
or
RM427
+; PBLs were harvested at 5 days
postinoculation for assay. The
previously observed decrease in RM4511.1
or RM4511.2 infection
resulted in peak viremia that was 25- to
50-fold lower than that
seen with either parental virus
RM427
+ (Fig.
4B) or control virus RM4503
(Fig.
4C). These results showed
that
mck expression
correlated with increased viremia, that
mck function
depended upon the conserved CC motif, and that the m130
ORF did not
contribute to the phenotype.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 4.
Evaluation of peak levels of viremia at 5 days after
i.p. inoculation of BALB/c mice with 106 PFU. (A)
Comparison of K181+, RM461, and RQ461. (B) Comparison of
RM427+, RM461, RM4511.1, and RM4511.2. (C) Comparison
of RM427+, RM4503, and RM4511.2. PBLs
(106) were harvested and subjected to an infectious-center
assay on NIH 3T3 cells. Bar height indicates the geometric mean, and
vertical bars indicate standard deviations of the geometric mean. The
shaded area indicates the limit of detection of virus.
|
|
Dissemination of mck mutants after inoculation.
We used the footpad inoculation route to evaluate whether
mck influenced dissemination to salivary glands as it does
following i.p. inoculation (8, 19, 49). This inoculation
route introduces virus in the periphery at a location more distal to
organs and tissues that become involved during acute infection. This
route may also be considered a model of natural transmission that is dependent on animal behavior such as biting. The impact of
mck on viral dissemination was examined in several
independent experiments (Fig. 5). We
observed lower virus titers in the salivary glands at day 7 or 14 postinoculation with RM461 than with K181+ or
rescued virus RQ461 (Fig. 5K and L). Following either i.p. or footpad
inoculation, mck mutant or wild-type viruses reached peak
levels in the salivary glands between days 14 and 21 and began to
decrease by day 28 (8, 55; J. Huang, unpublished data).
Footpads (Fig. 5A and B), draining popliteal lymph nodes (Fig. 5C and
D), and organs such as the liver and spleen (Fig. 5E through H) showed
similar titers for all viruses tested. Except for the significantly
reduced titers in the salivary glands, growth of the mck
mutant viruses could not be distinguished from that of the wild-type
virus. Although a report (19) suggested that viral
replication in the spleen and liver may be influenced by mck, we have not detected any consistent differences (Fig. 5
and data not shown). In our experiments, variable virus titers in the
spleen, liver, and lungs have sometimes been observed (8), but these differences are not consistently associated with a particular virus genotype, as exemplified by the data in Fig. 5I and J.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 5.
Replication patterns for RM461, RQ461, and
K181+ in BALB/c mice. Experiment 1 (A, C, E, G, I, and K)
shows virus titers in organs at 3, 5, 7, and 14 days postinoculation
(four animals per group). Experiment 2 (B, D, F, H, J, and L) shows
titers at 1, 2, 3, 5, 7, and 14 days postinoculation (five animals per
group). Footpads of 3-week-old BALB/c mice were inoculated with
106 PFU. Titers in organ sonicates were determined by
plaque assays on NIH 3T3 cells. Each symbol represents an individual
mouse. K181+ ( ), RM461 ( ), and RQ461 ( ) were the
viruses used. The lines connect the geometric means for each virus
(solid, K181+; dotted, RQ461; dashed, RM461). The shaded
area indicates the limit of detection of virus.
|
|
The high inoculum dose (10
6 PFU) used for
experimental infection likely exceeds the dose typical of natural
infection. To evaluate
the impact of
mck on dissemination
under low-dose conditions,
groups of five mice were inoculated i.p.
with either 10
2 or 10
4 PFU
of
mck mutant or control virus. Virus titers in salivary
glands at 8 and 21 days postinoculation showed that the
mck
phenotype
was preserved at a dose of as low as
10
2 PFU (Fig.
6A)
as well as at a dose of 10
4 PFU (data not shown).
Thus, the
mck gene plays an important role
as a
determinant of dissemination at high doses as well as at
low doses that
better approximate natural transmission. Interestingly,
titers of
either virus in salivary glands were significantly lower
than when
higher doses were used and were most variable following
the lowest
dose. Despite the variability, the impact of
mck on
the
levels of virus present in this tissue remained highly significant
over
a broad range of doses using either tissue culture-derived
or
salivary gland-passaged virus inocula (
8,
19,
49,
55;
this
study).

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 6.
Dissemination of mck mutant viruses to
salivary glands. (A) Levels of RM461 ( ) or RQ461 ( ) in the
salivary glands at 8 and 21 days postinoculation of 100 PFU into
footpads of 3-week-old BALB/c mice (four animals per group). (B) Levels
of RM427+, RM4503, RM4511.1, and RM4511.2 in the salivary
glands at 14 days postinoculation of 106 PFU into footpads
of 3-week-old BALB/c mice (four animals per group). Titers of organ
sonicates were determined by plaque assays on NIH 3T3 cells, and mean
values were plotted. Vertical bars indicate standard deviations of the
geometric mean. The shaded area indicates the limit of detection of
virus.
|
|
To assess the contribution of the m131 CC chemokine motif to
dissemination, salivary gland sonicates were collected at 14
days
postinoculation with RM4511.1, RM4511.2, RM4503, or
RM427
+. The RM4511 isolates replicated to levels
10- to 30-fold lower
than those of control
mck-expressing
viruses (Fig.
6), consistent
with a role for the CC chemokine motif in
dissemination to this
tissue. Although RM4503 and
RM427
+ replicated to similar levels
(
P > 0.3; Student's two-sided
t test) that
were comparable to those of wild-type K181
+ (Fig.
5K), differences between any of the control viruses and
the RM4511
isolates were significant (
P values determined by Student's
two-sided
t test of RM4503 compared to either RM4511.1
or RM4511.2
were <0.002 and <0.0008, respectively). When
RM4511.1 and RM4511.2
were isolated from salivary gland sonicates and
analyzed, both
retained the
BbrPI restriction site
indicative of the introduced
mutation (data not shown). These results
show that the CC chemokine
motif mutation was stable and suggest a
substantial proinflammatory
activity for
mck.
It was previously reported (
49) that low-level viremia of
mck mutant virus was complemented by coinoculation with
mck-expressing
virus. In order to determine whether
mck-expressing virus was
able to complement mutant virus
dissemination to salivary glands,
lacZ-tagged
mck
mutant virus RM461 was inoculated i.p. alone or
together with control
virus RM4503 into groups of four BALB/c
mice. We used 2 × 10
6 PFU of RM461 or 1 × 10
6 PFU of RM4503 for independent inoculation and
1 × 10
6 PFU of RM461 plus 5 × 10
5 PFU of RM4503 (1.5 × 10
6 PFU total) for coinoculation. Virus titers in
salivary gland
sonicates were determined at 5, 7, and 15 days
postinoculation.
In tissues from the coinfected animals,
lacZ-expressing
mck mutant
RM461 plaques were
distinguished from RM4503 plaques by staining
with X-Gal. RM461 titers
were enhanced 4- to 50-fold in coinoculated
animals (Table
1), the highest levels of complementation
being
observed on day 7 postinoculation. At this time, the ratio of
titers for RM461 and RM4503 in the coinfected mice was 0.1, compared
to
0.002 for independently inoculated mice. Apparently,
mck
mutant
virus was able to disseminate 50 times more efficiently in
coinfected
mice. RM461 levels in salivary glands were also complemented
by
RM4503 at day 5, when titers were very low, as well as at day
15 postinoculation, when peak levels of virus were observed at
this site
(
55). The variations in these ratios were entirely
due to
differences in the levels of RM461. Titers of
mck-expressing
virus RM4503 were unaltered by the presence of mutant virus (data
not
shown). The peak complementation at day 7 followed the period
of peak
viremia (
49) and coincided with the initial rise in
viral
replication levels in salivary glands (Fig.
5), suggesting
that the
expression of MCK-2 (
35) by RM4503 increased the
dissemination
of mutant virus RM461.
Modulation of foot swelling by mck.
Foot
thickness, measured with a caliper, can provide an indicator of local
inflammatory responses, particularly in conjunction with direct
histological evaluation of tissue sections (62, 64, 65).
Groups of 3-week-old BALB/c mice were inoculated (106 PFU) with mck mutant or rescued
virus, and the foot thickness of restrained mice was measured before
and at 0.5, 1, 2, 3, 4, 5, 7, 10, and 14 days after inoculation
using a digital caliper (Mitutoyo, Kanagawa, Japan). Virus-infected
mice did not show outward signs of illness, so to control investigator
bias, all inocula were coded. Foot swelling was defined as the percent
increase in thickness relative to the preinoculation measurement. This variation in foot thickness in different groups of mice was found to be
low, between 0.3 and 0.7%, based on measurements taken over a 2-week
period. We found that mck mutant virus RM461 induced significantly less swelling than either rescued virus RQ461 (Fig. 7A) or parental wild-type virus
K181+ (data not shown). A consistent pattern
developed by day 2, when the level of swelling in RQ461-inoculated feet
increased markedly, about 50% over preinoculation levels, compared to
the results obtained with RM461. These levels were maintained through
day 5, started to decline by day 7, and approached baseline by day 14 for all viruses. All swelling resulted from the effects of virus in the
inoculum because tissue culture medium alone failed to elicit any
response (data not shown). The differences in swelling corresponded to
the expected timing of expression of MCK-2 (35), starting
at day 2, and were consistently observed in several independent experiments (Fig. 7). Swelling continued throughout the period during
which viral replication was detected (Fig. 5A and B). The induction of
an mck-dependent swelling response correlated with the true
late (
2) kinetics of mck expression
(35). Swelling before 48 h, when MCK-2 is expressed,
was variable without regard to virus genotype or inoculum dose. The
appearance of dramatic, sustained differences in inflammation starting
at day 2 provided confirmation for the suggested proinflammatory role
of mck (19, 49).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 7.
Time course analysis of footpad swelling. (A and B)
Measurement of RM461 ( )- or RQ461 ( )-induced swelling following
footpad inoculation of 3-week-old BALB/c mice in groups of five (A) or
four (B) animals. (C) Measurement of RM4511.1 ( )-, RM4511.2
( )-, RM4503 ( )-, or RM427+ ( )-induced
swelling following footpad inoculation of three 5-week-old mice. Mice
were inoculated with 106 PFU of virus. Foot thickness was
measured with a digital caliper at the times indicated after
inoculation, and mean values were plotted. Vertical bars
indicate standard deviations of the mean.
|
|
To assess whether the m131 CC chemokine motif contributed to the
intensity of the swelling response, we evaluated foot swelling
during infection with either of the RM4511 isolates (Fig.
7C).
The
level of swelling induced by RM4511.1 or RM4511.2 was similar
to that
induced by
mck mutant virus RM461 (Fig.
7A and B) and
was
lower than that induced by either parental virus
RM427
+ or control virus RM4503 (Fig.
7C).
RM427
+ induced swelling similar to that seen with
other
mck-expressing
viruses, almost 60% above
preinoculation levels in this experiment
and more than double that
observed following inoculation of RM4511.1
or RM4511.2. A similar
pattern was induced by other
mck-expressing
viruses
throughout a 10- to 14-day observation period (data not
shown). Taken
together, these data show that the increased swelling
induced by
wild-type viruses is dependent upon the conserved CC
chemokine motif in
m131, further implicating MCK-2 as a proinflammatory
protein.
Modulation of local inflammation by mck.
In
order to directly investigate cellular infiltrates in response to
mck, BALB/c mouse footpads were inoculated with mutant virus
RM461 or rescued virus RQ461 (106 PFU). Feet were
collected from sacrificed mice at 48 h postinoculation, and
midline longitudinal sections were prepared from 10% neutral buffered
formalin-fixed (Ex Cal II; Fisher Scientific), paraffin-embedded (Histo
Tech, Inc.) blocks. Examination by light microscopy at a low power
(×40) revealed substantially larger amounts of both cellularity and
edema in mck-expressing virus- than in control virus-infected feet (Fig. 8). All areas
of inoculated feet (dorsal, internal, and ventral) appeared less
inflamed following infection with mutant virus RM461 (Fig. 8B) than
following infection with mck-expressing control virus RQ461
(Fig. 8A). The differences in foot thickness measured grossly using
calipers (Fig. 7) correlated with the histopathological findings and
appeared to result from increases in both cellularity and edema (Fig.
8A and B). In a pattern that was readily appreciated at a low power,
the expression of mck correlated with a much more intense
local inflammatory response in the regions closest to the inoculation
sites. At a higher power (×400), differences in cellular infiltrates
with increased neutrophils were readily apparent, and there was more necrosis in tissues from mck-expressing virus-infected mice
(Fig. 8C) than in those from mutant virus-infected mice (Fig. 8D). All of these inflammatory changes were due to the presence of virus in the
inoculum, because injection of culture medium alone failed to induce
any response over that seen in sham (medium)-inoculated controls (data
not shown). These observations suggested that the expression of
mck altered and intensified the innate inflammatory response
to virus infection.

View larger version (127K):
[in this window]
[in a new window]
|
FIG. 8.
Inflammatory responses induced by RM461 and RQ461
following footpad inoculation. Tissues were harvested from an
inoculated mouse foot 48 h after inoculation with RQ461 or RM461
(106 PFU in 3 µl of growth medium), formalin fixed, and
decalcified; after embedding in paraffin, 5-µm sections were cut and
stained with hematoxylin and eosin. (A) RQ461. (B) RM461. (C) RQ461.
(D) RM461. The dorsal, internal, and ventral areas are denoted
by white, grey, and black bars, respectively, on the sides of panels A
and B. Areas boxed in panels A and B are magnified in panels C and D,
respectively.
|
|
To determine how the host inflammatory response was modulated by the
expression of
mck during infection, histological sections
from groups of mice were analyzed. Sections were evaluated
semiquantitively
at 2, 3, and 7 days postinoculation, and mean scores
for the intensity
of cellular infiltration and edema in the dorsal,
internal, and
ventral areas of midline longitudinal sections (5 µm)
of infected
feet were assigned numerical values: minimal, 1; mild, 2;
moderate,
3; marked, 4; and severe, 5 (Fig
9). Dorsal, internal, and ventral
regions
of the feet were evaluated by light microscopy at low-power
magnification for levels of edema and cellularity and at high-power
magnification for changes in cell type and necrosis. When separate
areas of the feet were scored for cellularity and edema, the ventral
and internal regions exhibited greater differences at day 2 or
3 than
did the dorsal region, although mutant virus infection
consistently
induced a less intense response than wild-type virus
infection in all
of these areas. Overall, these differences reflected
the extent of
swelling measured using calipers (Fig.
7). The total
levels of
cellularity (Fig.
9A) and edema (Fig.
9B) were depicted
by combining
the mean scores of individual areas. These levels
peaked at day 2 or 3 following inoculation with wild-type virus
and were markedly lower in
mutant virus-infected tissues. Mononuclear
cell infiltrates increased
and neutrophil infiltrates decreased
at between days 3 and 7 for both
viruses (data not shown), consistent
with the transition from an innate
to an adaptive immune response
over this time (
27). When
the intensity of cellularity or edema
in separate areas was evaluated
(Fig.
9A and B), results continued
to show a marked difference in
mutant-infected and control tissues.
On day 2 or 3 postinoculation,
levels of cellularity during infection
with mutant virus were
approximately 60% the levels seen with
wild-type virus, with
differences being most marked in the ventral
and internal areas. On day
2 or 3 postinoculation, levels of edema
during infection with mutant
virus were variable (55 to 79% the
levels of the wild type) but were
consistently lower than the
levels seen with wild-type virus. Together,
these results show
that
mck expression correlated with a
more intense inflammatory
response in the infected tissues at times
when the innate response
predominated. It seems likely that
mck acts to profoundly alter
and intensify the early
antiviral inflammatory response, albeit
in a manner that is apparently
independent of the effectiveness
of that response. Quite remarkably,
the profound increase in the
inflammatory response induced by
mck-expressing viruses does not
result in a greater
clearance of infection (Fig.
5).

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 9.
Histopathological evaluation of edema and cellularity
following footpad inoculation. Groups of five mice were inoculated in a
single footpad with either RM461 or RQ461 as described in the legend to
Fig. 8, and foot sections were collected for analysis at days 2, 3, and
7 postinoculation. Sections from each foot were evaluated for
inflammatory changes at low-power magnification by light microscopy
(×40) and assigned numerical values (see the text) for levels of
cellularity (A) and edema (B). Bars correspond to the mean values for
the dorsal (open), internal (grey), and ventral (black) areas and are
depicted to appreciate the score for an area as well as a total score
(maximum of 15) that incorporates the evaluation of all three areas.
|
|
We have shown that the expression of MCK-2 during acute infection in
mice contributes to an increase in the inflammatory response
at the
footpad site of inoculation as well as to higher peak levels
of viremia
and more efficient dissemination to salivary glands.
Efficient
mck-dependent dissemination is not affected by the capacity
of the host to mount an adaptive immune response (
8,
55)
but appears to interface with the innate immune response over
the first
few days of infection. Fleming et al. (
19) observed
approximately twofold lower levels of inflammation in the liver
at 2 days after i.p. inoculation with
mck mutant viruses;
however,
this result does not reflect differences in the levels of
inflammation
in the peritoneal cavity, which are similar for
mck mutant and
control viruses (N. Saederup, unpublished
observations).
Recombinant viruses carrying specific mutations disrupting the
conserved CC chemokine motif within m131 provide the strongest
evidence
that inflammation at the footpad inoculation site is
under the control
of MCK-2 and that the intensity of the local
inflammatory response
influences the level of viremia that precedes
dissemination to the
salivary glands. Consistent with a proposed
role as a secreted
chemokine, the requirement for MCK-2 can be
complemented by
coinoculating an
mck-expressing virus together
with a mutant
virus. Although we cannot discount a direct immunomodulatory
role for
MCK-2, we believe that the major impact of
mck is to
recruit mononuclear leukocytes that disseminate virus. Many other
immunomodulatory viral gene products probably contribute to altering
the effectiveness of innate and adaptive immune responses (reviewed
in
references
29,
38,
52, and
53).
mck function therefore
appears to be
focused on the recruitment of cells that facilitate
dissemination to
the salivary glands during acute infection. With
a pirated function
used to increase dissemination,
mck appears
suited to the
needs of a virus that gains access to the salivary
glands in order to
be shed into saliva and transmitted to new
hosts (
24).
 |
ACKNOWLEDGMENTS |
This work was supported by PHS grants AI30363 and AI33852 (to
E.S.M.) as well as PHS training grant T32 GM07328 (to N.S.) and PHS
Clinical Scientist Career Development Award K08 AI 01638 (to S.A.A.).
We thank Jing Huang for excellent technical assistance.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, Stanford University School of Medicine, Sherman Fairchild Science Building, Stanford, CA 94305-5124. Phone: (650) 723-6435. Fax: (650) 723-1606. E-mail:
mocarski{at}stanford.edu.
 |
REFERENCES |
| 1.
|
Ahn, K.,
A. Angulo,
P. Ghazal,
P. A. Peterson,
Y. Yang, and K. Fruh.
1996.
Human cytomegalovirus inhibits antigen presentation by a sequential multistep process.
Proc. Natl. Acad. Sci. USA
93:10990-10995[Abstract/Free Full Text].
|
| 2.
|
Alam, R.,
D. Kumar,
D. Anderson-Walters, and P. A. Forsythe.
1994.
Macrophage inflammatory protein-1 alpha and monocyte chemoattractant peptide-1 elicit immediate and late cutaneous reactions and activate murine mast cells in vivo.
J. Immunol.
152:1298-1303[Abstract].
|
| 3.
|
Baggiolini, M.,
B. Dewald, and B. Moser.
1997.
Human chemokines: an update.
Annu. Rev. Immunol.
15:675-705[CrossRef][Medline].
|
| 4.
|
Baggiolini, M., and P. Loetscher.
2000.
Chemokines in inflammation and immunity.
Immunol. Today
21:418-420[CrossRef][Medline].
|
| 5.
|
Bale, J. F., Jr., and M. E. O'Neil.
1989.
Detection of murine cytomegalovirus DNA in circulating leukocytes harvested during acute infection of mice.
J. Virol.
63:2667-2673[Abstract/Free Full Text].
|
| 6.
|
Boshoff, C.,
Y. Endo,
P. D. Collins,
Y. Takeuchi,
J. D. Reeves,
V. L. Schweickart,
M. A. Siani,
T. Sasaki,
T. J. Williams,
P. W. Gray,
P. S. Moore,
Y. Chang, and R. A. Weiss.
1997.
Angiogenic and HIV-inhibitory functions of KSHV-encoded chemokines.
Science
278:290-294[Abstract/Free Full Text].
|
| 7.
|
Butcher, E. C.,
M. Williams,
K. Youngman,
L. Rott, and M. Briskin.
1999.
Lymphocyte trafficking and regional immunity.
Adv. Immunol.
72:209-253[Medline].
|
| 8.
|
Cardin, R. D.,
J. M. Boname,
G. B. Abenes,
S. A. Jennings, and E. S. Mocarski.
1993.
Reactivation of murine cytomegalovirus from latency, p. 65-74.
In
S. Michelson, and S. A. Plotkin (ed.), Multidisciplinary approaches to understanding cytomegalovirus disease. Elsevier, Amsterdam, The Netherlands.
|
| 9.
|
Clark-Lewis, I.,
B. Dewald,
M. Loetscher,
B. Moser, and M. Baggiolini.
1994.
Structural requirements for interleukin-8 function identified by design of analogs and CXC chemokine hybrids.
J. Biol. Chem.
269:16075-16081[Abstract/Free Full Text].
|
| 10.
|
Clark-Lewis, I.,
K. S. Kim,
K. Rajarathnam,
J. H. Gong,
B. Dewald,
B. Moser,
M. Baggiolini, and B. D. Sykes.
1995.
Structure-activity relationships of chemokines.
J. Leukoc. Biol.
57:703-711[Abstract].
|
| 11.
|
Collins, P. D.,
P. J. Jose, and T. J. Williams.
1991.
The sequential generation of neutrophil chemoattractant proteins in acute inflammation in the rabbit in vivo. Relationship between C5a and proteins with the characteristics of IL-8/neutrophil-activating protein 1.
J. Immunol.
146:677-684[Abstract].
|
| 12.
|
Collins, T. M.,
M. R. Quirk, and M. C. Jordan.
1994.
Biphasic viremia and viral gene expression in leukocytes during acute cytomegalovirus infection of mice.
J. Virol.
68:6305-6311[Abstract/Free Full Text].
|
| 13.
|
Dairaghi, D. J.,
R. A. Fan,
B. E. McMaster,
M. R. Hanley, and T. J. Schall.
1999.
HHV8-encoded vMIP-I selectively engages chemokine receptor CCR8. Agonist and antagonist profiles of viral chemokines.
J. Biol. Chem.
274:21569-21574[Abstract/Free Full Text].
|
| 14.
|
Dairaghi, D. J.,
D. R. Greaves, and T. J. Schall.
1998.
Abduction of chemokine elements by herpesviruses.
Semin. Virol.
8:377-385[CrossRef].
|
| 15.
|
Damon, I.,
P. M. Murphy, and B. Moss.
1998.
Broad spectrum chemokine antagonistic activity of a human poxvirus chemokine homolog.
Proc. Natl. Acad. Sci. USA
95:6403-6407[Abstract/Free Full Text].
|
| 16.
|
Endres, M. J.,
C. G. Garlisi,
H. Xiao,
L. Shan, and J. A. Hedrick.
1999.
The Kaposi's sarcoma-related herpesvirus (KSHV)-encoded chemokine vMIP-I is a specific agonist for the CC chemokine receptor (CCR)8.
J. Exp. Med.
189:1993-1998[Abstract/Free Full Text].
|
| 17.
|
Farrell, H. E.,
H. Vally,
D. M. Lynch,
P. Fleming,
G. R. Shellam,
A. A. Scalzo, and N. J. Davis-Poynter.
1997.
Inhibition of natural killer cells by a cytomegalovirus MHC class I homologue in vivo.
Nature
386:510-514[CrossRef][Medline].
|
| 18.
|
Feinberg, A. P., and B. Vogelstein.
1984.
A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity.
Anal. Biochem.
137:266-267[CrossRef][Medline].
|
| 19.
|
Fleming, P.,
N. Davis-Poynter,
M. Degli-Esposti,
E. Densley,
J. Papadimitriou,
G. Shellam, and H. Farrell.
1999.
The murine cytomegalovirus chemokine homolog, m131/129, is a determinant of viral pathogenicity.
J. Virol.
73:6800-6809[Abstract/Free Full Text].
|
| 20.
|
Gao, J. L., and P. M. Murphy.
1994.
Human cytomegalovirus open reading frame US28 encodes a functional beta chemokine receptor.
J. Biol. Chem.
269:28539-28542[Abstract/Free Full Text].
|
| 21.
|
Gerna, G.,
D. Zipeto,
E. Percivalle,
M. Parea,
M. G. Revello,
R. Maccario,
G. Peri, and G. Milanesi.
1992.
Human cytomegalovirus infection of the major leukocyte subpopulations and evidence for initial viral replication in polymorphonuclear leukocytes from viremic patients.
J. Infect. Dis.
166:1236-1244[Medline].
|
| 22.
|
Hengel, H.,
W. Brune, and U. H. Koszinowski.
1998.
Immune evasion by cytomegalovirus-survival strategies of a highly adapted opportunist.
Trends Microbiol.
6:190-197[CrossRef][Medline].
|
| 23.
|
Hengel, H.,
U. Reusch,
A. Gutermann,
H. Ziegler,
S. Jonjic,
P. Lucin, and U. H. Koszinowski.
1999.
Cytomegaloviral control of MHC class I function in the mouse.
Immunol. Rev.
168:167-176[CrossRef][Medline].
|
| 24.
|
Ho, M.
1991.
Cytomegalovirus: biology and infection, 2nd ed., p. 327-353.
Plenum Publishing Corp., New York, N.Y.
|
| 25.
|
Jones, T. R., and L. Sun.
1997.
Human cytomegalovirus US2 destabilizes major histocompatibility complex class I heavy chains.
J. Virol.
71:2970-2979[Abstract/Free Full Text].
|
| 26.
|
Kledal, T. N.,
M. M. Rosenkilde,
F. Coulin,
G. Simmons,
A. H. Johnsen,
S. Alouani,
C. A. Power,
H. R. Luttichau,
J. Gerstoft,
P. R. Clapham,
I. Clark-Lewis,
T. N. C. Wells, and T. W. Schwartz.
1997.
A broad-spectrum chemokine antagonist encoded by Kaposi's sarcoma-associated herpesvirus.
Science
277:1656-1659[Abstract/Free Full Text].
|
| 27.
|
Koszinowski, U. H.,
M. del Val, and M. J. Reddehase.
1990.
Cellular and molecular basis of the protective immune response to cytomegalovirus infection.
Curr. Top. Microbiol. Immunol.
154:189-220[Medline].
|
| 28.
|
Krathwohl, M. D.,
R. Hromas,
D. R. Brown,
H. E. Broxmeyer, and K. H. Fife.
1997.
Functional characterization of the CC chemokine-like molecules encoded by molluscum contagiosum virus types 1 and 2.
Proc. Natl. Acad. Sci. USA
94:9875-9880[Abstract/Free Full Text].
|
| 29.
|
Lalani, A. S.,
J. W. Barrett, and G. McFadden.
2000.
Modulating chemokines: more lessons from viruses.
Immunol. Today
21:100-106[CrossRef][Medline].
|
| 30.
|
Lee, L. F.,
P. Wu,
D. Sui,
D. Ren,
J. Kamil,
H. J. Kung, and R. L. Witter.
2000.
The complete unique long sequence and the overall genomic organization of the GA strain of Marek's disease virus.
Proc. Natl. Acad. Sci. USA
97:6091-6096[Abstract/Free Full Text].
|
| 31.
|
Leong, C. C.,
T. L. Chapman,
P. J. Bjorkman,
D. Formankova,
E. S. Mocarski,
J. H. Phillips, and L. L. Lanier.
1998.
Modulation of natural killer cell cytotoxicity in human cytomegalovirus infection: the role of endogenous class I major histocompatibility complex and a viral class I homolog.
J. Exp. Med.
187:1681-1687[Abstract/Free Full Text].
|
| 32.
|
Lin, Y.-C.
1997.
Ph.D. thesis.
Stanford University, Stanford, Calif.
|
| 33.
|
Liu, J. L.,
S. F. Lin,
L. Xia,
P. Brunovskis,
D. Li,
I. Davidson,
L. F. Lee, and H. J. Kung.
1999.
MEQ and V-IL8: cellular genes in disguise?
Acta Virol.
43:94-101[Medline].
|
| 34.
|
Loetscher, P.,
M. Seitz,
I. Clark-Lewis,
M. Baggiolini, and B. Moser.
1996.
Activation of NK cells by CC chemokines. Chemotaxis, Ca2+ mobilization, and enzyme release.
J. Immunol.
156:322-327[Abstract].
|
| 35.
|
MacDonald, M. R.,
M. W. Burney,
S. B. Resnick, and H. I. Virgin.
1999.
Spliced mRNA encoding the murine cytomegalovirus chemokine homolog predicts a beta chemokine of novel structure.
J. Virol.
73:3682-3691[Abstract/Free Full Text].
|
| 36.
|
MacDonald, M. R.,
X. Y. Li, and H. W. Virgin, IV.
1997.
Late expression of a beta chemokine homolog by murine cytomegalovirus.
J. Virol.
71:1671-1678[Abstract/Free Full Text].
|
| 37.
|
Manning, W. C.,
C. A. Stoddart,
L. A. Lagenaur,
G. B. Abenes, and E. S. Mocarski.
1992.
Cytomegalovirus determinant of replication in salivary glands.
J. Virol.
66:3794-3802[Abstract/Free Full Text].
|
| 38.
|
McFadden, G.,
A. Lalani,
H. Everett,
P. Nash, and X. Xu.
1998.
Virus-encoded receptors for cytokines and chemokines.
Semin. Cell Dev. Biol.
9:359-368[CrossRef][Medline].
|
| 39.
|
Mocarski, E. S., and C. T. Courcelle.
2001.
Cytomegaloviruses and their replication, p. 2629-2673.
In
D. M. Knipe, and P. M. Howley (ed.), Fields virology, 4th ed. Lippincott-Williams & Wilkins, Philadelphia, Pa.
|
| 40.
|
Moore, P. S.,
C. Boshoff,
R. A. Weiss, and Y. Chang.
1996.
Molecular mimicry of human cytokine and cytokine response pathway genes by KSHV.
Science
274:1739-1744[Abstract/Free Full Text].
|
| 41.
|
Neote, K.,
D. DiGregorio,
J. Y. Mak,
R. Horuk, and T. J. Schall.
1993.
Molecular cloning, functional expression, and signaling characteristics of a C-C chemokine receptor.
Cell
72:415-425[CrossRef][Medline].
|
| 42.
|
Pass, R. F.
2001.
Cytomegalovirus, p. 2675-2705.
In
D. M. Knipe, and P. M. Howley (ed.), Fields virology, 4th ed. Lippincott-Williams & Wilkins, Philadelphia, Pa.
|
| 43.
|
Penfold, M. E.,
D. J. Dairaghi,
G. M. Duke,
N. Saederup,
E. S. Mocarski,
G. W. Kemble, and T. J. Schall.
1999.
Cytomegalovirus encodes a potent alpha chemokine.
Proc. Natl. Acad. Sci. USA
96:9839-9844[Abstract/Free Full Text].
|
| 44.
|
Prichard, M. N.,
G. M. Duke, and E. S. Mocarski.
1996.
Human cytomegalovirus uracil DNA glycosylase is required for the normal temporal regulation of both DNA synthesis and viral replication.
J. Virol.
70:3018-3025[Abstract/Free Full Text].
|
| 45.
|
Rajarathnam, K.,
B. D. Sykes,
B. Dewald,
M. Baggiolini, and I. Clark-Lewis.
1999.
Disulfide bridges in interleukin-8 probed using non-natural disulfide analogues: dissociation of roles in structure from function.
Biochemistry
38:7653-7658[CrossRef][Medline].
|
| 46.
|
Rawlinson, W. D.,
H. E. Farrell, and B. G. Barrell.
1996.
Analysis of the complete DNA sequence of murine cytomegalovirus.
J. Virol.
70:8833-8849[Abstract/Free Full Text].
|
| 47.
|
Reyburn, H. T.,
O. Mandelboim,
M. Vales-Gomez,
D. M. Davis,
L. Pazmany, and J. L. Strominger.
1997.
The class I MHC homologue of human cytomegalovirus inhibits attack by natural killer cells.
Nature
386:514-517[CrossRef][Medline].
|
| 48.
|
Rossi, D., and A. Zlotnik.
2000.
The biology of chemokines and their receptors.
Annu. Rev. Immunol.
18:217-242[CrossRef][Medline].
|
| 49.
|
Saederup, N.,
Y. C. Lin,
D. J. Dairaghi,
T. J. Schall, and E. S. Mocarski.
1999.
Cytomegalovirus-encoded beta chemokine promotes monocyte-associated viremia in the host.
Proc. Natl. Acad. Sci. USA
96:10881-10886[Abstract/Free Full Text].
|
| 50.
|
Sallusto, F.,
C. R. Mackay, and A. Lanzavecchia.
2000.
The role of chemokine receptors in primary, effector, and memory immune responses.
Annu. Rev. Immunol.
18:593-620[CrossRef][Medline].
|
| 51.
|
Saltzman, R. L.,
M. R. Quirk, and M. C. Jordan.
1988.
Disseminated cytomegalovirus infection. Molecular analysis of virus and leukocyte interactions in viremia.
J. Clin. Investig.
81:75-81.
|
| 52.
|
Smith, G. L.,
J. A. Symons,
A. Khanna,
A. Vanderplasschen, and A. Alcami.
1997.
Vaccinia virus immune evasion.
Immunol. Rev.
159:137-154[CrossRef][Medline].
|
| 53.
|
Spriggs, M. K.
1996.
One step ahead of the game: viral immunomodulatory molecules.
Annu. Rev. Immunol.
14:101-130[CrossRef][Medline].
|
| 54.
|
Stine, J. T.,
C. Wood,
M. Hill,
A. Epp,
C. J. Raport,
V. L. Schweickart,
Y. Endo,
T. Sasaki,
G. Simmons,
C. Boshoff,
P. Clapham,
Y. Chang,
P. Moore,
P. W. Gray, and D. Chantry.
2000.
KSHV-encoded CC chemokine vMIP-III is a CCR4 agonist, stimulates angiogenesis, and selectively chemoattracts TH2 cells.
Blood
95:1151-1157[Abstract/Free Full Text].
|
| 55.
|
Stoddart, C. A.,
R. D. Cardin,
J. M. Boname,
W. C. Manning,
G. B. Abenes, and E. S. Mocarski.
1994.
Peripheral blood mononuclear phagocytes mediate dissemination of murine cytomegalovirus.
J. Virol.
68:6243-6253[Abstract/Free Full Text].
|
| 56.
|
Streblow, D. N.,
C. Soderberg-Naucler,
J. Vieira,
P. Smith,
E. Wakabayashi,
F. Ruchti,
K. Mattison,
Y. Altschuler, and J. A. Nelson.
1999.
The human cytomegalovirus chemokine receptor US28 mediates vascular smooth muscle cell migration.
Cell
99:511-520[CrossRef][Medline].
|
| 57.
|
Takebe, Y.,
M. Seiki,
J. Fujisawa,
P. Hoy,
K. Yokota,
K. Arai,
M. Yoshida, and N. Arai.
1988.
SR alpha promoter: an efficient and versatile mammalian cDNA expression system composed of the simian virus 40 early promoter and the R-U5 segment of human T-cell leukemia virus type 1 long terminal repeat.
Mol. Cell. Biol.
8:466-472[Abstract/Free Full Text].
|
| 58.
|
Taub, D. D.,
J. R. Ortaldo,
S. M. Turcovski-Corrales,
M. L. Key,
D. L. Longo, and W. J. Murphy.
1996.
Beta chemokines costimulate lymphocyte cytolysis, proliferation, and lymphokine production.
J. Leukoc. Biol.
59:81-89[Abstract].
|
| 59.
|
van Den Pol, A. N.,
E. Mocarski,
N. Saederup,
J. Vieira, and T. J. Meier.
1999.
Cytomegalovirus cell tropism, replication, and gene transfer in brain.
J. Neurosci.
19:10948-10965[Abstract/Free Full Text].
|
| 60.
|
Vieira, J.,
H. E. Farrell,
W. D. Rawlinson, and E. S. Mocarski.
1994.
Genes in the HindIII J fragment of the murine cytomegalovirus genome are dispensable for growth in cultured cells: insertion mutagenesis with a lacZ/gpt cassette.
J. Virol.
68:4837-4846[Abstract/Free Full Text].
|
| 61.
|
Wiertz, E.,
A. Hill,
D. Tortorella, and H. Ploegh.
1997.
Cytomegaloviruses use multiple mechanisms to elude the host immune response.
Immunol. Lett.
57:213-216[CrossRef][Medline].
|
| 62.
|
Wilson, S. D.,
V. K. Kuchroo,
D. I. Israel, and M. E. Dorf.
1990.
Expression and characterization of TCA3: a murine inflammatory protein.
J. Immunol.
145:2745-2750[Abstract].
|
| 63.
|
Witt, D. P., and A. D. Lander.
1994.
Differential binding of chemokines to glycosaminoglycan subpopulations.
Curr. Biol.
4:394-400[CrossRef][Medline].
|
| 64.
|
Wolpe, S. D.,
G. Davatelis,
B. Sherry,
B. Beutler,
D. G. Hesse,
H. T. Nguyen,
L. L. Moldawer,
C. F. Nathan,
S. F. Lowry, and A. Cerami.
1988.
Macrophages secrete a novel heparin-binding protein with inflammatory and neutrophil chemokinetic properties.
J. Exp. Med.
167:570-581[Abstract/Free Full Text].
|
| 65.
|
Wolpe, S. D.,
B. Sherry,
D. Juers,
G. Davatelis,
R. W. Yurt, and A. Cerami.
1989.
Identification and characterization of macrophage inflammatory protein 2.
Proc. Natl. Acad. Sci. USA
86:612-616[Abstract/Free Full Text].
|
| 66.
|
Wuyts, A.,
N. Van Osselaer,
A. Haelens,
I. Samson,
P. Herdewijn,
A. Ben-Baruch,
J. J. Oppenheim,
P. Proost, and J. Van Damme.
1997.
Characterization of synthetic human granulocyte chemotactic protein 2: usage of chemokine receptors CXCR1 and CXCR2 and in vivo inflammatory properties.
Biochemistry
36:2716-2723[CrossRef][Medline].
|
| 67.
|
Zou, P.,
Y. Isegawa,
K. Nakano,
M. Haque,
Y. Horiguchi, and K. Yamanishi.
1999.
Human herpesvirus 6 open reading frame U83 encodes a functional chemokine.
J. Virol.
73:5926-5933[Abstract/Free Full Text].
|
Journal of Virology, October 2001, p. 9966-9976, Vol. 75, No. 20
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.20.9966-9976.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Cardin, R. D., Schaefer, G. C., Allen, J. R., Davis-Poynter, N. J., Farrell, H. E.
(2009). The M33 Chemokine Receptor Homolog of Murine Cytomegalovirus Exhibits a Differential Tissue-Specific Role during In Vivo Replication and Latency. J. Virol.
83: 7590-7601
[Abstract]
[Full Text]
-
Stern, J. L., Slobedman, B.
(2008). Human Cytomegalovirus Latent Infection of Myeloid Cells Directs Monocyte Migration by Up-Regulating Monocyte Chemotactic Protein-1. J. Immunol.
180: 6577-6585
[Abstract]
[Full Text]
-
Frascaroli, G., Varani, S., Mastroianni, A., Britton, S., Gibellini, D., Rossini, G., Landini, M. P., Soderberg-Naucler, C.
(2006). Dendritic cell function in cytomegalovirus-infected patients with mononucleosis. J. Leukoc. Biol.
79: 932-940
[Abstract]
[Full Text]
-
Dewin, D. R., Catusse, J., Gompels, U. A.
(2006). Identification and Characterization of U83A Viral Chemokine, a Broad and Potent {beta}-Chemokine Agonist for Human CCRs with Unique Selectivity and Inhibition by Spliced Isoform. J. Immunol.
176: 544-556
[Abstract]
[Full Text]
-
Noda, S., Aguirre, S. A., Bitmansour, A., Brown, J. M., Sparer, T. E., Huang, J., Mocarski, E. S.
(2006). Cytomegalovirus MCK-2 controls mobilization and recruitment of myeloid progenitor cells to facilitate dissemination. Blood
107: 30-38
[Abstract]
[Full Text]
-
Cicin-Sain, L., Podlech, J., Messerle, M., Reddehase, M. J., Koszinowski, U. H.
(2005). Frequent Coinfection of Cells Explains Functional In Vivo Complementation between Cytomegalovirus Variants in the Multiply Infected Host. J. Virol.
79: 9492-9502
[Abstract]
[Full Text]
-
Redwood, A. J., Messerle, M., Harvey, N. L., Hardy, C. M., Koszinowski, U. H., Lawson, M. A., Shellam, G. R.
(2005). Use of a Murine Cytomegalovirus K181-Derived Bacterial Artificial Chromosome as a Vaccine Vector for Immunocontraception. J. Virol.
79: 2998-3008
[Abstract]
[Full Text]
-
Varani, S., Frascaroli, G., Homman-Loudiyi, M., Feld, S., Landini, M. P., Soderberg-Naucler, C.
(2005). Human cytomegalovirus inhibits the migration of immature dendritic cells by down-regulating cell-surface CCR1 and CCR5. J. Leukoc. Biol.
77: 219-228
[Abstract]
[Full Text]
-
Paulsen, S. J., Rosenkilde, M. M., Eugen-Olsen, J., Kledal, T. N.
(2005). Epstein-Barr Virus-Encoded BILF1 Is a Constitutively Active G Protein-Coupled Receptor. J. Virol.
79: 536-546
[Abstract]
[Full Text]
-
Bolovan-Fritts, C. A., Trout, R. N., Spector, S. A.
(2004). Human Cytomegalovirus-Specific CD4+-T-Cell Cytokine Response Induces Fractalkine in Endothelial Cells. J. Virol.
78: 13173-13181
[Abstract]
[Full Text]
-
Hahn, G., Revello, M. G., Patrone, M., Percivalle, E., Campanini, G., Sarasini, A., Wagner, M., Gallina, A., Milanesi, G., Koszinowski, U., Baldanti, F., Gerna, G.
(2004). Human Cytomegalovirus UL131-128 Genes Are Indispensable for Virus Growth in Endothelial Cells and Virus Transfer to Leukocytes. J. Virol.
78: 10023-10033
[Abstract]
[Full Text]
-
Slobedman, B., Stern, J. L., Cunningham, A. L., Abendroth, A., Abate, D. A., Mocarski, E. S.
(2004). Impact of Human Cytomegalovirus Latent Infection on Myeloid Progenitor Cell Gene Expression. J. Virol.
78: 4054-4062
[Abstract]
[Full Text]
-
Hertel, L., Lacaille, V. G., Strobl, H., Mellins, E. D., Mocarski, E. S.
(2003). Susceptibility of Immature and Mature Langerhans Cell-Type Dendritic Cells to Infection and Immunomodulation by Human Cytomegalovirus. J. Virol.
77: 7563-7574
[Abstract]
[Full Text]
-
Akter, P., Cunningham, C., McSharry, B. P., Dolan, A., Addison, C., Dargan, D. J., Hassan-Walker, A. F., Emery, V. C., Griffiths, P. D., Wilkinson, G. W. G., Davison, A. J.
(2003). Two novel spliced genes in human cytomegalovirus. J. Gen. Virol.
84: 1117-1122
[Abstract]
[Full Text]
-
Cavanaugh, V. J., Deng, Y., Birkenbach, M. P., Slater, J. S., Campbell, A. E.
(2003). Vigorous Innate and Virus-Specific Cytotoxic T-Lymphocyte Responses to Murine Cytomegalovirus in the Submaxillary Salivary Gland. J. Virol.
77: 1703-1717
[Abstract]
[Full Text]
-
Tsutsui, Y., Kawasaki, H., Kosugi, I.
(2002). Reactivation of Latent Cytomegalovirus Infection in Mouse Brain Cells Detected after Transfer to Brain Slice Cultures. J. Virol.
76: 7247-7254
[Abstract]
[Full Text]