Previous Article | Next Article 
Journal of Virology, October 2001, p. 9819-9827, Vol. 75, No. 20
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.20.9819-9827.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
African Swine Fever Virus Protein p54 Interacts
with the Microtubular Motor Complex through Direct Binding to
Light-Chain Dynein
Covadonga
Alonso,1,*
James
Miskin,2
Bruno
Hernáez,1
Patricia
Fernandez-Zapatero,1
Lourdes
Soto,1
Carmen
Cantó,1
Ignacio
Rodríguez-Crespo,3
Linda
Dixon,2 and
José M.
Escribano1
Departamento de Biotecnología,
Instituto Nacional de Investigación y Tecnología Agraria
y Alimentaria (INIA),1 and Departamento
de Bioquímica y Biología Molecular, Facultad de
Químicas, Universidad Complutense,
Madrid,3 Spain, and Institute for Animal
Health, Pirbright GU24 ONF, United Kingdom2
Received 2 April 2001/Accepted 5 July 2001
 |
ABSTRACT |
Dynein is a minus-end-directed microtubule-associated motor protein
involved in cargo transport in the cytoplasm. African swine fever virus
(ASFV), a large DNA virus, hijacks the microtubule motor complex
cellular transport machinery during virus infection of the cell through
direct binding of virus protein p54 to the light chain of cytoplasmic
dynein (LC8). Interaction of p54 and LC8 occurs both in vitro and in
cells, and the two proteins colocalize at the microtubular organizing
center during viral infection. p50/dynamitin, a dominant-negative
inhibitor of dynein-dynactin function, impeded ASFV infection,
suggesting an essential role for dynein during virus infection. A
13-amino-acid domain of p54 was sufficient for binding to LC8, an SQT
motif within this domain being critical for this binding. Direct
binding of a viral structural protein to LC8, a small molecule of the
dynein motor complex, could constitute a molecular mechanism for
microtubule-mediated virus transport.
 |
INTRODUCTION |
Dynein is part of a large
enzyme complex responsible for intracellular movement associated with
microtubules (31, 32). Intracellular movement of
membrane-bound organelles is linked to molecular motors; cytoplasmic
dynein and kinesin are believed to be responsible for organelle
movement in opposite directions along microtubules (11).
Microtubules appear to project from a single perinuclear spot, the
microtubular organizing center (MTOC), as the microtubule filaments
radiate from this area. During mitosis it is called a centrosome and is
responsible for the formation of the mitotic spindle. Cytoplasmic
dynein mediates the return of vesicles to the microtubular organizing
center and retains the vesicles at this cell location
(23). The bidirectional nature of microtubule movement
provides a shuttle transport to relocate organelles, endosomes,
lysosomes, the Golgi apparatus (25), and also mRNA
(15, 51). Cytoplasmic dyneins are part of a small family
of minus-end-directed, microtubule-based motors implicated in organelle
transport processes. These enzymes must contain motor, cargo-binding,
and regulatory components (24, 30). The ATPase and
microtubule motor domains are located within the large dynein heavy
chains that form the globular heads and stems of the complex (59). Cargo-binding activity involves the intermediate
chains and several classes of light chains that associate in a
subcomplex at the base of the soluble dynein particle. Regulatory
control involves phosphorylation of light-chain proteins associated
with the heavy chains. LC8 cytoplasmic dynein exists in situ as a dimer (4, 49). The X-ray crystal structure of the LC8 dimer in complex with a 12-residue peptide from neuronal nitric oxide synthase (nNOS) has been solved, and the binding site is located in a
pocket-forming concave surface (35).
A set of proteins have been described to bind LC8, although the
sequence determinants needed for LC8 binding remain obscure (28,
35, 49). Virus entry into host cells requires targeting of their
genome and accessory proteins across the plasma membrane and to the
correct cellular compartment for viral replication to proceed. The
involvement of microtubules in virus transport has been reported for a
number of viruses (34, 52, 53, 62). Microtubule transport
mediated by binding to microtubular motors has been described for
adenovirus and herpes simplex virus. Adenovirus binds dynein
intermediate chain through an adapter GTP-protein (34,
36). Herpes simplex virus protein UL34
binds dynein intermediate chain (62), and two lyssavirus
proteins have been reported to bind the light chain of cytoplasmic
dynein LC8 (26, 46).
Microtubule transport has also been described for vaccinia virus
(41) and African swine fever virus (ASFV) (7,
10). ASFV is an enveloped icosahedral deoxyvirus which causes a
devastating disease of swine (12, 56, 58). The virus
genome is double-stranded DNA about 170 kb long and encodes about 150 open reading frames. ASFV is the only member of a new family of viruses
called Asfarviridae. It replicates mainly in the cytoplasm
in perinuclear factory areas, although some early DNA replication
occurs in the nucleus (17). p30 and p54 are externally
located virus proteins (20, 48) of 30 and 25 kDa, encoded
by the virus genes CP204L and E183L, respectively (47,
61). Protein p54 is a late virus protein that is essential for
virus replication, is incorporated into the external envelope of
virions (47, 48), and participates in the first stages of
virus infection (20). ASFV perinuclear location of the
viral factory was related to microtubules, as it was inhibited by
colchicine (7). In the present work we demonstrate that
ASFV interacts with the dynein motor complex through the structural
virus protein p54. The ASFV interaction with microtubular motor protein
LC8 through p54 protein could represent one of a number of viral
strategies to take advantage of cellular functions and ensure efficient
virus transport and replication.
 |
MATERIALS AND METHODS |
Yeast two-hybrid and mutational analysis.
A fragment
encoding the ASFV p54 gene downstream from the predicted transmembrane
domain to the C terminus (residues 52 to 183) was cloned in pGBT9
(Clontech) and used to screen a pig macrophage cDNA library
(37) using the yeast two-hybrid system (16). Clones encoding interacting proteins were selected on medium lacking histidine and by expression of
-galactosidase (
-gal). The
sequence of inserts was determined. Smaller fragments of the p54 gene
were cloned in pGBT9 and similarly tested for interaction with LC8 dynein. A library containing random amino acid substitutions in the p54
gene fragment (residues 52 to 183) between residues 149 and 161 was
constructed. The mutants encoded either the wild-type (YTTVTTQNTASQT)
or a mutant residue at each position. The fully mutated sequence was
SSSGSSHSSGPHS. This was achieved by amplifying the COOH-terminal region
of p54 (residues 139 to 183) by PCR using the degenerate PCR primer
AAAGCGGCCGCGAGTGCTCATCCGACTGAGCCTT(AC)C(AT)CG(AT)CAG(GT)C(AT)CT(AT)CTCA(GC)A(AG)C(AT)CGT(GC)T(CT)CACA(AC)(AT)CAATGTCGGC and a 3'-end primer; digestion with NotI
(NotI site shown in boldface), and ligation to the wild-type
NH2-terminal fragment (residues 52 to 138), which
was also digested with NotI and cloned in pGBT9. This
library of mutants was transformed into yeast cells and tested for
interaction with LC8 dynein. Individual point mutations were similarly
constructed using the appropriate double-stranded oligonucleotide.
Interaction studies.
LC8 was expressed as a 6His-tagged
protein (pET-LC8) and linked to a
Ni2+-nitrilotriacetic acid (NTA)-agarose column
(Qiagen). Insect cell extracts containing p54 overexpressed in a
baculovirus vector were passed through the column (20).
After extensive washing of columns with 30 mM Tris-100 mM NaCl (pH 7),
retained and control proteins were eluted with 200 mM imidazole.
Western blot analyses of eluted fractions were carried out with
anti-p54 and anti-LC8 dynein antibodies (see below). Purified LC8
dynein cloned in plasmid pET-23a+ (Novogen) and expressed in
Escherichia coli was incubated with the
baculovirus-expressed p54 at 4°C for 2 h and then
immunoprecipitated with monospecific affinity-purified pig antibodies
against p54 or preimmune pig serum conjugated with protein A-Sepharose
beads (Pharmacia). Immunocomplexes were analyzed by Western blot with specific anti-LC8 dynein serum.
Antibodies and immunofluorescence.
Vero cells were grown in
chamber slides (Lab-Tek; Nunc), approximately 1.5 × 104 cells/chamber, allowed to attach, and then
mock infected or infected with ASFV strain BA71V at a multiplicity of
infection (MOI) of 1 to 10 and then fixed with acetone-methanol (1:1)
for immunofluorescence analyses.
An affinity-purified rabbit antibody raised against LC8 dynein (R4058)
was kindly supplied by S. King (31, 32) and used at a
1:200 dilution. Other antibodies used were a mouse monoclonal anti-c-Myc antibody (Clontech), actin phalloidin-fluorescein
isothiocyanate (FITC) and anti-
-tubulin-indocarbocyanine (Cy3)
conjugate (Sigma). Secondary antibodies used were Alexa 488-, rhodamine-, and Cy3-conjugated sheep anti-rabbit or goat anti-mouse
immunoglobulin (Ig) antibodies (Sigma). A monospecific antiserum
against p54 was raised in pigs using E. coli-expressed
protein as the immunogen. Hyperimmune serum from a pig infected with
the virus strain 1207 was used to detect ASFV. Both were visualized
with 1:100 protein A-Alexa 488 fluor (Molecular Probes). Anti-p30 and
anti-p72 antisera were obtained from pigs immunized against each
recombinant protein produced in a baculovirus system. Specificity of
labeling and absence of signal crossover were established by
examination of singly labeled control samples. Conventional microscopy
was carried out in a Leica photomicroscope with a digital camera, and
digitized images were obtained with Qwin program (Leica). Confocal
microscopy was carried out on an MRC1024 system (Bio-Rad) mounted on a
Nikon Eclipse 300 microscope. Statistical analysis of colocalization was performed using Lasersharp Processing 3.2 program (Bio-Rad).
Infections, drug treatments, and transfections.
For virus
titrations in the presence or absence of specific inhibitors, a
recombinant ASFV expressing the
-galactosidase marker gene
(BA71
-gal) (20) was used in Vero cells.
Nocodazole, a microtubule inhibitor, was used dissolved in dimethyl
sulfoxide and added to the culture medium to a final concentration
of
10 µM or 1 µM. Brefeldin A was used at 5 µg/ml in methanol
as an
inhibitor of the endoplasmic reticulum (ER)-Golgi and trans-Golgi
network secretory pathway. Sodium orthovanadate
(Na
3VO
4), a tyrosine
phosphatase inhibitor (
21,
60), was used at 100 µM or 10 µM
in Dulbecco's modified Eagle's medium. Controls were
simultaneously
treated with solvents. Microtubule depolymerization was
assessed
with antitubulin-Cy3 staining of cells. Inhibitors did not
affect
cell viability, as tested by trypan blue staining. In a set of
experiments, the inhibitors were added 2 h prior to infection
at
an MOI of 1. Then, virus was adsorbed to cells 4°C, and the
cells
were washed and incubated at 37°C for 48 h in the presence
of
each concentration of inhibitor. In a second set of experiments
the
inhibitor was added when infection had proceeded for 6 h.
Cells
and supernatants were collected after 48 h to determine
the
extracellular or cell-associated virus production as described
(
20). Early and late viral protein synthesis under
different
inhibitor concentrations was evaluated by Western blotting
using
antisera against early and late ASFV
proteins.
For transient expression, full-length p54 was cloned into the
expression vector pCMV (Clontech) and transfected into Vero
cells using
Lipofectamine 2000 transfection reagent (Gibco-BRL)
according to the
manufacturer's recommendations. To analyze the
essential role of LC8
in ASFV infection, cells were transfected
with a Myc-tagged
p50/dynamitin expression construct (in plasmid
pCMV) (
13)
and then infected 24 h later with the Ba71V ASFV,
analyzing virus
protein expression 24 h later (positive or negative
cells). Cells
were analyzed for expression of ASFV early or late
proteins and
p50/dynamitin by double immunofluorescence labeling.
To carry out the
experiment, specific pig antisera against the
early p30 ASFV protein
and late virus proteins p54 and p72 were
used. Antibodies reacting with
ASFV proteins were revealed with
protein A-Alexa 488 fluor (green
fluorescence; Molecular Probes).
To detect p50/dynamitin-c-Myc
expression, an anti-c-Myc monoclonal
antibody with anti-mouse
Ig-rhodamine was used. Cell samples were
observed using confocal
microscopy.
 |
RESULTS |
Interaction of ASFV p54 protein with LC8 of cytoplasmic
dynein.
Previous results have shown that ASFV protein p54 is an
essential virus protein involved in the early steps of viral infection (20, 48). p54 sequence resembles cytoskeletal proteins
such as microtubule-associated proteins of 190 kDa (human and bovine) in containing a Pro-, Ala-, and Thr-rich domain with tandem repeats keeping the distance between prolines constant (1, 47). We identified cellular proteins that bind to p54 protein using the yeast
two-hybrid system. A p54 gene fragment encoding the C-terminal part of
the protein trimmed from the transmembrane domain was used to screen a
porcine macrophage cDNA library. Four clones identical in size and
composition were isolated encoding p54-interacting host proteins, which
contained cDNAs encoding the light chain of cytoplasmic dynein, LC8. We
confirmed the specific and direct interaction of p54 with LC8 in vitro
by affinity chromatography. Recombinant p54 from baculovirus-infected
cells interacted directly with hexahistidine-tagged LC8 bound to
Ni-NTA-agarose resin, and the complex could subsequently be
eluted with 200 mM imidazole. The eluted fractions were positive with
anti-p54 (Fig. 1a) and anti-LC8 dynein
antibodies (Fig. 1b). LC8 dynein-p54 complex was also efficiently
pulled down by Sepharose beads linked to p54-specific antibodies (Fig.
1c), confirming the specific interaction between p54 and LC8.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 1.
Specificity of p54-LC8 dynein binding. Detection by
Western blotting of protein p54 retained by His-tagged LC8 dynein
linked to nickel-agarose columns. The fractions eluted from the
affinity column were electrophoresed in 5 to 15% acrylamide gels,
transferred to nitrocellulose filters, and probed with specific
antisera. (a) Lanes 1 and 2 show the absence of p54 in eluted fractions
after extensive washing of the column with washing buffer. Lanes 3 to 5 show detection of p54 protein eluted with 200 mM imidazole. (b) LC8
dynein detected by Western blotting in the same eluted fractions
using an antidynein serum. Controls of purified recombinant LC8 dynein
and baculovirus-expressed p54 are shown as a positive control
(C+). (c) Coimmunoprecipitation of purified recombinant LC8
dynein and p54 with anti-p54 linked to Sepharose-protein A. Lane 1, Western blot of recombinant purified LC8 dynein. Lanes 2 and 3, coimmunoprecipitations of LC8 and p54 detected with anti-p54 antibodies
and preimmune pig serum, respectively. LC8 dynein was detected using a
specific polyclonal serum. (d and e) Subcellular localization of p54
protein (Alexa 488) in green (d) and LC8 dynein-rhodamine (e), in cells
infected with ASFV at 24 h postinfection. (f) Colocalization of
LC8 dynein and p54 in MTOC. Colocalization percentages were 99% for
the viral protein and 75% for LC8 dynein. Magnification, ×100. (g and
h) Localization of p54 (Alexa 488) in green (g) and LC8 dynein revealed
with rhodamine (h) in Vero cells transfected with a plasmid expressing
full-length p54. (i) Colocalization of both proteins in the merged
image in yellow. Colocalization percentages were 99% for p54. Bar, 10 µm.
|
|
Subcellular localization of viral-cellular protein complex.
Confocal immunofluorescence microscopy was used to visualize the viral
and cellular protein complex during ASFV infection of Vero cells using
specific antibodies against LC8 and p54. p54 colocalized with
light-chain dynein LC8 at rates over 98% probability, in a perinuclear
location at the MTOC area (Fig. 1d to f). Sequential optical sections
along the z axis showed a peripheral location for p54 with a
central core of LC8 dynein (not shown).
Also, full-length p54 (pCMV-p54) transiently expressed in uninfected
Vero cells colocalized with LC8 dynein (>98% probability)
(Fig.
1g to
i), demonstrating that p54 interacts with LC8 dynein
in the absence of
other viral
proteins.
Mapping of LC8 binding region in p54.
Interactions between
different proteins with LC8 dynein have been characterized previously
and are mediated by a variety of amino acid sequence motifs. To
determine the residues of p54 required for LC8 binding, the yeast
two-hybrid system was used. Expression of several truncated fragments
of p54 as Gal4 binding domain (BD) fusions revealed that C-terminal
amino acids Y149 to T161 were sufficient for binding to LC8 (Fig.
2a-c). Random mutations were introduced
into this 13-amino-acid LC8-binding domain within the p54 gene fragment
(residues 52 to 183). A library of mutants was constructed in which the
p54 fragment could contain either a wild-type or mutant amino acid
residue at positions 149 to 161 (Fig. 2d). Mutant p54 proteins which
either bound or failed to bind LC8 in the yeast two-hybrid system were
selected, and the encoded p54 genes were sequenced. In the p54 mutants
which retained LC8 binding activity, no amino acid substitutions were
observed in 4 residues (the T-SQT motif between residues 157 and 161),
indicating that these were essential for binding function. Individual
point mutations were introduced at each of these residues, and
substitution of Q (160) or T (161) for A abolished binding, confirming
that these were essential. No binding was observed when S (159) residue
was replaced with P, but binding was observed when it was replaced with
A. Replacing T (157) residue with S or A did not affect binding, suggesting that this is not an essential part of the binding motif. We
conclude that the motif SQT (159 to 161) is critical for binding of p54
to LC8 but that some substitutions are possible at the S (159) residue,
thus establishing the minimal sequences required for its biological
function (Fig. 2). Using dodecapeptide libraries of various proteins
known to bind to LC8 synthesized on an amino-derivatized cellulose
membrane and by means of the pepscan technique (55), binding to this minimal stretch of p54 was also confirmed (not shown).

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 2.
Mapping of the LC8 binding region in p54. (a) Domain
structure of the p54 protein. The predicted transmembrane domain, basic
and acidic regions, and variable region encoding amino acid repeats are
indicated. (b) Deletion mutants of the p54 gene that were tested for
interaction with LC8 in the yeast two-hybrid system. (c) Amino acid
sequence of the minimal LC8 binding domain in p54 (residues 149 to 161)
with critical residues in bold (SQT). (d) Summary of data from analysis
of amino acid substitutions in the 149 to 161 LC8 binding domain of
p54. Mutants contained either the wild-type or a mutant residue at each
position between 149 and 161. Row 1 shows the wild-type amino acid
sequence; row 2 shows the fully mutated sequence. Mutants were tested
for binding to LC8 using the yeast two-hybrid system. Row 3 shows the
number of times a substitution to the wild-type residue was observed at
each position in non-LC8 binding mutants; row 4 shows the number of
substitutions at each position in LC8-binding mutants; row 5 indicates
point mutations which prevented LC8 binding; and row 6 indicates point
mutations which did not prevent LC8 binding. Row 7 indicates the
critical SQT motif needed for binding of p54 to LC8.
|
|
Relevance of microtubules and dynein motor complex in viral
infection.
Microtubules have been suggested to be important in the
molecular trafficking of ASFV to the perinuclear region during early stages of virus replication (7). Microtubule cytoskeleton
is formed by tubulin filaments that appear to project from a single perinuclear spot, markedly stained with antitubulin antibodies (Fig.
3a), the microtubular organizing center.
When microtubule depolymerization dismantled tubulin filaments after
nocodazole treatment (Fig. 3b), the production of extracellular and
intracellular virus at 48 h postinfection was significantly
reduced (Fig. 3c). Similar inhibition percentages of virus
production were observed by addition of nocodazole either 2 h
before infection or after virus internalization (6 h postinfection,
Fig. 3c). A greater than eightfold reduction in the amount of early
(p30) and late (p54) ASFV protein accumulation in infected cells as
detected by Western blotting was also observed in the presence of
inhibitors (not shown). These results suggest an important role for
microtubules in intracellular virus transport, since microtubule
dismantling severely impairs virus production.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 3.
Microtubule depolymerization influence on virus
production. (a and b) Microtubule cytoskeleton organized in filaments
irradiating from the microtubular organizing center, shown as a
perinuclear bright spot in untreated Vero cells (a) and Vero cells
after microtubule depolymerization with nocodazole (b). Panels a and b
were stained with a Cy3-labeled monoclonal anti- -tubulin antiserum.
(c) Effect of nocodazole on extracellular and intracellular ASFV
production at 48 h postinfection. The inhibition of virus
production from cells treated 2 h before infection or 6 h
postinfection is presented as a percentage of the untreated infected
control value. Solid and open bars represent extracellular and
intracellular virus inhibition, respectively, as described in the text.
This figure shows the mean inhibition values from three independent
experiments ± standard error. (d) Control uninfected Vero cells.
(e) Control cells infected with ASFV fixed at 24 h postinfection
in the absence of inhibitors. (f) Depolymerization of microtubules with
nocodazole caused dispersed cytoplasmic positive staining and loss of
perinuclear localization. (g) Brefeldin A was added 6 h after
infection, and perinuclear localization was maintained. Cells were
stained with anti-p54 antiserum and protein A-Alexa 488. Bar, 10 µm.
|
|
To detect virus proteins by immunofluorescence of infected cells
treated with different inhibitors, a hyperimmune serum against
ASFV and
antisera against early and late viral proteins were used
(Fig.
3d to
g). Instead of the characteristic accumulation of
virus proteins in the
perinuclear zone seen in untreated infected
cells (Fig.
3e), in cells
treated with nocodazole, virus proteins
were detected in a dispersed
pattern throughout the cytoplasm
(Fig.
3d). Perinuclear localization of
the viral proteins was
not modified with brefeldin A, an inhibitor of
ER-Golgi and trans-Golgi
transport in the secretory pathway (Fig.
3g).
Thus, alteration
of virus localization with nocodazole was not due to
an indirect
effect because of the role of microtubules in maintaining
localization
of organelles such as the Golgi
apparatus.
Microtubules seem to play a role in ASFV transport and localization of
the viral proteins at the perinuclear area. To confirm
that
microtubular motor dynein is essential for initiation of
ASFV
infection, cells were transfected with a Myc-tagged pCMV
plasmid
expressing p50/dynamitin 24 h before infection. p50/dynamitin
acts
as a dominant-negative inhibitor of dynein-dynactin function
(
13). p50/dynamitin expression was found in transfected
cells
(Fig.
4a and c to e). No
coexpression of both viral proteins and
p50/dynamitin was found in the
same cell. In control nontransfected
infected cultures, virus infection
was very efficient, and most
cells were infected and expressed virus
proteins (Fig.
4b). Nevertheless,
cells transfected with an unrelated
control plasmid (pCMV-

gal)
supported infection and showed double
staining for transfection
and infection markers (not shown). These
experiments suggested
that inhibition of dynein function blocks the
infection at a critical
early step of ASFV infection.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 4.
Disruption of the dynein-dynactin complex results in
inhibition of infection. (a, c, d, and e) A plasmid expressing
Myc-tagged p50/dynamitin was transfected into Vero cells and detected
using antibodies against the Myc epitope tag and secondary anti-mouse
Ig-rhodamine (in red). (b, c, d, e) Cells were infected with ASFV and
showed characteristic morphological changes. Virus proteins were
detected with antibodies against p30 (c), anti-p54 (b and d), and
anti-p72 primary antibodies (e) labeled with Alexa 488 (in green).
Cells transfected with dynein dominant-negative mutant were not
infected, and no simultaneous expression of both viral proteins and
p50/dynamitin was found in the same cell. Percentages of infected cells
were over 95% in control infected but nontransfected cultures, as
shown in panel b. Bar, 10 µm.
|
|
Moreover, signaling pathways associated with minus-end cytosolic
motility mediated by the dynein-dynactin motor complex
(
54)
seemed to be relevant for viral internalization. An
inhibitor
of tyrosine phosphatase, sodium orthovanadate
(Na
3OV
4), reduced
intracellular and extracellular virus production by more than
60% at
48 h postinfection when added 2 h prior to infection (Fig.
5). In contrast, when the inhibitor was
added at 6 h postinfection,
when virus is already internalized,
the drug had little effect
on virus production compared to controls
(Fig.
5) (20 to 40% inhibition).
With immunofluorescence, virus
internalization was not observed
at 24 and 48 h postinfection in
the cytoplasm of cells treated
with
Na
3OV
4 prior to infection
(not shown), whereas when
Na
3OV
4 inhibitor drug was
added to the cultures after the early infection
phase of
internalization, viral proteins were found in the characteristic
perinuclear location.

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 5.
Influence of tyrosine phosphatase inhibitor
Na3OV4 on virus production. Effect of
Na3OV4 on extracellular and intracellular ASFV
production found at 48 h postinfection. The inhibition of virus
production from cells treated 2 h before infection or 6 h
postinfection with Na3OV4 are presented as a
percentage of the untreated infected cell control value. Solid and open
bars represent extracellular and intracellular virus inhibition,
respectively, as described in the text. This figure shows the mean
inhibition values from three independent experiments ± standard
error.
|
|
 |
DISCUSSION |
ASFV, a large DNA virus, hijacks the microtubule motor complex
cellular transport machinery during virus infection of the cell through
direct binding of virus protein p54 to the light chain of cytoplasmic
dynein (LC8). LC8 dynein is part of a motor protein multicomplex that
generates minus-end-directed movement by ATP hydrolysis along the
microtubules (31, 32). Within the cell, proteins and
vesicles are transported centripetally from the plasma membrane to the
cell interior. Cell shuttling of both proteins and vesicles requires
cytoskeletal filaments and molecular motor proteins (3,
33). Three motor protein superfamilies are involved in membrane
transport: kinesin motors transport vesicles toward the microtubule
plus end, cytoplasmic dynein transports cargo toward the microtubule
minus end, and unconventional myosins convey cargo along actin
filaments. Dynein is the most complex motor protein and involves
multiple interactions. The dynein-associated adapter complex, dynactin,
is required for cargo transport, and dynamitin overexpression releases
this complex (13, 22). Centractin is a molecule linking
the microtubular motor to the actin cytoskeleton by dynein binding
(24).
Specific motor proteins are linked to particular cargoes. The nonmotor
"tail" domains of motor polypeptides or associated subunits are
thought to contain the information for cargo selection. On the
organelle side, "receptor" proteins that interact with the motor
tail domains are assumed to exist. Proteins that may dock molecular
motors onto organelles with previously identified functions have
recently been characterized (10, 39).
Sequence determinants of LC8 binding.
It is of great interest
to define which molecules within dynein complexes directly contact the
cargo. Five proteins with diverse cellular functions have been
described to bind LC8, although the sequence determinants needed for
LC8 binding remain obscure (28, 35, 49). Although a
three-dimensional structure of LC8 bound to an nNOS peptide with
the sequence KDTGIQVDR is currently available, this binding motif is
absent in the other proteins known to interact with LC8
(35). Interestingly, the LC8 binding motif that we have
identified in p54 differs from the motif defined for nNOS (28,
35, 49), I
B
(8), GKAP (guanylate kinase
domain-associated protein), and myosin V (38),
but it is similar to that of the apoptosis regulator Bim
(42). The Bim/LC8 binding site, QDKSTQTPS, is close to the
p54-LC8 binding site defined in this work (QNTASQTMS; Fig. 2). ASFV
sequestering of LC8 cytoplasmic dynein transport might secondarily
modify the binding of dynein to cellular targets and potentially alter
cellular regulatory processes related to Bim, a member of the Bcl-2
family of apoptosis regulators. This might contribute to the apoptosis
induced during ASFV infection (44), which is known to play
an important role in virus pathogenesis (5, 6, 45)
Viral interaction with cytoplasmic dynein shuttle.
Viruses
have evolved subtle strategies to ensure the efficient expression of
their genes upon infection. This includes use of the cytoplasmic
transport machinery during early steps of infection to enable the virus
to reach the replication site (57). Once delivered into
the cytosol, virions have to be transported to sites of replication,
and some viruses make use of microtubules and microtubule-dependent
motors to move from the cell periphery to the nucleus (29, 36,
62). This means that incoming virions expose on their surface
not only targeting signals, but also signals for association with
molecular motor complexes or their adapters (57).
We here provide evidence for an interaction between LC8 dynein and p54
that suggests a possible mechanism for transport of
ASFV particles to
the perinuclear factory area by a minus-end-directed
movement along
microtubules. Disruption of the dynactin complex
by overexpression of
one of its subunits, called p50/dynamitin,
releases both dynactin and
cytoplasmic dynein, blocking the dynein-dependent
transport mechanism
(
13,
43), and this impedes ASFV infection.
Adenovirus
cytosolic minus- and plus-end-directed movements are
supported by
microtubules, and this migration is reduced by overexpression
of
dynamitin (
53). It has been reported that a nonstructural
adenovirus protein binds to an adapter GTPase, RagA, that in turn
binds
TCTEL1, a 14-kDa light-intermediate-chain dynein (
34,
36).
Association between the virus proteins and dynein intermediate
chains
has been also shown for herpes simplex virus type 1 (HSV-1)
(
62) and adenovirus (
53), and light-chain
dynein (LC8) binding
was described for lyssavirus proteins (
26,
46).
Understanding the molecular basis and functional consequences of these
interactions would provide further insight in the molecular
mechanisms
linking motor proteins to viral infection. U
L34
protein
of HSV-1 interacts with the intermediate chain of cytoplasmic
dynein IC-1a and U
L31 protein (
62),
and the site of interaction
has been mapped to the carboxyl-terminal 30 amino acids (
63).
A10L and L4R proteins of vaccinia virus
accumulate in the vicinity
of the MTOC in a dynein-dynactin
complex-dependent fashion also
demonstrated by expression of
p50/dynamitin (
41). In the present
study, virus yields
were also greatly affected at early infection
steps by sodium
orthovanadate (Na
3OV
4), an
inhibitor drug previously
reported to inhibit dynein-dependent movement
(
18). Na
3OV
4
is
an inhibitor of tyrosine phosphatase activity and function
(
21),
and it has been shown to inhibit minus-end-directed
movement (
54).
Tyrosine phosphorylation regulates the
structure and function
of some cytoskeletal proteins (
21,
60). When Na
3OV
4 was
added
prior to infection, virus production was strongly inhibited and
there was no intracytoplasmic staining by immunofluorescence.
Nevertheless, when the drug was added at 6 h postinfection, viral
protein perinuclear localization was conserved and it had little
effect
on virus production. Therefore, inhibition of tyrosine
phosphatases
with Na
3OV
4 impaired early
steps of virus internalization,
suggesting a role for dynein- and
tyrosine phosphatase-dependent
pathways in early virus transport. It
has recently been described
that signal transduction pathways are
activated to mediate early
steps of viral infections (
40,
50). Adenovirus was reported
to enhance dynein-mediated nuclear
targeting by activation of
protein kinase A (PKA) and
p38/mitogen-activated protein kinase
(MAPK) (
54). Also,
the delivery of activated MAPK by incoming
human immunodeficiency virus
type 1 (HIV-1) enhances virus early
infection (
27).
In the presence of nocodazole, viral proteins were detected in a
dispersed pattern and did not reach the perinuclear region,
presumably
because they are unable to move on microtubules. Although
the
microtubular network supports localization and maintenance
of the Golgi
apparatus, ASFV protein p54 was not redistributed
by brefeldin A
treatment. Similar results have been reported for
an HSV-1 structural
protein in Vero cells (
14). The effect of
specific LC8
inhibition (using its dominant negative) should be
differentiated from
microtubule inhibition due to colchicine (
9)
or
nocodazole. Both inhibitions could be related but not identical
and
result in a different effect on viral infection. Cell shuttling
of both
proteins and vesicles requires cytoskeletal filaments
and molecular
motor proteins (
3,
33). Similarly, cytosolic
ASFV
transport (bidirectional) seems to require microtubule filament
integrity. Nevertheless, minus-end-directed or centripetal virus
transport depends on dynein molecular motor activity and integrity
of
tyrosine phosphatase activity. Microtubules could also be involved
in
ASFV exit, since in the presence of nocodazole microtubule
depolymerization inhibits virus production at both early and late
times
postinfection. These results are coincident with previous
studies of
Carvalho et al. (
7). ASFV virions must move from
factory
areas to the plasma membrane to be released by budding,
and it is
possible that microtubules play a role in virus particle
transport from
factory areas to the cell membrane (
9; this
study).
Viral proteins encoded by enveloped animal viruses interact with host
molecules to influence factors such as cellular tropism,
the site of
assembly and release of viral progeny, and the immune
response of the
host to infection. Understanding how viruses exploit
cell-based
transport could yield basic information relevant to
the normal
recruitment of specific microtubule-associated proteins
by organelles
in the cytoplasm. Viruses provide interesting model
systems for basic
studies on cytoskeleton-based intracellular
transport and definition of
the molecular machinery involved in
motor protein recruitment and cargo
selection. Since dynein inhibition
blocks viral infection, the
identification of the specific amino
acid sequences required for viral
protein transport could be of
value in the design of new antiviral
drugs targeting the dynein
multicomplex.
 |
ACKNOWLEDGMENTS |
We thank A. Alvarez-Barrientos for confocal microscopy
assistance. We thank Stephen M. King for the generous gift of the
anti-LC8 polyclonal antibody and Richard Vallee and Chin-Yin Tai for
the p50/dynamitin construct.
This work was supported by EU QLK3-2000-00362, BMC 2000-1003, BIO
98-307, and PB 96-105 from Programa de Promoción General del
Conocimiento and SC 00-049 Programa Sectorial INIA grants.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Departamento de
Biotecnología, Instituto Nacional de Investigación y
Tecnología Agraria y Alimentaria (INIA), Carretera de la
Coruña Km 7, 28040 Madrid, Spain. Phone: 34-91-3476896. Fax:
34-91-3573107. E-mail: calonso{at}inia.es.
 |
REFERENCES |
| 1.
|
Aizawa, H., and Y. Emori.
1990.
Molecular cloning of a ubiquitously distributed microtubule-associated protein with Mr 190.000.
J. Biol. Chem.
265:13849-13855[Abstract/Free Full Text].
|
| 2.
|
Alcami, A.,
A. L. Carrascosa, and E. Viñuela.
1989.
The entry of African swine fever virus into Vero cells.
Virology
171:68-75[CrossRef][Medline].
|
| 3.
|
Allan, V. J., and T. A. Schroer.
1999.
Membrane motors.
Curr. Opin. Cell Biol.
11:476-482[CrossRef][Medline].
|
| 4.
|
Benashski, S. H.,
A. Harrison,
R. S. Patel-King, and S. M. King.
1997.
Dimerization of the highly conserved light chain shared by dynein and myosin V.
J. Biol. Chem.
272:20929-20935[Abstract/Free Full Text].
|
| 5.
|
Brun, A.,
F. Rodríguez,
J. M. Escribano, and C. Alonso.
1998.
Functionality and cell anchorage dependence in insect cells of the African swine fever virus gene A179L, a viral bcl-2 homolog.
J. Virol.
72:10227-10233[Abstract/Free Full Text].
|
| 6.
|
Brun, A.,
C. Rivas,
M. Esteban,
J. M. Escribano, and C. Alonso.
1996.
African swine fever virus gene A179L, a viral homologue of bcl-2, protects cells from programmed cell death.
Virology
225:227-230[CrossRef][Medline].
|
| 7.
|
Carvalho, Z. G.,
A. P. De Matos, and C. Rodrigues-Pousada.
1988.
Association of African swine fever virus with the cytoskeleton.
Virus Res.
11:175-192[CrossRef][Medline].
|
| 8.
|
Crépieux, P.,
H. Kwon,
N. Leclerc,
W. Spencer,
S. Richard,
R. Lin, and J. Hiscott.
1997.
I B physically interacts with a cytoskeleton-associated protein through its signal response domain.
Mol. Cell. Biol.
17:7375-7385[Abstract].
|
| 9.
|
De Matos, A. P. A., and Z. G. Carvalho.
1993.
African swine fever virus interaction with microtubules.
Biol. Cell
78:229-234[CrossRef][Medline].
|
| 10.
|
De Matteis, M. A., and J. S. Morrow.
2000.
Spectrin tethers and mesh in the biosynthetic pathway.
J. Cell Sci.
113:2331-2343[Abstract].
|
| 11.
|
Dillman, J. F., III, and K. K. Pfister.
1994.
Differential phosphorylation in vivo of cytoplasmic dynein associated with anterogradely moving organelles.
J. Cell. Biol.
127:1671-1681[Abstract/Free Full Text].
|
| 12.
|
Dixon, L. K.,
J. V. Costa,
J. M. Escribano,
D. L. Rock,
E. Vinuela, and P. J. Wilkinson.
2000.
Asfarviridae, p. 159-165.
In
M. Van Regenmortle, et al. (ed.), Seventh report of the International Committee on Taxonomy of Viruses. Academic Press, New York, N.Y.
|
| 13.
|
Echeverri, C. J.,
B. M. Paschal,
K. T. Vaughan, and R. B. Valee.
1996.
Molecular characterization of the 50 Kd subunit of dynactin reveals function for the complex in chromosome alignment and spindle organization during mitosis.
J. Cell Biol.
132:617-633[Abstract/Free Full Text].
|
| 14.
|
Elliot, G., and P. Ohare.
1997.
Intracellular trafficking and protein delivery by a herpesvirus structural protein.
Cell
88:223-233[CrossRef][Medline].
|
| 15.
|
Epstein, E.,
A. Sela-Brown,
I. Ringel,
R. Kilav,
S. M. King,
S. E. Benashski,
J. K. Yisraeli,
J. Silver, and T. Naveh-Many.
2000.
Dynein light chain binding to a 3'-untranslated sequence mediates parathyroid hormone mRNA association with microtubules.
J. Clin. Investig.
105:505-512[Medline].
|
| 16.
|
Fields, S., and O. Song.
1989.
A novel genetic system to detect protein-protein interactions.
Nature
340:245-246[CrossRef][Medline].
|
| 17.
|
García-Beato, R.,
M. L. Salas,
E. Viñuela, and J. Salas.
1992.
Role of the host cell nucleus in the replication of African swine fever virus DNA.
Virology
188:637-649[CrossRef][Medline].
|
| 18.
|
Gibbons, I. R.,
M. P. Cosson,
J. A. Evans,
B. H. Gibbons,
B. Houck,
K. H. Martinson,
W. S. Sale, and W. Tang.
1978.
Potent inhibition of dynein adenosinetriphosphatase and of the motility of cilia and sperm flagella by vanadate.
Proc. Natl. Acad. Sci. USA
75:2220-2224[Abstract/Free Full Text].
|
| 19.
|
Gómez-Puertas, P.,
F. Rodriguez,
J. M. Oviedo,
F. Ramiro-Ibáñez,
F. Ruiz-Gonzalvo,
C. Alonso, and J. M. Escribano.
1996.
Neutralizing antibodies to African swine fever virus inhibit through different proteins both virus attachment and internalization. Influence of passage history of the virus.
J. Virol.
70:5689-5694[Abstract/Free Full Text].
|
| 20.
|
Gómez-Puertas, P.,
F. Rodríguez,
J. M. Oviedo,
A. Brun,
C. Alonso, and J. M. Escribano.
1998.
The African swine fever virus proteins p54 and p30 are involved in two distinct steps of virus attachment and both contribute to the antibody-mediated protective immune response.
Virology
243:461-471[CrossRef][Medline].
|
| 21.
|
Goval, J. J.,
A. Van Cauwenberge, and H. Alexandre.
2000.
Respective roles of protein tyrosine kinases and protein kinases C in the upregulation of beta-catenin distribution, and compaction in mouse preimplantation embryos: a pharmacological approach.
Biol. Cell
92:513-526[CrossRef][Medline].
|
| 22.
|
Habermann, A.,
T. A. Schroer,
G. Griffiths, and J. K. Burkhardt.
2001.
Immunolocalization of cytoplasmic dynein and dynactin subunits in cultured macrophages: enrichment on early endocytic organelles.
J. Cell Sci.
114:229-240[Abstract].
|
| 23.
|
Harada, A.,
Y. Takei,
Y. Kanai,
Y. Tanaka,
S. Nonaka, and N. Hirokawa.
1998.
Golgi vesiculation and lysosome dispersion in cells lacking cytoplasmic dynein.
J. Cell Biol.
141:51-59[Abstract/Free Full Text].
|
| 24.
|
Holzbaur, E. L. F., and R. B. Vallee.
1994.
Dyneins, molecular structure and cellular function.
Annu. Rev. Cell Biol.
10:339-372[CrossRef].
|
| 25.
|
Itin, C.,
N. Ulitzur,
B. Mühlbauer, and S. R. Pfeffer.
1999.
Mapmodulin, cytoplasmic dynein and microtubules enhance the transport of mannose-6-phosphate receptors from endosomes to the trans-Golgi network.
Mol. Biol. Cell
10:2191-2197[Abstract/Free Full Text].
|
| 26.
|
Jacob, Y.,
H. Badrane,
P.-E. Ceccaldi, and N. Tordo.
2000.
Cytoplasmic dynein LC8 interacts with lyssavirus phosphoprotein.
J. Virol.
74:10217-10222[Abstract/Free Full Text].
|
| 27.
|
Jacqué, J.-M.,
A. Mann,
H. Enslen,
N. Sharova,
B. Brichacek,
R. J. Davis, and M. Stevenson.
1998.
Modulation of HIV-1 infectivity by MAPK, a virion-associated kinase.
EMBO J.
17:2607-2618[CrossRef][Medline].
|
| 28.
|
Jaffrey, S. R., and S. H. Snyder.
1996.
PIN, an associated protein inhibitor of neuronal nitric oxide synthetase.
Science
274:774-777[Abstract/Free Full Text].
|
| 29.
|
Kaelin, K.,
S. Dezelee,
M. J. Masee,
F. Bras, and A. Flamand.
2000.
The UL25 protein of pseudorabies virus associates with capsids and localizes to the nucleus and microtubules.
J. Virol.
74:474-482[Abstract/Free Full Text].
|
| 30.
|
King, S.
2000.
The dynein microtubule motor.
Biochim. Biophys. Acta
1496:60-75[Medline].
|
| 31.
|
King, S. M., and R. S. Patel-King.
1995.
The M(r) = 8,000 and 11,000 outer arm dynein light chains from Chlamydomonas flagella have cytoplasmic homologs.
J. Biol. Chem.
270:11445-11452[Abstract/Free Full Text].
|
| 32.
|
King, M.,
E. Barbarese,
J. F. Dillman III,
R. S. Patel-King,
J. H. Carson, and K. Pfister.
1996.
Brain cytoplasmic and flagellar outer arm dyneins share a highly conserved Mr 8,000 light chain.
J. Biol. Chem.
271:19358-19366[Abstract/Free Full Text].
|
| 33.
|
Klopfenstein, D. R.,
R. D. Vale, and L. Rogers.
2000.
Motor protein receptors: moonlighting on other jobs.
Cell
10:537-540[CrossRef].
|
| 34.
|
Leopold, P. L.,
G. Kreitzer,
N. Miyazawa,
S. Rempel,
K. K. Pfister,
E. Rodriguez-Boulan, and R. G. Crystal.
2000.
Dynein-and microtubule-mediated translocation of adenovirus serotype 5 occurs after endosomal lysis.
Hum. Gene Ther.
11:151-165[CrossRef][Medline].
|
| 35.
|
Liang, J.,
S. R. Jaffrey,
W. Guo,
S. H. Snyder, and J. Clardy.
1999.
Structure of the PIN/LC8 dimer with a bound peptide.
Nat. Struct. Biol.
6:735-740[CrossRef][Medline].
|
| 36.
|
Lukashok, S. A.,
L. Tarassishin,
Y. Li, and M. Horwitz.
2000.
An adenovirus inhibitor of tumor necrosis factor alpha-induced apoptosis complexes with dynein and a small GTPase.
J. Virol.
74:4705-4709[Abstract/Free Full Text].
|
| 37.
|
Miskin, J. E.,
C. C. Abrams,
L. C. Goatley, and L. K. Dixon.
1998.
A viral mechanism for inhibition of the cellular phosphatase calcineurin.
Science
281:562-565[Abstract/Free Full Text].
|
| 38.
|
Naisbitt, S.,
J. Valtschanoff,
D. W. Allison,
C. Sala,
E. Kim,
A. M. Craig,
R. J. Weimberg, and M. Sheng.
2000.
Interaction of the postsynaptic density-95/guanylate kinase domain-associated protein complex with a light chain of myosin V and dynein.
J. Neurosci.
20:4524-4534[Abstract/Free Full Text].
|
| 39.
|
Nakagawa, T.,
M. Setou,
D. Seog,
K. Ogasawara,
N. Dohmae,
K. Takio, and N. Hirokawa.
2000.
A novel motor, KIF13A, transports mannose-6-phosphate receptor to plasma membrane through direct interaction with AP-1 complex.
Cell
103:569-581[CrossRef][Medline].
|
| 40.
|
Nemerow, G. R., and P. L. Stewart.
1999.
Role of (v) integrins in adenovirus cell entry and gene delivery.
Microbiol. Mol. Biol. Rev.
63:725-734[Abstract/Free Full Text].
|
| 41.
|
Ploubidou, A.,
V. Moreau,
K. Ashman,
I. Reckman,
C. González, and M. Way.
2000.
Vaccinia infection disrupts microtubule organization and centrosome function.
EMBO J.
19:3932-3944[CrossRef][Medline].
|
| 42.
|
Puthalakath, H.,
D. C. S. Huang,
L. A. O'Reilly,
S. M. King, and A. Strasser.
1999.
The proapoptotic activity of the bcl-2 family member Bim is regulated by interaction with the dynein motor complex.
Mol. Cell
3:287-296[CrossRef][Medline].
|
| 43.
|
Quintyne, N. J.,
S. R. Gill,
D. M. Eckley,
C. L. Crego,
D. A. Compton, and T. A. Schroer.
1999.
Dynactin is required for microtubule anchoring at centrosomes.
J. Cell Biol.
147:321-334[Abstract/Free Full Text].
|
| 44.
|
Ramiro-Ibañez, F.,
A. Ortega,
A. Brun,
J. M. Escribano, and C. Alonso.
1996.
Apoptosis, a mechanism of cell killing and lymphoid organ impairment during acute African swine fever virus infection.
J. Gen. Virol.
77:2209-2219[Abstract/Free Full Text].
|
| 45.
|
Ramiro-Ibáñez, F.,
A. Ortega,
F. Ruiz-Gonzalvo,
J. M. Escribano, and C. Alonso.
1997.
Modulation of immune cell populations and activation markers in the pathogenesis of African swine fever virus infection.
Virus Res.
47:31-40[CrossRef][Medline].
|
| 46.
|
Raux, H.,
A. Flammand, and D. Blondel.
2000.
Interaction of the rabies virus P protein with the LC8 dynein light chain.
J. Virol.
74:10212-10216[Abstract/Free Full Text].
|
| 47.
|
Rodriguez, F.,
C. Alcaraz,
A. Eiras,
R. J. Yañez,
J. M. Rodriguez,
C. Alonso,
J. F. Rodriguez, and J. M. Escribano.
1994.
Characterization and molecular basis of heterogeneity of the African swine fever virus envelope protein p54.
J. Virol.
68:7244-7252[Abstract/Free Full Text].
|
| 48.
|
Rodríguez, F.,
V. Ley,
P. Gomez-Puertas,
R. García,
J. F. Rodríguez, and J. M. Escribano.
1996.
The structural protein p54 is essential for African swine fever virus viability.
Virus Res.
40:161-167[CrossRef][Medline].
|
| 49.
|
Rodriguez-Crespo, I.,
W. Straub,
F. Gavilanes, and P. R. Ortiz de Montellano.
1998.
Binding of dynein light chain to neuronal nitric oxide synthase in the absence of inhibition.
Arch. Biochem. Biophys.
359:297-304[CrossRef][Medline].
|
| 50.
|
Sanglioglu, S.,
P. K. Benson,
J. Yang,
E. Morrey Atkinson,
T. Reynolds, and J. F. Engelhardt.
2000.
Endocytosis and nuclear trafficking of adeno-associated virus type 2 are controlled by Rac1 and phosphatidylinositol-3 kinase activation.
J. Virol.
74:9184-9189[Abstract/Free Full Text].
|
| 51.
|
Schnorrer, F.,
K. Bohmann, and C. Nüsslein-Volhard.
2000.
The molecular motor dynein is involved in targeting Swallow and bicoid RNA to the anterior pole of Drosophila oocytes.
Nat. Cell Biol.
21:85-190.
|
| 52.
|
Sodeik, B.,
M. W. Ebershold, and A. Helenius.
1997.
Microtubule mediated transport of incoming herpes simplex virus 1 capsids to the nucleus.
J. Cell Biol.
144:657-672[Abstract/Free Full Text].
|
| 53.
|
Suomalainen, M.,
M. Y. Nakano,
S. Keller,
K. Boucke,
R. P. Stidwill, and U. F. Greber.
1999.
Microtubule dependent plus- and minus end directed motilities are competing processes for nuclear targeting of adenovirus.
J. Cell Biol.
14:657-672.
|
| 54.
|
Suomalainen, M.,
M. Y. Nakano,
K. Boucke,
S. Keller, and U. F. Greber.
2001.
Adenovirus-activated PKA and p38/MAPK pathways boost microtubule-mediated nuclear targeting of virus.
EMBO J.
20:1310-1319[CrossRef][Medline].
|
| 55.
|
Valle, M.,
M. Muñoz,
L. Kremer,
J. M. Valpuesta,
C. Martinez-A,
J. L. Carrascosa, and J. P. Albar.
1999.
Selection of antibody probes to correlate protein sequence domains with their structural distribution.
Protein Sci.
8:883-889[Medline].
|
| 56.
|
Viñuela, E.
1985.
African swine fever virus.
Curr. Top. Microbiol. Immunol.
116:155-170.
|
| 57.
|
Whittaker, G. R.,
M. Kann, and A. Helenius.
2000.
Viral entry into the nucleus.
Annu. Rev. Cell Dev. Biol.
16:627-651[CrossRef][Medline].
|
| 58.
|
Wilkinson, P. J.
1989.
African swine fever virus, p. 17-35.
In
M. B. Pensaert (ed.), Virus infections of porcines. Elsevier, Amsterdam, The Netherlands.
|
| 59.
|
Wu, H.,
M. W. Maciejewski,
A. Marintchev,
S. E. Benashski,
G. P. Mullen, and S. M. King.
2000.
Solution structure of a dynein motor domain associated light chain.
Nat. Struct. Biol.
7:575-579[CrossRef][Medline].
|
| 60.
|
Wu, Y. X.,
T. Uezato, and M. Fujita.
2000.
Tyrosine phosphorylation and cellular redistribution of ezrin in MDCK cells treated with pervanadate.
J. Cell Biochem.
79:311-321[CrossRef][Medline].
|
| 61.
|
Yañez, R. J.,
J. M. Rodriguez,
M. L. Nogal,
L. Yuste,
C. Enríquez,
J. F. Rodriguez, and E. Viñuela.
1995.
Analysis of the complete nucleotide sequence of African swine fever virus.
Virology
208:249[CrossRef][Medline].
|
| 62.
|
Ye, G.-J.,
K. T Vaughan,
R. B. Vallee, and B. Roizman.
2000.
The herpes simplex virus 1 UL34 protein interacts with a cytoplasmic dynein intermediate chain and targets nuclear membrane.
J. Virol.
74:1355-1363[Abstract/Free Full Text].
|
| 63.
|
Ye, G.-J., and B. Roizman.
2000.
The essential protein encoded by the UL31 gene of herpes simplex virus 1 depends for its stability on the presence of UL34 protein.
Proc. Natl. Acad. Sci. USA
97:11002-11007[Abstract/Free Full Text].
|
Journal of Virology, October 2001, p. 9819-9827, Vol. 75, No. 20
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.20.9819-9827.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kannan, H., Fan, S., Patel, D., Bossis, I., Zhang, Y.-J.
(2009). The Hepatitis E Virus Open Reading Frame 3 Product Interacts with Microtubules and Interferes with Their Dynamics. J. Virol.
83: 6375-6382
[Abstract]
[Full Text]
-
Moseley, G. W., Roth, D. M., DeJesus, M. A., Leyton, D. L., Filmer, R. P., Pouton, C. W., Jans, D. A.
(2007). Dynein Light Chain Association Sequences Can Facilitate Nuclear Protein Import. Mol. Biol. Cell
18: 3204-3213
[Abstract]
[Full Text]
-
Havecker, E. R., Gao, X., Voytas, D. F.
(2005). The Sireviruses, a Plant-Specific Lineage of the Ty1/copia Retrotransposons, Interact with a Family of Proteins Related to Dynein Light Chain 8. Plant Physiol.
139: 857-868
[Abstract]
[Full Text]
-
Strunze, S., Trotman, L. C., Boucke, K., Greber, U. F.
(2005). Nuclear Targeting of Adenovirus Type 2 Requires CRM1-mediated Nuclear Export. Mol. Biol. Cell
16: 2999-3009
[Abstract]
[Full Text]
-
Ruthel, G., Demmin, G. L., Kallstrom, G., Javid, M. P., Badie, S. S., Will, A. B., Nelle, T., Schokman, R., Nguyen, T. L., Carra, J. H., Bavari, S., Aman, M. J.
(2005). Association of Ebola Virus Matrix Protein VP40 with Microtubules. J. Virol.
79: 4709-4719
[Abstract]
[Full Text]
-
Jouvenet, N., Wileman, T.
(2005). African swine fever virus infection disrupts centrosome assembly and function. J. Gen. Virol.
86: 589-594
[Abstract]
[Full Text]
-
Naranatt, P. P., Krishnan, H. H., Smith, M. S., Chandran, B.
(2005). Kaposi's Sarcoma-Associated Herpesvirus Modulates Microtubule Dynamics via RhoA-GTP-Diaphanous 2 Signaling and Utilizes the Dynein Motors To Deliver Its DNA to the Nucleus. J. Virol.
79: 1191-1206
[Abstract]
[Full Text]
-
Kelkar, S. A., Pfister, K. K., Crystal, R. G., Leopold, P. L.
(2004). Cytoplasmic Dynein Mediates Adenovirus Binding to Microtubules. J. Virol.
78: 10122-10132
[Abstract]
[Full Text]
-
Jouvenet, N., Monaghan, P., Way, M., Wileman, T.
(2004). Transport of African Swine Fever Virus from Assembly Sites to the Plasma Membrane Is Dependent on Microtubules and Conventional Kinesin. J. Virol.
78: 7990-8001
[Abstract]
[Full Text]
-
Douglas, M. W., Diefenbach, R. J., Homa, F. L., Miranda-Saksena, M., Rixon, F. J., Vittone, V., Byth, K., Cunningham, A. L.
(2004). Herpes Simplex Virus Type 1 Capsid Protein VP26 Interacts with Dynein Light Chains RP3 and Tctex1 and Plays a Role in Retrograde Cellular Transport. J. Biol. Chem.
279: 28522-28530
[Abstract]
[Full Text]
-
Rodriguez, J. M., Garcia-Escudero, R., Salas, M. L., Andres, G.
(2004). African Swine Fever Virus Structural Protein p54 Is Essential for the Recruitment of Envelope Precursors to Assembly Sites. J. Virol.
78: 4299-4313
[Abstract]
[Full Text]
-
Suikkanen, S., Aaltonen, T., Nevalainen, M., Valilehto, O., Lindholm, L., Vuento, M., Vihinen-Ranta, M.
(2003). Exploitation of Microtubule Cytoskeleton and Dynein during Parvoviral Traffic toward the Nucleus. J. Virol.
77: 10270-10279
[Abstract]
[Full Text]
-
Grieshaber, S. S., Grieshaber, N. A., Hackstadt, T.
(2003). Chlamydia trachomatis uses host cell dynein to traffic to the microtubule-organizing center in a p50 dynamitin-independent process. J. Cell Sci.
116: 3793-3802
[Abstract]
[Full Text]
-
Petit, C., Giron, M.-L., Tobaly-Tapiero, J., Bittoun, P., Real, E., Jacob, Y., Tordo, N., de The, H., Saib, A.
(2003). Targeting of incoming retroviral Gag to the centrosome involves a direct interaction with the dynein light chain 8. J. Cell Sci.
116: 3433-3442
[Abstract]
[Full Text]
-
Kaiser, F. J., Tavassoli, K., Van den Bemd, G.-J., Chang, G. T.G., Horsthemke, B., Moroy, T., Ludecke, H.-J.
(2003). Nuclear interaction of the dynein light chain LC8a with the TRPS1 transcription factor suppresses the transcriptional repression activity of TRPS1. Hum Mol Genet
12: 1349-1358
[Abstract]
[Full Text]
-
Andres, G., Alejo, A., Salas, J., Salas, M. L.
(2002). African Swine Fever Virus Polyproteins pp220 and pp62 Assemble into the Core Shell. J. Virol.
76: 12473-12482
[Abstract]
[Full Text]
-
Fuhrmann, J. C., Kins, S., Rostaing, P., El Far, O., Kirsch, J., Sheng, M., Triller, A., Betz, H., Kneussel, M.
(2002). Gephyrin Interacts with Dynein Light Chains 1 and 2, Components of Motor Protein Complexes. J. Neurosci.
22: 5393-5402
[Abstract]
[Full Text]