INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Neonatal infection of mice with Moloney murine leukemia virus (MMLV) is potently oncogenic, leading to the development of thymic lymphoma within 3 to 4 months (9). Much evidence suggests that the virus plays a direct role in the initiation and maintenance of these tumors, which display clonal integrations of proviral sequences adjacent to proto-oncogenes such as c-myc, Pim-1, or Gfi-1. Indeed, analysis of common proviral insertion sites in MMLV-induced lymphomas has led to the identification of a large number of genes which can act as dominant oncogenes in the malignant transformation of lymphocytes (reviewed in reference 16). The importance of insertional mutagenesis and transcriptional activation of host cell genes in the pathogenesis of MMLV-induced tumors is underlined by the fact that the transcriptional enhancer elements within the viral long terminal repeats are key determinants of its oncogenic potency and targeting to the lymphoid compartment (10, 20, 21).

In contrast, the role of tumor suppressor pathways in MMLV tumors is virtually unknown. A genome-wide scan for loss of heterozygosity in MMLV-induced tumors of BRAKJ/F1 mice showed that this was an infrequent event, with no evidence of changes affecting the murine Trp53 locus on chromosome 11 (19). We explored this issue directly by examining the effect of the Trp53^/ genotype on MMLV lymphomagenesis. Although MMLV infection and the Trp53^/ genotype independently led to thymic lymphomas with similar kinetics and phenotypic characteristics, we found that the combination was only weakly additive (1). Furthermore, there was no obvious effect of the Trp53^/ genotype on the spectrum of proto-oncogenes targeted by MMLV in the resultant lymphomas. From these observations we postulated that MMLV lymphomagenesis bypasses the need for genetic inactivation of p53 (1).

Recent studies show that the p53 pathway is coupled to oncogene overexpression. The p19^ARF protein, the product of one of the overlapping reading frames at the p16^INK4a/p19^ARF locus, appears to stabilize p53 through antagonism of its interaction with Mdm2 (36). Moreover, the expression of p19^ARF has been reported to be induced in response to overexpression of myc and viral oncogenes such as E1A (6, 37). It appears, therefore, that the p53 pathway acts to protect cells from the consequences of inappropriate proliferative signals as well as genotoxic insult. As p53 itself appears to down-regulate p19^ARF as well as Mdm2, the p19^ARF-Mdm2-p53 pathway represents a feedback loop which integrates and coordinates the cellular response to a variety of conflicting growth signals (8). The importance of this fail-safe mechanism is indicated by the rapid onset of tumors in mice carrying an overexpressed myc oncogene in combination with defective p53 (4, 13).

To explore the role of MMLV further, we tested the effects of viral infection in mice that carry a CD2-myc oncogene and were either homozygous or heterozygous for an inactivated Trp53 allele. We found that neonatal infection with MMLV could accelerate tumor onset even on the highly tumor-prone CD2-myc Trp53^/ background and that the lack of functional p53 had little or no discernible effect on the range of genes targeted by proviral insertion. The most striking effect, however, was seen in CD2-myc Trp53^+/ mice, where viral infection promoted the outgrowth of tumors which retained the wild-type Trp53 allele in apparently functional form. From these results we hypothesize that MMLV leukemogenesis involves uncoupling of the hyperproliferative effects of oncogenes such as myc from the fail-safe mechanisms mediated by p53.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Transgenic mice The targeted inactivation of the Trp53 gene and introduction into the mouse germ line have been described previously: the null mice were derived by homologous recombination in 129/Sv murine stem cells, crossed onto a C57BL/6 background (7), and subsequently crossed with NIH mice. The generation of transgenic mice carrying human c-myc under the CD2 locus control region has also been described (35): in short, a linearized CD2-myc plasmid construct was microinjected into (C57BL/6 × CBA/Ca)F₂ fertilized eggs. Trp53^/ and CD2-myc mice were crossed to generate progeny heterozygous for both Trp53 and CD2-myc. These F₁ animals were crossed to give mice of all six possible genotypes and also backcrossed with Trp53 null mice to produce approximately equal numbers of Trp53^//CD2-myc-positive, Trp53^+//CD2-myc-positive, Trp53^/, and Trp53^+/ mice. Mice were infected within 24 h of birth with 10⁵ infectious units of MMLV (34). Animals were routinely monitored and sacrificed when cachexia was noted.

Establishment of cells in culture. Tumor tissues were disaggregated in RPMI 1640 medium (Gibco Life Technologies) using scalpel blades. Lymphocytes were separated on a Ficoll-Paque density gradient (Pharmacia) at 3,000 rpm for 10 min, washed in RPMI, and cultured in RPMI containing 10% fetal calf serum, penicillin, streptomycin, 10 mM HEPES, and 50 µM 2-mercaptoethanol.

DNA hybridization analysis. High-molecular-weight DNA was isolated from mouse tissues and cultured cells using either guanidinium hydrochloride or the Nucleon kit (Scotlab, Coatbridge, Scotland). Digestion of the DNA with restriction enzymes, electrophoresis, hybridization, and autoradiography were carried out as previously described (26). Transfer to Hybond-N membranes was carried out according to the manufacturer's recommendations (Amersham Pharmacia). Probes were radiolabeled by random priming using [-³²P]dCTP (3,000 Ci/mmol; Amersham Pharmacia) to specific activities of 2 × 10⁸/µg or greater. The Trp53 null and wild-type (wt) alleles were detected, along with the pseudogene on BamHI-digested DNA by Southern blotting using a PCR-generated Trp53 exon 4 probe described previously (1). The CD2-myc transgene was detected as a 25-kb band on reprobing the same blots with the CD2-myc probe described previously (31). Tumors, kidney metastases, and cell lines were screened for rearrangements in the Pim-1 locus using a probe previously described (clone A) and in the bmi-1 and pal-1 loci using mouse bmi-1 cDNA clone 13.1 and the pal-1 probe 11A2 (34). Tumors, kidney metastases, and cell lines were also screened for rearrangements at Gfi-1, Ahi-1, and Evi-5 as described previously (10, 22, 27) and at til-1 using the til-1E probe (32). Kidney metastases were screened for rearrangements at the loci mentioned above and at Frat-1 (17). Rearrangements of the T-cell receptor (TCR) -chain gene and the immunoglobulin heavy-chain (IgH) gene were determined using a 496-bp PCR-derived fragment of the C gene, derived from the 1.2-kb fragment of clone 86T5 (12) and a 1.7-kb EcoRI-BamHI fragment of plasmid J11 (24), respectively. A PCR probe for the U3 region of the MMLV long terminal repeat was derived using primers U3a, CCACCTGTAGGTTTGGCAAGC, and U3b, GGTCATTTCCAGGTCCTTGG, and used for estimation of proviral copy number. Rearrangements at exon 1 of p19^ARF were examined by Southern blotting using AflII-digested tumor DNA and an exon 1-specific probe (8).

Western analysis. Levels of p53 in cell lines were investigated by Western blotting as described elsewhere (5) using the Pab240 monoclonal antibody (Oncogene Research Products) and a horseradish peroxidase (HRP)-conjugated secondary anti-mouse antibody (Sigma). The antibody complex was visualized by enhanced chemiluminesence (Amersham Pharmacia). The cell line BW5147 was used as a positive control for Trp53 expression (European Collection of Animal Cell Cultures, Salisbury, United Kingdom). p19^ARF was detected using a rabbit polyclonal primary antibody raised against an internal peptide (residues 54 to 75) (R562; AbCam Ltd.) and detected using HRP-conjugated goat anti-rabbit secondary (Sigma). p21^WAF1 was detected using a goat polyclonal primary antibody (sc397-G; Santa Cruz Biotechnology) and an HRP-conjugated anti-goat secondary antibody (Sigma). p16^INK4a was detected using a rabbit polyclonal primary antibody (sc1207; Santa Cruz Biotechnology) and a goat anti-rabbit-HRP conjugate (Sigma). -actin was also detected as a loading control using a goat polyclonal antibody (sc1616; Santa Cruz Biotechnology).

RT-PCR analysis. Levels of Mdm2 and p19^ARF transcript were investigated in primary tumor cells and tumor cell lines by reverse transcription (RT)-PCR: first- strand cDNA was generated from total RNA isolated using RNAzolB (Tel-Test Inc.) with enhanced avian myeloblastosis virus reverse transcriptase (Sigma) or Superscript-enhanced MMLV reverse transcriptase (Gibco-BRL). For Mdm2, 2 µl of first-strand reaction mixture was placed in a standard 50-µl PCR mixture containing primers Mdm2cn (5' CAGCTTCGGAACAAGAGACTC 3') and Mdm2d (5' CTGTGCTCCTTCACAGAGAAAC 3') each at 10 µM. PCR was carried out using Taq polymerase (Perkin-Elmer) at 35 cycles of 45 s of denaturation at 94°C, 45 s of annealing at 60°C, and 90 s of elongation at 72°C. p19^ARF transcripts were detected using identical conditions except that the primers were the same as those used in a previous study (28). The RT-PCR product from one representative reaction was cloned and sequenced to ensure that the product was as expected.

Flow cytometry. Flow cytometry for cell phenotype was carried out as described previously using R-phycoerythrin-conjugated anti-mouse CD4 (Serotec), fluorescein isothiocyanate-conjugated anti-mouse CD8 (Serotec/Sigma) and Quantum Red- or fluorescein isothiocyanate-conjugated anti-mouse CD3 (Serotec/Sigma). For the detection of apoptosis, 10⁶ cells were gamma irradiated (5 Gy), cultured as normal for 4 h, harvested by centrifugation, and washed in phosphate-buffered saline. The cells were resuspended and incubated for 15 min in a buffer (10 mM HEPES [pH 7.4], 140 mM NaCl, 5 mM CaCl₂) containing fluorescein-conjugated annexin V (Roche Molecular Biochemicals). Control cells established from a CD2-myc-induced thymic lymphoma were treated with 10 µM dexamethasone (Sigma) for 24 h prior to analysis. Annexin V staining increased from 21 to 68% following treatment. All samples were analyzed on a Coulter Epics Elite.

Statistics. Survival analysis of tumor-prone animals was carried out using the Mann-Whitney rank sum test.

Nucleotide sequence accession number. The sequence data have been submitted to the DDBJ/EMBL/GenBank databases under accession no. AJ302067.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Collaboration of MMLV and Trp53 loss in T-cell lymphomas of CD2-myc mice: effects on rate of tumor development and tumor cell growth in vitro. Our previous studies of CD2-myc mice showed that the combination of overexpressed myc and an inactive Trp53 gene is strongly synergistic in promoting lymphoid tumors in mice (4). However, the clonal nature of the tumors which emerged indicated that further selective events are operative in the genesis of these lymphomas. This led us to ask whether neonatal infection of these highly tumor-prone mice with MMLV could reduce the latent period for tumor development still further and whether the virus could be used as a probe for the complementing oncogenic pathways involved.

/

/

/

Trp53^+/

/

/

Trp53^+/

Trp53^+/

View larger version (17K): [in this window] [in a new window]   FIG. 1.   (A) MMLV infection accelerates the development of thymic lymphoma in Trp53/ CD2-myc mice. Tumor-free survival was significantly decreased in MMLV-infected Trp53/ CD2-myc mice compared to that in uninfected mice of the same genotype (P < 0.001). (B) Loss of p53 influences the latency of tumor development in infected CD2-myc mice. Trp53/ CD2-myc MMLV-infected mice develop tumors significantly faster than Trp53+/ or Trp53+/+ CD2-myc MMLV-infected mice (P < 0.001 for both).

Trp53^/

Trp53^/

Trp53^+/

MMLV promotes the development of tumors that retain functional, wild-type Trp53 in CD2-myc Trp53+/ mice. If MMLV infection can bypass the requirement for inactivation of Trp53 in lymphoma development, we postulated that there should be no selective advantage for loss of the Trp53 wt allele in MMLV-induced tumors in Trp53^+/ mice. This prediction was borne out by Southern blot analyses of Trp53 in MMLV-infected, CD2-myc lymphomas. Examples of these analyses are shown in Fig. 2A, and the results are summarized in Table 1. Extensive loss of the Trp53 wt allele was observed in 13 of 13 tumors from Trp53^+/ CD2-myc mice (4), while only 2 of 27 of the equivalent MMLV-infected lymphomas showed complete loss of the Trp53 wt allele, with a further 6 of 27 showing very slight loss of the wt Trp53 allele. However, cell lines established from Trp53^+/ tumors ultimately lost the wild-type allele or showed evidence of mutational stabilization and functional loss. In accord with a previous study, we found no evidence of Trp53 inactivation by proviral insertion or other gross rearrangements.

View larger version (61K): [in this window] [in a new window]   FIG. 2.   (A) Loss of the Trp53 wild-type allele (WT) is uncommon in MMLV-induced, Trp53+/ CD2-myc primary tumors (T) and in kidney metastases (K) but is common in the resulting established cell lines (C). The pseudogene () and homologously recombined, knocked-out allele (KO) are indicated. Tumors judged not to have lost the wild-type allele were found to have wt Trp53 alleles with intensity of at least 90% of that of the knockout allele by Southern blot analysis. Loss of the Trp53 wild-type allele is evident in p/m63i cell line, tumor, and kidney DNA but retention of the Trp53 wild-type allele is seen in p/m48i, p/m51i, p/m61i, and p/m62i tumor and kidney DNA. (B) Apoptosis response to gamma irradiation in Trp53+/ cell lines by flow cytometry. Induction of apoptosis, as identified by annexin V staining, was found in early passages (E) of p/m51i and p/m69i cell lines following irradiation (hatched bar). A greatly reduced apoptotic response to gamma irradiation was observed in later passages (L) of these cell lines, coinciding with loss of the Trp53 wt allele as shown by Southern blot analysis. Gamma-irradiated Trp53/ cells were included as a negative control, and dexamethasone-treated lymphoma cells were used as a positive control.

View this table: [in this window] [in a new window]   TABLE 1.   Retention of the Trp53 wild-type allele in spontaneous and MMLV-induced thymic lymphomas in CD2-myc Trp53+/ mice

p19^ARF expression in CD2-myc lymphomas is inversely correlated with the presence of an intact Trp53 wt allele and can be reactivated on Trp53 loss in vitro. The elucidation of the p19^ARF-p53 regulatory loop has revealed another means by which the p53 pathway can be compromised in tumors (8). Moreover, the evidence that this pathway couples overexpression of myc to the p53 response (37) suggested that it may be particularly relevant to this study, as the Trp53^/ genotype has a profound effect on the development of lymphomas in CD2-myc mice (4). Southern blot analysis of the lymphoma series revealed no gross deletions or rearrangements of the p16^INK4a/p19^ARF locus (not shown). We therefore examined the expression of p19^ARF and p16^INK4a, the products of alternative and overlapping exons at the p16^INK4a/p19^ARF locus (28). p19^ARF was readily detected by Western blotting and showed a mainly bimodal expression pattern, being either strongly expressed or below detectable levels. Only a few tumors failed to conform to this pattern, showing a low level of p19^ARF protein, for example p/m48i (Fig. 3A and Table 2). Regulation of p19^ARF expression appeared to be mainly at the transcriptional level, as RT-PCR analysis yielded results essentially identical to those of the Western blots (not shown). Western blot analysis revealed no detectable expression of p16^INK4a in cell lines overexpressing p19^ARF, suggesting that the two products of the p16^INK4a/p19^ARF locus are not coordinately expressed (data not shown).

View larger version (29K): [in this window] [in a new window]   FIG. 3.   Western analysis of p19ARF. (A) Expression of p19ARF is commonly down-regulated in MMLV-induced CD2-myc primary tumors from Trp53+/ and Trp53+/+ mice but not in those from Trp53/ littermates. In contrast, p19ARF expression is strong in spontaneous primary tumors from Trp53/ and Trp53+/ mice. It should be noted that the spontaneous tumors (p/m28, 30, 47, 48) from Trp53+/ mice lost the Trp53 wt allele. Gels were routinely run in parallel and stained using Coomassie blue to ensure that there were equal amounts of protein in each lane on the Western blots. The presence or absence of the Trp53 wild-type allele is indicated in each case. (B) Repression of p19ARF expression in the presence of p53. p19ARF expression is repressed in early passages (E) of two cell lines which maintain functional p53, but the repression is not irreversible since on later passage (L), p53 is lost and p19ARF expression is comparable to that of a control cell line (C) that lacks functional p53. Amounts of protein loaded are indicated by -actin staining.

Trp53^+/

Trp53^+/

Trp53^+/

Analysis of MMLV target genes in CD2-myc Trp53^/ lymphomas reveals Runx2/til-1 and ptl-1, a novel insertion locus on mouse chromosome 8. The tumors induced by MMLV in CD2-myc mice were monoclonal or oligoclonal as judged by Southern blotting using TCR and IgH probes, even on the Trp53^/ background. The number of fragments detected with the U3 probe indicated that the tumors were composed of a small number of clones, each of which contained a small number of clonal proviral integrations (Table 3). These data suggested that mutagenic events mediated by proviral insertion were most likely responsible for the acceleration of tumorigenesis by MMLV.

/

View larger version (11K): [in this window] [in a new window]   FIG. 4.   Chromosomal localization of ptl-1. The locus was mapped to chromosome 8 with a logarithm of odds score of 13. ptl-1 mapped close to markers D8Mit6 and D8Mit228, 40 centimorgans from the centromere.

/

Trp53^+/

/

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

In CD2-myc mice, thymic lymphomas arise stochastically with a lifetime incidence of 3 to 18% (31). Neonatal infection of these mice with MMLV leads to 100% tumor incidence with much earlier onset (average time, 71 days). A remarkably similar effect on tumor incidence and onset is seen when CD2-myc mice are crossed onto a Trp53^/ background, with all mice succumbing to T-cell lymphoma at an average age of 72 days (4). In contrast, MMLV infection of Trp53^/ mice shows only a weakly additive effect on the kinetics of tumor development (1). From these observations we suggested that the MMLV lymphomagenic pathway may be at least partially overlapping and functionally redundant with p53 loss. This study reinforces these findings and shows further that MMLV significantly reduces the selective pressure on the p53 pathway in CD2-myc mice, promoting the outgrowth of tumors that retain the p53 gene and preserve at least some of its downstream functions. However, the pressure on p53 is not lost entirely and becomes evident when tumor cells are propagated in vitro.

According to Knudson's two-hit model for inherited tumor suppressor gene function, loss of both copies of the gene is a prerequisite for tumor outgrowth (18). This model applies imperfectly to p53, for which there is evidence that the loss of one allele can predispose to tumorigenesis and some tumors arise without loss of the wild-type allele (35). An extensive study of wild-type Trp53 loss in primary tumors of Trp53 heterozygous mice showed that tumors arising in older mice are more likely to retain the wild-type allele in a functional state, regardless of the type of malignancy, with rates of loss declining from 60 to around 15% in tumors arising at 21 months of age (35). In contrast, we found that 100% of lymphomas in CD2-myc Trp53^+/ mice had undergone significant loss of the wild-type allele at the primary tumor stage, despite their relatively late onset, suggesting that in this case p53 inactivation is a rate-limiting event which is required for the growth of tumors to clinically detectable size. However, in CD2-myc Trp53^+/ mice infected with MMLV, this trend was reversed, with tumors arising at an early age with a relatively low rate of allele loss (25%).

How might MMLV relieve the selective pressure for loss of p53 in lymphomagenesis? In contrast to Friend MLV-induced erythroleukemias (25), we found no evidence of virus-induced rearrangements of the Trp53 gene itself. Moreover, several lines of evidence indicate that the normal Trp53 allele is functionally intact in most primary tumors of MMLV-infected CD2-myc Trp53^+/ mice. First, Southern blot analyses showed that the normal allele was lost during the establishment of cell lines from the primary tumors. The defective targeted Trp53 allele and the pseudogene were unaffected, showing that this loss was not merely the result of random karyotypic variations in aneuploid tumor cells. Secondly, two lymphoma cell lines that retained the wild-type allele for a significant prolonged period of culture showed an intact p53 response as revealed by expression of p21^WAF1 and apoptotic markers following exposure to ionizing radiation. It appears that the tumor suppressor function of p53 is either quiescent or neutralized in these tumors, despite the presence of the constitutively expressed CD2-myc gene.

The expression status of the p16^INK4a/p19^ARF locus was of interest in these tumors since p19^ARF, one of the overlapping products of this locus, can stabilize p53 through antagonism of its interaction with Mdm2 (36) and has been reported to be induced in response to overexpression of myc and viral oncogenes such as E1A (6, 37). We found that p19^ARF was highly expressed in virtually all Trp53^/ tumors and was commonly observed in Trp53^+/ lymphomas, which had demonstrable loss of the wild-type p53 allele, indicating that the postulated negative-feedback loop connecting p53 and p19^ARF is operative in T-lymphoma cells (8). Two Trp53^+/ cell lines that lost the wild-type allele on prolonged culture showed concomitant up-regulation of p19^ARF expression, providing further evidence that p53 was intact prior to allele loss and showing that nonexpression of p19^ARF in the corresponding primary tumors was not due to the deletions, nonsense mutations, or DNA methylation which can affect the p16^INK4a/p19^ARF locus in human tumors of various lineages (reviewed in reference 29).

The lack of apparent pressure to lose p19^ARF expression in MMLV-infected Trp53^/ tumors suggests that its p53-independent apoptotic effects noted in primary B cells (8) are either inoperative in T cells or are neutralized by the MMLV lymphomagenic program in T lymphomas. In this respect it is interesting that screening of MMLV insertion sites in our tumor series revealed no hits at the Bmi-1 locus, a gene collaborating with myc that represses transcription of the p16^INK4a/p19^ARF locus (15). While activation of Bmi-1 by MMLV is a common feature of B-cell lymphomas of Eµ-myc mice (34), it is very rare in MMLV-induced T-cell lymphomas, including virus-accelerated tumors of CD2-myc mice (33). Intriguingly, this lineage preference is echoed in the spectrum of tumors which arise in Ink4a^/ mice, which develop either B-cell lymphomas or sarcomas (30), while Trp53^/ mice develop mainly T-cell lymphomas (7).

It is conceivable, nevertheless, that the combination of MMLV functions with the CD2-myc transgene overcomes the requirement for p53 inactivation during the early stages of neoplastic transformation. A precedent is provided by a prostate cancer model in which the combination of myc and ras appears to render p53 loss redundant (23). Screening of known MMLV insertion sites in this tumor series revealed a significant rate of insertions at Runx2, a gene collaborating with myc that was identified previously in CD2-myc mice (32). However, insertions at this locus were distributed across Trp53 genotype groups, showing that Runx2 activation is not functionally equivalent to p53 loss. In accord with this interpretation, recent evidence shows that a CD2-Runx2 oncogene is strongly synergistic with the Trp53^/ genotype (3). Screening for new insertion sites revealed a novel common insertion locus, ptl-1, which we mapped to mouse chromosome 8. The relevant target gene for these insertions has not yet been identified, but, as noted for Runx2, these insertions were also found in Trp53^/ lymphomas. While insertions at Pim-1 revealed an apparent complementary pattern with Trp53 genotype, the low number of cases recorded indicates that caution should be exercised in drawing any conclusions at this stage.

As MMLV-accelerated tumors of CD2-myc mice appear to be refractory to p19^ARF-p53 surveillance, a further possibility which merits consideration is that the MMLV lymphomagenic program uncouples the p19^ARF-p53 response to myc overexpression, without necessarily preventing its induction by other stimuli. According to this model, the p19^ARF-p53 pathway is in waiting mode in MMLV-induced lymphomas, as it appears to be in normal cells which express only very low levels of p19^ARF (29). The later loss of p53 and its functions on in vitro propagation or in metastatic tumors in vivo could then be accounted for by the induction of the p19^ARF-p53 pathway in response to growth crisis or suboptimal levels of essential survival factors, and the accumulation of p19^ARF in Trp53^/ lymphoma cells could be a consequence of loss of p53-mediated repression rather than its de novo induction by myc. In support of this notion, it has been shown recently that p19^ARF can be induced in human tumor cell lines by serum deprivation as well as oncogene-mediated hyperproliferation (14). The intriguing possibility that myc overexpression is uncoupled from p19^ARF-p53 in MMLV-accelerated lymphomas may be testable by the use of regulatable myc transgenes (2) in combination with MMLV.