Previous Article | Next Article 
Journal of Virology, October 2001, p. 9703-9712, Vol. 75, No. 20
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.20.9703-9712.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Endothelial Cells Enhance Human Immunodeficiency Virus Type 1 Replication in Macrophages through a C/EBP-Dependent
Mechanism
Eileen S.
Lee,1
Huiyu
Zhou,1,
and
Andrew J.
Henderson1,2,*
Department of Veterinary
Science2 and Graduate Program in
Biochemistry, Microbiology and Molecular
Biology,1 Pennsylvania State University,
University Park, Pennsylvania 16802
Received 13 December 2000/Accepted 13 July 2001
 |
ABSTRACT |
Macrophages are early targets of human immunodeficiency virus type
1 (HIV-1) infection and serve as potential reservoirs for long-term
infection. Through inflammatory mediators and direct cell contact,
infected macrophages interact with neighboring cell populations, such
as the endothelium, which create a microenvironment favorable for HIV-1
replication. We hypothesize that the transcriptional activator C/EBP
is critical for macrophages to respond to endothelial cell-derived signals. We show that endothelial cells significantly enhance C/EBP
binding activity and HIV-1 replication in
macrophages. This increase in HIV-1 transcription is due to
cell-cell contact as well as the production of soluble factors,
mediated in part by ICAM-1 and interleukin 6, respectively.
Furthermore, C/EBP factors are necessary for endothelial cell-dependent
activation of HIV-1 transcription in macrophages, and HIV-1
induction can be inhibited by a C/EBP dominant-negative protein. In
addition, C/EBP binding sites are necessary for efficient LTR activity
and HIV-1 replication in the presence of endothelial cells. Taken together, these results indicate that endothelial cells, through the
activation of C/EBP
, provide a microenvironment that supports HIV-1
replication in monocytes/macrophages.
 |
INTRODUCTION |
Macrophages are primary targets of
human immunodeficiency virus type 1 (HIV-1) infection and serve as
potential reservoirs for long-term infection due to their resistance to
cytopathic effects of the virus (18). Furthermore,
infected macrophages aberrantly express a variety of factors,
including inflammatory cytokines, which directly or indirectly
contribute to a number of AIDS-associated diseases, including B-cell
lymphoma, Kaposi's sarcoma, interstitial pneumonitis, and dementia
(9, 19, 25, 29, 32, 48, 55).
Although it is unclear whether endothelial cells are susceptible to
HIV-1 infection, they clearly promote the onset of many AIDS-related
pathologies (19, 36, 48). Through direct cell-cell contact
between monocytes/macrophages and endothelial cells or the production of soluble factors, a microenvironment that is potentially favorable for HIV-1 replication is created. For example, endothelial cells may actively recruit HIV-1-infected cells and potential target cells, such as macrophages, to various tissue sites. Interactions between macrophages and endothelial cells would then be expected to lead to cellular activation, cytokine production, enhanced HIV-1 expression, and ultimately increased tissue
damage (22, 52). However, the mechanisms by which
endothelial cells affect HIV-1 expression in macrophages and
establish a permissive microenvironment for HIV-1 infection and
replication are not well understood.
Upon activation and differentiation of
monocytes/macrophages, transcriptional activators such
as NF-
B and C/EBP
are induced (2, 3, 4, 38). These
transcription factors can physically interact to synergistically
regulate the expression of inflammatory cytokines and chemokines
including interleukin 1
(IL-1
), IL-6, IL-8, and tumor necrosis
factor alpha (TNF-
), as well as HIV-1 transcription (21, 33,
41, 42, 43, 44, 47, 50). Furthermore, inflammatory cytokines can
feed back in an autostimulatory loop to induce HIV-1 transcription
(15, 21, 33, 39, 41, 42, 43, 44). NF-
B has been shown
to be important for HIV-1 transcription and activation of
CD4+ T cells as well as persistent and activated
viral replication in monocytes (24, 31). Although C/EBP
is not necessary for HIV-1 transcription in CD4+
T cells, it is essential for HIV-1 replication in
monocytes/macrophages (27, 28).
C/EBP
is a member of the C/EBP family of transcription factors that
share homology in their leucine zipper dimerization and basic DNA
binding domains. Included in this family are transcriptional activators
as well as dominant-negative regulators, such as liver inhibitory
protein (LIP) (8, 14, 62). Functional C/EBP
sites are
required for efficient long-terminal-repeat (LTR) activity and HIV-1
replication in monocytes/macrophages (26, 27, 28, 59). In addition, establishment of HIV-1 infection and induction of proviral expression in monocytes/macrophages
require endogenous C/EBP factors (27, 28). Although
NF-
B has been shown to be involved in endothelial cell-induced
activation of HIV-1 transcription in infected cells (20,
52), the role of C/EBP
in macrophage-endothelial cell
interactions is not known.
One potential mechanism by which endothelial cells create a
microenvironment that is favorable for HIV-1 replication is by inducing
transcription factors such as NF-
B or C/EBP
in
macrophages through either direct cell contact or soluble
factors (20). In this study, we specifically address the
role of C/EBP
in the regulation of HIV-1 expression in response to
endothelial cell-derived signals. The human promonocytic cell line U937
and primary macrophages were infected in the absence or
presence of endothelial cells to investigate alterations in cytokine
expression, cell function and viral replication. In these studies, the
presence of endothelial cells significantly enhanced HIV-1 replication
in macrophages. Most importantly, the ability of
macrophages to upregulate HIV-1 in response to endothelial
cell-derived signals was shown to be dependent upon the presence of
C/EBP binding sites in the LTR and functional C/EBP
protein.
 |
MATERIALS AND METHODS |
Cell lines.
U937 and U1 promonocytic cell lines and primary
human umbilical vein endothelial cells (HUVEC) (Clontech, Palo Alto,
Calif.) were cultured in RPMI 1640 medium supplemented with 10% fetal calf serum (FCS), 100 U of penicillin per ml, 100 µg of streptomycin per ml, and 2 mM L-glutamine. U937 and U1 cells
overexpressing LIP (U937-LIP and U1-LIP) have been previously described
(13, 27, 28) and were cultured under the same conditions.
293T human embryonic kidney cells and 3T3 fibroblasts were grown in an
alpha modification of Eagle's medium supplemented with 10% FCS, 100 U
of penicillin per ml, 100 µg of streptomycin per ml, and 2 mM
L-glutamine.
Macrophage isolation.
Peripheral blood macrophages
were isolated from whole blood obtained from healthy HIV-1-seronegative
donors. Mononuclear cells were obtained by differential centrifugation
using a Ficoll/Hypaque gradient (Sigma, St. Louis, Mo.) as previously
described (28). The cells were cultured in RPMI 1640 medium supplemented with 10% FCS, 100 U of penicillin per ml, 100 µg
of streptomycin per ml, and 2 mM L-glutamine. Macrophages
were separated from lymphocytes by an initial adherence to plastic
culture flasks overnight. After removal of nonadherent cells,
macrophages were cultured for 5 to 7 days prior to infection.
ICAM-1 and IL-6 antibody blocking.
For blocking of ICAM-1,
1.0 × 105 U1 cells were cocultured with
1.0 × 104 HUVEC in 96-well plates. Mouse
immunoglobulin G1 (IgG1) anti-human CD54 monoclonal antibody (MAb) (1 µg/ml; Pharmingen, San Diego, Calif.) was added to the coculture, and
viral induction was measured 48 h later by reverse transcriptase
(RT) activity. To block IL-6 activity, 1.0 × 105 U1 cells were cultured in a 24-well transwell
plate with a 0.4-µm filter (Costar, Corning, N.Y.) with
1.0 × 105 HUVEC. Rat IgG1 anti-human IL-6
MAb (1 µg/ml; Pharmingen) was added to the bottom well containing
adherent HUVEC. Viral induction by U1 cells in the top well was
measured 48 h later by RT activity. In both cases, mouse IgG1 (1 µg/ml; ICN/Cappel, Aurora, Ohio) was used as an isotype control.
Generation of HIV-1 infectious titers and infections.
Replication competent virus was generated by transfecting 293T cells
with 15 µg of M-tropic pHIV-BaL DNA and 3 µg of Rev in a Rous
sarcoma virus expression construct (RSV-Rev) DNA by
CaPO4 transfection (40). Wild-type
and mutant HXB2 virus were similarly generated with 15 µg of HIV-HXB2
or mC2,C3 HXB2 (27, 28) DNA, and 3 µg of RSV-Rev DNA.
Production of viral particles was monitored by RT activity 48 h
posttransfection. Infectious virus stocks were added to 1.0 × 106 primary macrophages or U937
monocytes/ml. Equivalent levels of virus were used to infect cells, as
determined by RT activity. The infection medium was then removed
24 h postinfection and replaced with fresh RPMI medium
supplemented with 10% FCS, 100 U of penicillin per ml, 100 µg of
streptomycin per ml, and 2 mM L-glutamine.
Vesicular stomatitis virus glycoprotein (VSV-G)-pseudotyped HIV-1 was
also generated by transient transfection using 15 µg of
pNL43-Luc(+)Env(
) DNA (12), 3 µg of LVSVG DNA
(5), and 3 µg of RSV-Rev DNA. Transfection efficiency
was assessed by luciferase activity. For infections with pseudotyped
virus, 1 to 2 ml of undiluted viral stocks was added to 1.0 × 106 U937 cells or primary macrophages per
ml for 24 to 48 h. Cells were harvested 48 h postinfection
and assayed for viral transcription by luciferase assays. Cells
(1.0 × 106 to 2.0 × 106) were lysed in 1× reporter lysis buffer
(Promega, Madison, Wis.), and supernatants were collected. Cell extract
(20 µl) was added to 100 µl of luciferase substrate (Promega), and
activity was measured using a luminometer.
Transient transfections of U937 cells.
U937 cells (5.0 × 105 to 6.0 × 105)
were transiently transfected with 1.0 µg of LTR-Luc or mC2,3 LTR
(26) DNA using Lipofectamine 2000 (Gibco BRL, Rockville,
Md.). At 24 h posttransfection, cells were harvested and assayed
for luciferase activity.
RT assays.
Virus replication was measured by RT assays at
various times postinfection (23). Briefly, 10 µl of
supernatant was added to a mixture containing 60 mM Tris, 24 mM
dithiothreitol [DTT], 7 mM MgCl2, 75 mM NaCl, 6 µg of poly(dG)/ml, 12 µg of poly(rC)/ml, 0.06% NP-40, and 10 µCi
of [
-32P]dGTP in a final volume of 50 µl
and incubated at 37°C for 1 h. A 10-µl portion of this
reaction mixture was then transferred to DEAE paper and washed twice in
2× SSC (0.3 M NaCl, 0.03 M sodium citrate) for 15 min at 25°C. RT
activity was quantitated using a phosphorimager. Cells were refed every
3 to 4 days by removing 80% of the spent medium and replacing it with
fresh medium.
Immunofluorescent staining.
To detect cell surface adhesion
molecules, 1.0 × 106 HUVEC were incubated
in staining medium (1% FCS in phosphate-buffered saline [PBS]) with
1 µg of IgG1 isotype fluorescein isothiocyanate (FITC)-conjugated
mouse anti-human CD54 MAb (Sigma) or 1 µg of FITC-conjugated mouse
IgG2a (Pharmingen) isotype control for 30 min at 4°C. Cells were
washed three times in staining medium, and propidium iodide was added
at 10 µg/ml. After dead cells had been gated out, fluorescence was
measured at 530 nm using a Coulter flow cytometer at the Penn State
flow cytometry core facility.
Adhesion assays.
U937 and U937-LIP cells (5.0 × 105) were stained with 1.0 µM
2',7'-bis-(2-carboxyethyl)-5-(and -6-)carboxyfluorescein-acetoxymethyl ester (BCECF-AM) (Molecular Probes, Eugene, Oreg.) at 37°C for 30 min. Cells were washed twice with PBS and cultured with 5 × 104 HUVEC at 37°C for an additional 30 min in
96-well plates. Cells were washed several times with PBS before
fluorescence was measured at 530 nm using a microplate reader.
Nuclear extract preparations and electromobility shift assays
(EMSA).
Nuclear extracts from U937 cells were prepared as
described previously (49) by lysing 1.0 × 106 to 2.0 × 106
cells with 10% Nonidet P-40 in buffer A (10 mM HEPES [pH 7.9], 10 mM
KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 0.5 mM
phenylmethylsulfonyl fluoride). The extracts were recovered in buffer C
(20 mM HEPES [pH 7.9], 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM
DTT, 1 mM phenylmethylsulfonyl fluoride). Annealed C/EBP
binding
site DNA (50 ng; 5' GATCGCCTAGCATTTCATCACACGT 3' and
5' GATCACGTGTGATGAAATGCTAGGC 3') or NF-
B binding
site DNA (5' AGCTAAGGGACTTTCCGCTGGGGACTTTCCAGG 3' and
5' AGCTCCTGGAAAGTCCCCAGCGGAAAGTCCCTT 3') were end
filled with [
-32P]dCTP using bacterial
Klenow fragment (Promega). The DNA probe was used at a specific
activity of 108 to 109
cpm/µg and incubated with 5 µg of nuclear extract samples in a
reaction mixture containing 3 µg of poly(dI-dC) (Amersham
Pharmacia Biotech, Arlington Heights, Ill.), 0.25 M HEPES (pH 7.5), 0.6 M KCl, 50 mM MgCl2, 1 mM EDTA, 7.5 mM DTT, and
9% glycerol for 20 min at 25°C. A 50-fold excess of unlabeled
C/EBP
and NF-
B binding site DNA was used as both specific and
nonspecific competitors. Anti-C/EBP
antibody (0.5 µg; Santa Cruz
Biotechnology, Santa Cruz, Calif.) was used to supershift complexes.
The samples were run on a 6% polyacrylamide gel and visualized by autoradiography.
ELISA.
Enzyme-linked immunosorbent assay (ELISA) plates were
coated with 50 µl of either 4-µg/ml mouse anti-human MAb against
IL-1
or TNF-
in Ngai's coating buffer (15 mM
Na2CO3, 34.8 mM
NaHCO3 [pH 9.6]) or 2-µg/ml mouse anti-human
MAb against IL-6 in 0.1 M NaHCO3 (pH 8.2) and
incubated overnight at 4°C. After plates had been washed four times
in PBS with 0.2% Tween (PBST) for 1 min, plates were blocked with 200 µl of 1% bovine serum albumin-PBS/well and incubated for 2 h
at 25°C. Plates were washed again with PBST, and samples were added
at 100 µl/well and incubated overnight at 4°C. Plates were washed
an additional four times with PBST, and 100 µl of 0.2-µg/ml
biotinylated affinity-purified goat anti-human IL-1
, IL-6, and
TNF-
(0.1 µg/ml) polyclonal antibodies in 1% bovine serum
albumin-PBS were added to each well. Plates were incubated for 2 h at 25°C. After six washes with PBST for 1 min, 100 µl of
1-µg/ml streptavidin peroxidase was added to each well, and samples
were incubated for 30 min at 25°C. Plates were washed eight times
with PBST for 1 min, and 100 µl of
2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) substrate
solution (Sigma) was added to each well. Samples were incubated 60 to
90 min in the dark at 25°C and read with a microplate reader. All
antibodies used for ELISA were purchased from R&D Systems (Minneapolis,
Minn.).
 |
RESULTS |
Endothelial cells provide a microenvironment that enhances HIV-1
transcription.
Cellular microenvironments created by endothelial
and epithelial cells have been demonstrated to influence HIV-1
replication (6, 17, 20, 22, 52). In order to further
understand the importance of these cellular interactions, U1 cells were
cocultured with HUVEC activated with 10 ng of phorbol myristate acetate
(PMA) per ml. U1 cells are promonocytic cells that harbor latent HIV-1 provirus, which can be activated by a variety of factors, including endothelial cell-derived signals (6, 17, 21). The
pretreatment of HUVEC leads to the induction of inflammatory cytokines
and surface adhesion molecules (58), ensuring optimal
interactions between HUVEC and U1 monocytic cells. Consistent with
previous observations, when cocultured with stimulated HUVEC, U1 cells produced >25-fold-higher levels of virus than U1 cells cultured alone,
as measured by RT activity (Fig. 1A).
Furthermore, this ability to enhance virus production in U1 cells was
not due to direct effects of PMA treatment and was specific for
activated HUVEC, since PMA treatment of empty wells, 293T human
embryonic kidney cells, and 3T3 mouse fibroblasts did not result in
significant induction of virus replication (data not shown).

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 1.
Endothelial cells enhance HIV-1 replication in
monocytes/macrophages through a transcriptional
mechanism. (A) U1 cells were cultured alone or with HUVEC pretreated
with 10 ng of PMA per ml. Supernatants were assayed for RT activity
48 h after coculture. (B) Primary macrophages (M ) were
infected with HIV-1 BaL and cultured alone, with HUVEC, or with 3T3
cells. Supernatants were assayed for RT activity 10 days postinfection.
(C) U937 cells were infected with VSV-G-pseudotyped HIV-Luc and
cultured alone or with HUVEC pretreated with 10 ng of PMA per ml. Cells
were lysed 48 h postinfection and assayed for luciferase activity.
(D) Primary macrophages were infected with VSV-G-pseudotyped
HIV-Luc and cultured either alone or with PMA-stimulated (10 ng/ml)
HUVEC. Macrophages were harvested 48 h postinfection and assayed
for luciferase activity. These results are from single experiments
performed in triplicate and are representative of at least three
independent experiments. Error bars show 1 standard deviation.
|
|
We also examined the ability of endothelial cells to enhance HIV-1
expression in primary macrophages isolated from peripheral blood. Cells were infected in the absence or presence of endothelial cells with an R5 virus, BaL, and assayed for viral replication by RT
activity at various times postinfection. At 10 days postinfection, an
eightfold enhancement in viral replication was observed in the primary
macrophages cocultured with HUVEC compared to the macrophages cultured alone (Fig. 1B). Enhanced virus expression was detected over the course of 3 weeks postinfection (data not shown). This increase in HIV-1 replication was dependent upon specific
interactions between macrophages and endothelial cells, since
macrophages cocultured with 3T3 and 293T fibroblast lines did not result in significant changes in virus production (Fig. 1B and
data not shown). In addition, HUVEC were not productively infected by
HIV-1 (data not shown). These results suggest that signals provided by
the endothelial cells enhance HIV-1 replication in primary macrophages.
To address whether endothelial cells enhance HIV-1 expression in
macrophages via a transcriptional mechanism, we used VSV-G to
pseudotype a replication-incompetent HIV-1 construct in which a
luciferase reporter gene (HIV-Luc) was inserted in place of the
envelope gene (Env). This VSV-G-pseudotyped virus enters the cell through a receptor-mediated endocytic mechanism, bypassing receptor-mediated fusion and potential signaling events initiated by
HIV-1 envelope proteins binding to cellular receptors, thus permitting
us to focus specifically on transcriptional effects of cell-cell
interactions. U937 monocytic cells infected with HIV-Luc were
cocultured with stimulated HUVEC and luciferase activity was measured
as an indication of virus transcription. A 14-fold increase in
luciferase activity was observed in infected U937 cells cocultured with
stimulated HUVEC compared to infected U937 cells cultured alone (Fig.
1C). No significant difference in cell numbers recovered from
cultures in the absence and presence of endothelial cells were detected
(data not shown). In addition, primary macrophages infected
with VSV-G pseudotyped HIV-Luc and cocultured with
stimulated HUVEC showed threefold-higher luciferase activity than
infected macrophages cultured alone (Fig. 1D), suggesting that
endothelial cells mediate the induction of HIV-1 expression in
macrophages by a transcriptional mechanism. These results are specific to factors produced by stimulated HUVEC, since pretreatment of
293T or 3T3 cells with PMA did not significantly enhance virus transcription in either U937 cells or primary macrophages (data not shown).
ICAM-1 induces HIV-1 expression in monocytic cells.
Our
experiments with primary macrophages demonstrate that direct
cell contact between endothelial cells and infected macrophages enhances HIV-1 transcription. Endothelial cells express a number of
adhesion molecules that are regulated upon activation, including ICAM-1, which can be strongly induced following PMA treatment (Fig.
2A). Furthermore, previous studies have
shown that mature macrophages express both ICAM-1 and its
ligand, Mac-1 (46, 57). The importance of ICAM-1 in
mediating HIV-1 induction in monocytic cells was tested by blocking
ICAM-1 with antibody in U1-endothelial cell cocultures. Addition of
anti-ICAM-1 antibody to cocultures of U1 and HUVEC resulted in a
2.4-fold decrease in virus induction compared to cocultures with
isotype control (Fig. 2B), suggesting that ICAM-1, in part, provides
signals that activate HIV-1 expression in latently infected monocytic
cells.

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 2.
ICAM-1 on activated endothelial cells induces HIV-1
expression in monocytic cells. (A) Flow cytometry analysis of HUVEC
unstimulated and stimulated with 10 ng of PMA per ml for 24 h.
Cells were stained with anti-CD54 (ICAM-1) antibody or mouse IgG
isotype matched control. (B) U1 cells were cultured with HUVEC
stimulated with 10 ng of PMA per ml. Either anti-ICAM-1 antibody or
mouse IgG isotype control (1 µg/ml) was added to the cultures, and RT
activity was measured 48 h later. These results are from single
experiments performed in triplicate and are representative of four
separate experiments. Error bars show 1 standard deviation. *,
P < 0.05, Student t test.
|
|
Endothelial cell-derived IL-6 induces HIV-1 expression in monocytic
cells.
Endothelial cells, in addition to being a selective
barrier, actively recruit cells and modulate immune responses through the production of soluble factors, including cytokines and chemokines (30, 36, 48, 54). We were interested in identifying
cytokines produced by endothelial cells that potentially regulated
HIV-1 expression; therefore, supernatants from both unactivated and activated HUVEC were collected and analyzed by ELISA for levels of
IL-1
, IL-6, and TNF-
(Table 1).
Unstimulated endothelial cells produced low levels of IL-6, but IL-1
and TNF-
were not detected. After stimulation with 10 ng of PMA per
ml, IL-6 production was dramatically increased ninefold, whereas
IL-1
and TNF-
levels remained low, implying that IL-6 is the
primary inflammatory cytokine produced by PMA-stimulated HUVEC.
An IL-6-specific antibody was used to block the activity of this
cytokine and to determine its role in regulating HIV-1 expression in
monocytic cells. U1 cells were cultured in the upper chamber of a
transwell apparatus above activated endothelial cells, in the absence
or presence of an anti-IL-6 monoclonal antibody or an isotype-matched
control. After 48 h, virus production was examined. A 30 to 40%
decrease in virus production was consistently observed following
treatment with anti-IL-6 antibody compared to the control, suggesting
that IL-6 is partly responsible for induction of HIV-1 transcription by
endothelial cells (Fig. 3).

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 3.
IL-6 induces HIV-1 expression in monocytic cells. U1
cells were cultured with HUVEC stimulated with 10 ng of PMA per ml in
transwells separated with 0.4-µm filters. Anti-IL-6 antibody (1 µg/ml) or mouse IgG isotype control was added to cultures, and RT
activity was measured 48 h later. Each data point represents three
separate experiments performed in triplicate. Error bars show 1 standard deviation. *, P < 0.025, Student
t test.
|
|
Induction of HIV-1 by endothelial cells requires functional C/EBP
factors.
A possible mechanism for the induction of HIV-1 in
macrophages by endothelial cell contact is through the
activation of transcription factors such as NF-
B and C/EBP
.
Potential target genes for C/EBP
in monocytic cells include
cytokines and adhesion molecules such as ICAM-1 and Mac-1 (2, 3,
27). Therefore, ectopic expression of the C/EBP
dominant-negative protein LIP might alter the ability of monocytic
cells to bind and adhere to endothelial cells. Monocytic cell lines
overexpressing LIP have been previously characterized, and LIP has been
demonstrated to specifically inhibit endogenous C/EBP activity in
multiple cell types, including monocytic cell lines (26, 27,
28). As shown in Fig. 4, U937
cells were shown to adhere strongly to activated endothelial cells,
whereas U937-LIP cells displayed a twofold decrease in their ability to adhere, indicating that endogenous C/EBP factors are required for
monocyte-endothelial cell interactions.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 4.
Functional C/EBP factors required for adherence of
monocytes to endothelial cells. U937 and U937 overexpressing LIP cells
were stained with 1.0 µM BCECF-AM and cultured alone or with
unstimulated or lipopolysaccharide-treated (10 µg/ml; STM) HUVEC for
30 min. Fluorescence was measured at 530 nm to determine adhesion.
These results represent single experiments performed in triplicate.
Error bars show 1 standard deviation.
|
|
Previous studies have indicated that C/EBP
is strongly upregulated
in monocytic cells upon activation and that it is required for HIV-1
transcription and replication in monocytes/macrophages (26, 27, 28). Therefore, we examined whether this
transcriptional activator was also required for responses to
endothelial cell-derived signals. U937 cells were cocultured with
stimulated HUVEC for 24 h, and U937 nuclear extracts were prepared
to assay for changes in C/EBP binding activity using EMSA (Fig.
5). After coculture with stimulated
endothelial cells, a diffuse complex that specifically bound C/EBP
oligonucleotides but not NF-
B sequences was significantly increased
in U937 cells (Fig. 5A). Although this complex included multiple C/EBP
family members and isoforms, C/EBP
was the predominant protein in
this complex, since antibody specific to C/EBP
supershifted the
induced binding activity (Fig. 5B). In addition to induction of
C/EBP
, we also observed the induction of other factors, including NF-
B (Fig. 5C).

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 5.
Endothelial cells increase binding of C/EBP and
NF- B to binding sites from HIV-1 LTR. (A) EMSA was performed with
nuclear extracts prepared from U937 cells cultured alone or with HUVEC
stimulated with 10 ng of PMA per ml and an oligonucleotide probe
spanning the 169 bp C/EBP binding site (27). Extracts
were incubated with no competitor (lanes 1 and 2), a 50-fold excess of
specific C/EBP binding site competitor (lane 3), and a 50-fold excess
of nonspecific NF- B binding site competitor (lane 4). (B) Extracts
were incubated with no antibody (lanes 1 and 2) and 0.5 µg of
C/EBP antibody (lanes 3 and 4). Complexes did not supershift with
0.5 µg of nonspecific control, NF- B, antibody (data not shown).
(C) Extracts were probed with an NF- B binding site oligonucleotide
and incubated with no competitor (lanes 1 and 2), a 50-fold excess of
specific NF- B binding site competitor (lane 3), and a 50-fold excess
of nonspecific C/EBP binding site competitor (lane 4).
|
|
To specifically investigate the requirement for C/EBP factors in
endothelial cell-induced HIV-1 transcription in monocytic cells, U1
cells and U1 cells overexpressing LIP (U1-LIP) were cocultured with
HUVEC. Endothelial cells activated with PMA strongly induced HIV-1
replication, producing approximately 100-fold more virus than U1 cells
cultured alone. However, this induction was decreased by approximately
fourfold in U1-LIP cells (Fig. 6A), indicating that endogenous C/EBP factors are necessary for efficient activation of HIV-1 transcription by endothelial cells. The observed induction of viral replication is specific to endothelial cells since
U1 coculture with 293T cells resulted in only modest virus production
(data not shown).

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 6.
Functional C/EBP factors required for endothelial
cell-mediated induction of HIV-1 in monocytic cells. (A) U1 and U1-LIP
cells were cultured alone or with HUVEC stimulated with 10 ng of PMA
per ml. RT activity was measured after 48 h. These results are
representative of three independent experiments. (B) U937 and U937-LIP
cells were infected with VSV-G pseudotyped HIV-Luc and cultured
alone or with HUVEC stimulated with 10 ng of PMA per ml. U937 and
U937-LIP cells were harvested 48 h postinfection and assayed for
luciferase activity. These results are from single experiments
performed in triplicate and are representative of three separate
experiments. (C) U1 and U1-LIP cells were cultured alone or with
PMA-stimulated (10 ng/ml) HUVEC in transwells separated by 0.4-µm
filters. RT activity was measured 48 h later. These results are
representative of three independent experiments. Error bars show 1 standard deviation.
|
|
To determine if the inhibition of HIV-1 expression observed in Fig. 6A
was through a transcriptional mechanism, U937 and U937-LIP cells were
infected with VSV-G-pseudotyped HIV-Luc for 24 h before coculturing with stimulated HUVEC. In cocultures with stimulated endothelial cells, a sixfold increase in luciferase activity was detected in U937 cells compared with U937 cells cultured alone (Fig.
6B), whereas HIV-1 transcription was reduced by approximately 75% in
U937-LIP cells cultured with stimulated HUVEC. Taken together, these
data indicate that C/EBP
activity is induced in
monocytes/macrophages upon interacting with stimulated
endothelial cells and that endogenous C/EBP factors are necessary for
efficient induction of HIV-1 in response to these interactions.
Furthermore, the decrease in virus transcription upon overexpression of
LIP is not due to indirect effects of LIP on other transcription
factors, since U937-LIP cells induced NF-
B binding activity
following coculture with PMA-treated endothelial cells as well as
control U937 cells cocultured with activated endothelial cells (data
not shown).
The potential role of C/EBP
in the induction of HIV-1 by endothelial
cell-derived cytokines was examined by separating monocytic cells from
HUVEC using a transwell system and measuring virus production. A
10-fold induction in virus replication was observed in U1 cells 48 h after culture with stimulated endothelial cells in the lower chamber
(Fig. 6C). The lack of significant virus production when U1 cells were
cultured with stimulated 293T cells suggests that the induction of
viral replication was due to specific soluble factors produced by HUVEC
and not residual PMA from pretreatment of the cells (data not shown).
This induction of HIV-1 expression requires functional C/EBP factors,
since U1-LIP cells did not produce significant levels of virus when
cultured with stimulated endothelial cells in the transwell (Fig. 6C),
indicating that these factors are necessary for monocytic cells to
fully respond to endothelial cell-produced cytokines.
Endothelial cell-induced HIV-1 transcription is dependent upon
C/EBP binding sites in the HIV-1 LTR.
The experiments described
above indicate that C/EBP proteins are required for endothelial
cell-mediated induction of HIV-1 transcription. Previous studies have
demonstrated that there are two critical C/EBP sites within the HIV-1
LTR, C2, located at
178 to
159, and C3, positioned at
120 to
109 (26, 27, 59). To directly assess the importance of
these C/EBP binding sites, HIV-1 LTR-Luc reporter constructs with
either wild-type high-affinity C/EBP sites or mutated C/EBP sites
(mC2,3 LTR) (26) were transiently transfected into U937
cells and cultured either alone or with PMA-stimulated endothelial
cells for 24 h before luciferase activity was examined. As shown
in Fig. 7A, HIV-1 LTR activity was
induced 2.5- to 3-fold in cocultures with endothelial cells. However,
no significant induction of LTR activity by endothelial cells was
observed with the mC2,3 LTR construct, demonstrating the necessity for
C/EBP sites in this response.

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 7.
Induction of HIV-1 transcription and replication by
endothelial cells requires C/EBP binding sites in HIV-1 LTR. (A) U937
cells were transiently transfected with 1.0 µg of LTR-Luc or mC2,3
LTR DNA and cultured alone or with HUVEC pretreated with 10 ng of PMA
per ml. Luciferase activity was measured 24 h posttransfection.
These data are from two experiments performed in triplicate. Error bars
show 1 standard deviation. (B) U937 cells were infected with equivalent
levels of wild-type HIV-1 HXB2 or mutant mC2,C3 HXB2 virus and cultured
with PMA-treated (10 ng/ml; STM) HUVEC. Supernatants were assayed for
RT activity 4 days postinfection. These results are from a single
experiment performed in triplicate and are representative of four
separate experiments. Error bars show 1 standard deviation. *,
P < 0.03, Student t test.
|
|
HIV-1 clones harboring mutations in the high-affinity C/EBP sites were
used to confirm the importance of these sequences in regulating HIV-1
expression in response to endothelial cell signals. Previous studies
have shown a requirement for C/EBP sites during HIV-1 replication in
monocytes/macrophages (27, 28) (data not shown).
To specifically address the role of C/EBP sites in HIV-1
replication in the presence of endothelial cells, U937 cells were
infected with wild-type HXB2 virus or virus with mutated C/EBP sites
(mC2,C3 HXB2) (27, 28) and cultured with PMA-treated endothelial cells. As shown in Fig. 7B, the ability of mC2,C3 HXB2 to
replicate in response to endothelial cell signals was reduced by 60%
compared to that of wild-type HXB2. These data indicate that C/EBP
sites within the HIV-1 LTR are necessary for efficient virus
replication in monocytes/macrophages in response to
microenvironmental signals.
 |
DISCUSSION |
Previous studies have indicated that tissue microenvironments
influence HIV-1 replication (6, 17, 20, 22, 52). Although
it has been suggested that endothelial cells might influence HIV-1
replication by inducing factors such as NF-
B, the role of other
transcriptional activators has not been fully investigated. Our results
suggest that, through the production of soluble factors and direct cell
contact, endothelial cells provide a favorable environment for HIV-1
transcription in macrophages and extend previous studies by
demonstrating that this induction of virus transcription requires
functional C/EBP
.
Upon coculture with endothelial cells, an enhancement of HIV-1
replication and transcription in monocytic cell lines and primary macrophages was observed. Although we show that the induction of HIV-1 in monocytic cells depends on specific cellular interactions with endothelial cells, the ability to transcriptionally activate HIV-1
is not unique to endothelium. Lung epithelial cells have also been
shown to enhance virus expression through similar mechanisms, including
the activation of transcription factors such as C/EBP
and NF-
B
(data not shown) (10). Taken together, these results support models proposing that specific tissue microenvironments can
alter the course of infection at different sites, including the brain,
lymph nodes, and lungs, by promoting HIV-1 transcription.
Although other reports have observed effects in cocultures between
monocytic cells and unstimulated endothelial cells (6, 17), we detected moderate induction of virus expression with unstimulated endothelial cells and needed to activate endothelial cells
to consistently induce robust virus expression. Stimulating endothelial
cells with PMA, lipopolysaccharide, or inflammatory cytokines
dramatically upregulates expression of ICAM-1 and inflammatory molecules such as IL-6, which we and others have shown are critical for
mediating macrophage-endothelial cell interactions and
transcriptional activation of HIV-1 expression in monocytic cells
(6, 17, 30, 52, 54, 58). Our studies further corroborate
these findings by indicating an increased level of ICAM-1 on stimulated endothelial cell surfaces and demonstrating that antibody to ICAM-1 decreases endothelial cell-induced HIV-1 replication in U1 cells.
Inflammatory cytokines from endothelial cells also influence the
expression of HIV-1 in macrophages (15, 21, 33, 39, 41,
42). Previous studies have shown that IL-1
, IL-6, and TNF-
levels are elevated in the sera of AIDS patients (7, 19,
34). Furthermore, IL-6 has been shown to increase virus expression and have a role in promoting AIDS-associated diseases, including Kaposi's sarcoma and non-Hodgkin's lymphoma (18, 19, 36, 41). Our results, which demonstrate that endothelial
cell-produced IL-6 increases HIV-1 transcription, are consistent with
IL-6 having an important role in regulating HIV-1. In addition, other
endothelial factors are clearly involved in regulating HIV-1
replication in monocytic cells, since blocking IL-6 or ICAM-1 does not
completely inhibit HIV-1 expression.
More importantly, our data demonstrate a role for C/EBP
in
endothelial cell-induced HIV-1 expression. When C/EBP factors are
functionally inhibited by a dominant-negative regulator (LIP), endothelial cell-mediated induction of HIV-1 proviral transcription is
decreased. Furthermore, full induction of LTR activity or virus replication requires C/EBP binding sites. This enhancement of virus
expression was inhibited by LIP overexpression, indicating that C/EBP
factors regulate HIV-1 expression through a transcriptional mechanism.
The ability of LIP to inhibit virus expression was not due to a general
block in transcription factor activity, since NF-
B binding activity
was similar in both U937 and U937-LIP cells following coculture with
endothelial cells. C/EBP
most likely regulates HIV-1 transcription,
since this activator was induced in monocytic cells upon coculture with
stimulated endothelial cells. These results showing that functional
C/EBP
is required for HIV-1 transcription in
monocytes/macrophages are consistent with previous
studies demonstrating the importance of C/EBP
for HIV-1
transcription and replication (26, 27, 28, 47, 59).
C/EBP
has been shown to be necessary but not sufficient for
transcriptional activation of the HIV-1 LTR. Overexpression of C/EBP
alone does not induce latent proviral expression, indicating that
posttranslational events or protein-protein interactions are required
for appropriate HIV-1 induction (27). Recent studies demonstrate that C/EBP
can interact both physically and functionally with the basal transcriptional machinery as well as multiple
transcription factor families (1, 51, 61) and chromatin
remodeling complexes (16, 37, 53, 56, 60). In particular,
C/EBP
can interact with NF-
B to synergistically activate the
HIV-1 LTR (47). The potential interaction between C/EBP
and NF-
B, which are both induced by endothelial cells, could
compensate for the mutated C/EBP binding sites and contribute to the
modest reduction in HIV-1 transcription and replication. Combinatorial
mechanisms between various transcription factors and coactivators are
clearly required for appropriate induction and expression of the HIV-1 LTR; however, our data are consistent with the conclusion that C/EBP
is a critical component of the transcriptional activation complex found
in macrophages.
Although C/EBP
is required for HIV-1 transcription in
macrophages, it may also indirectly influence HIV-1 replication
by altering the interactions between macrophages and
endothelial cells. One functional consequence of inhibiting endogenous
C/EBP by ectopic LIP expression in monocytic cells is a decrease in the
ability of cells to bind to endothelial cells. These results indicate
that C/EBP
is required for expression of genes that mediate
monocyte-endothelial cell interactions. C/EBP
expression is induced
upon macrophage activation and differentiation
(38) and has been shown to coordinate the expression of
many genes involved in macrophage activation, such as ICAM-1
and Mac-1 (27) and inflammatory cytokines (2;
reviewed in references 45 and 61), all of
which have functionally important NF-
B and C/EBP
sites within
their promoters (11, 35, 58). Furthermore, we have
preliminary data suggesting that IL-6 gene expression in
macrophages requires functional C/EBP
. In this study, we
demonstrate the importance of microenvironments in regulating HIV-1
transcription in macrophages, particularly through endothelial
cell-mediated signals. One such signal, IL-6, can further increase
C/EBP
expression (1), exemplifying the autoregulatory
roles of IL-6 and C/EBP
. Together, these observations underscore the
importance of C/EBP
in regulating macrophage function and
coordinating gene expression during the inflammatory response initiated
by HIV-1 infection.
 |
ACKNOWLEDGMENTS |
We thank R. Connor for the HIV constructs [pHIV-BaL,
pNL43-Luc(+)Env(
), and RSV-Rev], M. Vodicka for the VSV-G envelope
construct (LVSVG), and L. Truong for technical assistance. We also
thank P. Correll and B. Wigdahl for critically reading the manuscript and J. Cannon at the Penn State cytokine core facility and E. Kunze at
the Penn State flow cytometry core facility for valuable assistance.
This work was supported in part by funds from the Penn State Life
Sciences Consortium seed grant and NIH grant AI46261 to A.J.H.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Veterinary Science, 115 Henning Building, Pennsylvania State
University, University Park, PA 16801. Phone: (814) 863-0340. Fax:
(814) 863-6140. E-mail: ajh6{at}psu.edu.
Present address: Department of Pharmaceutical Sciences, School of
Pharmacy, University of Colorado Health Sciences Center, Denver, CO 80262.
 |
REFERENCES |
| 1.
|
Akira, S.
1997.
IL-6-regulated transcription factors.
Int. J. Biochem. Cell Biol.
29:1401-1418[CrossRef][Medline].
|
| 2.
|
Akira, S.,
H. Isshiki,
T. Sugita,
T. Osamu,
S. Kinoshita,
Y. Nishio,
T. Nakajima,
T. Hirano, and T. Kishimoto.
1990.
A nuclear factor for IL-6 expression (NF-IL6) is a member of the C/EBP family.
EMBO J.
9:1897-1906[Medline].
|
| 3.
|
Akira, S., and T. Kishimoto.
1992.
IL-6 and NF-IL6 in acute-phase response and viral infection.
Immunol. Rev.
127:25-50[CrossRef][Medline].
|
| 4.
|
Baeuerle, P. A., and T. Henkel.
1994.
Function and activation of NF- B in the immune system.
Annu. Rev. Immunol.
12:141-180[Medline].
|
| 5.
|
Bartz, S. R., and M. A. Vodicka.
1997.
Production of high-titer human immunodeficiency virus type 1 pseudotyped with vesicular stomatitis virus glycoprotein.
Methods
12:337-342[CrossRef][Medline].
|
| 6.
|
Borghi, M. O.,
P. Panzeri,
R. Shattock,
S. Sozzani,
A. Dobrina, and P. L. Meroni.
2000.
Interaction between chronically HIV-infected promonocytic cells and human umbilical vein endothelial cells: role of proinflammatory cytokines and chemokines in viral expression modulation.
Clin. Exp. Immunol.
120:93-100[CrossRef][Medline].
|
| 7.
|
Breen, E. C.,
A. R. Rezai,
K. Nakajima,
G. N. Beall,
R. T. Mitsuyasu,
T. Hirano,
T. Kishimoto, and O. Martinez-Maza.
1990.
Infection with HIV is associated with elevated IL-6 levels and production.
J. Immunol.
144:480-484[Abstract].
|
| 8.
|
Cao, Z.,
R. Umek, and S. McKnight.
1991.
Regulated expression of three C/EBP isoforms during adipose conversion of 3T3-L1 cells.
Genes Dev.
5:1538-1552[Abstract/Free Full Text].
|
| 9.
|
Chayt, K. J.,
M. E. Harper,
L. M. Marselle,
E. B. Lewis,
R. M. Rose,
J. M. Oleske,
L. G. Epstein,
F. Wong-Staal, and R. C. Gallo.
1986.
Detection of HTLV-III RNA in lungs of patients with AIDS and pulmonary involvement.
JAMA
256:2356-2359[Abstract].
|
| 10.
|
Chene, L.,
M. Nugeyre,
F. Barre-Sinoussi, and N. Israel.
1999.
High-level replication of human immunodeficiency virus in thymocytes requires NF- B activation through interaction with thymic epithelial cells.
J. Virol.
73:2064-2073[Abstract/Free Full Text].
|
| 11.
|
Chini, B. A.,
M. A. Fiedler,
L. Milligan,
T. Hopkins, and J. M. Stark.
1998.
Essential roles of NF- B and C/EBP in the regulation of intercellular adhesion molecule-1 after respiratory syncytial virus infection of human respiratory epithelial cell cultures.
J. Virol.
72:1623-1626[Abstract/Free Full Text].
|
| 12.
|
Connor, R. I.,
B. Chen,
S. Choe, and N. Landau.
1995.
Vpr is required for efficient replication of human immunodeficiency virus type-1 in mononuclear phagocytes.
Virology
206:936-944.
|
| 13.
|
Cooper, C.,
D. Johnson,
C. Roman,
N. Avitahl,
P. Tucker, and K. Calame.
1992.
The C/EBP family of transcriptional activators is functionally important for Ig Vh promoter activity in vivo and in vitro.
J. Immunol.
149:3225-3231[Abstract].
|
| 14.
|
Descombes, P., and U. Schibler.
1991.
A liver-enriched transcriptional activator protein, LAP, and a transcriptional inhibitory protein, LIP, are translated from the same mRNA.
Cell
67:569-579[CrossRef][Medline].
|
| 15.
|
Duh, E. J.,
W. J. Maury,
T. M. Folks,
A. S. Fauci, and A. B. Rabson.
1989.
Tumor necrosis factor activates human immunodeficiency virus type 1 through induction of nuclear factor binding to the NF- B sites in the long terminal repeat.
Proc. Natl. Acad. Sci. USA
86:5974-5978[Abstract/Free Full Text].
|
| 16.
|
El Kharroubi, A.,
G. Piras,
R. Zensen, and M. A. Martin.
1998.
Transcriptional activation of the integrated chromatin-associated human immunodeficiency virus type 1 promoter.
Mol. Cell. Biol.
18:2535-2544[Abstract/Free Full Text].
|
| 17.
|
Fan, S.,
K. Hsia, and T. S. Edgington.
1994.
Upregulation of human immunodeficiency virus-1 in chronically infected monocytic cell line by both contact with endothelial cells and cytokines.
Blood
84:1567-1572[Abstract/Free Full Text].
|
| 18.
|
Fauci, A. S.
1988.
The human immunodeficiency virus: infectivity and mechanisms of pathogenesis.
Science
239:617-622[Abstract/Free Full Text].
|
| 19.
|
Fauci, A. S.
1993.
Multifactorial nature of human immunodeficiency virus disease: implications for therapy.
Science
262:1011-1018[Abstract/Free Full Text].
|
| 20.
|
Faure, E.,
P. Lecine,
C. Lipcey,
S. Champion, and J. Imbert.
1997.
Cell-to-cell contact activates the long terminal repeat of human immunodeficiency virus 1 through its B motif.
Eur. J. Biochem.
244:568-574[Medline].
|
| 21.
|
Folks, T. M.,
J. Justement,
A. Kinter,
C. A. Dinarello, and A. S. Fauci.
1987.
Cytokine-induced expression of HIV-1 in a chronically infected promonocyte cell line.
Science
238:800-802[Abstract/Free Full Text].
|
| 22.
|
Gilles, P. N.,
J. L. Lathey, and S. A. Spector.
1995.
Replication of macrophage-tropic and T-cell-tropic strains of human immunodeficiency virus type 1 is augmented by macrophage-endothelial cell contact.
J. Virol.
69:2133-2139[Abstract].
|
| 23.
|
Goff, S.,
P. Traktman, and D. Baltimore.
1981.
Isolations and properties of Moloney murine leukemia virus mutants: use of a rapid assay for release of virion reverse transcriptase.
J. Virol.
38:239-248[Abstract/Free Full Text].
|
| 24.
|
Griffin, G. E.,
K. Leung,
T. M. Folks,
S. Kunkel, and G. J. Nabel.
1989.
Activation of HIV gene expression during monocyte differentiation by induction of NF- B.
Nature
339:70-73[CrossRef][Medline].
|
| 25.
|
Guilian, D.,
K. Vaca, and C. A. Noonan.
1990.
Secretion of neurotoxins by mononuclear phagocytes infected with HIV-1.
Science
250:1593-1596[Abstract/Free Full Text].
|
| 26.
|
Henderson, A. J.,
X. Zou, and K. L. Calame.
1995.
C/EBP proteins activate transcription from the human immunodeficiency virus type 1 long terminal repeat in macrophages/monocytes.
J. Virol.
69:5337-5344[Abstract].
|
| 27.
|
Henderson, A. J.,
R. I. Connor, and K. L. Calame.
1996.
C/EBP activators are required for HIV-1 replication and proviral induction in monocytic cell lines.
Immunity
5:91-101[CrossRef][Medline].
|
| 28.
|
Henderson, A. J., and K. L. Calame.
1997.
CCAAT/enhancer binding protein (C/EBP) sites are required for HIV-1 replication in primary macrophages but not CD4+ T cells.
Proc. Natl. Acad. Sci. USA
94:8714-8719[Abstract/Free Full Text].
|
| 29.
|
Honda, Y.,
L. Rogers,
K. Nakata,
B. Zhao,
R. Pine,
Y. Nakai,
K. Kurosu,
W. N. Rom, and M. Weiden.
1998.
Type 1 interferon induces inhibitory 16-kD CCAAT/enhancer binding protein (C/EBP) , repressing the HIV-1 long terminal repeat in macrophages: pulmonary tuberculosis alters C/EBP expression, enhancing HIV-1 replication.
J. Exp. Med.
188:1255-1265[Abstract/Free Full Text].
|
| 30.
|
Imaizumi, T.,
H. Itaya,
K. Fujita,
D. Kudoh,
S. Kudoh,
K. Mori,
K. Fujimoto,
T. Matsumiya,
H. Yoshida, and K. Satoh.
2000.
Expression of tumor necrosis factor-alpha in cultured human endothelial cells stimulated with lipopolysaccharide or interleukin-1 alpha.
Arterioscler. Thromb. Vasc. Biol.
20:410-415[Abstract/Free Full Text].
|
| 31.
|
Jacque, J. M.,
B. Fernandez,
F. Arenzana-Seisdedos,
D. Thomas,
F. Baleux,
J. L. Virelizier, and F. Bachelerie.
1996.
Permanent occupancy of the human immunodeficiency virus type 1 enhancer by NF- B is needed for persistent viral replication in monocytes.
J. Virol.
70:2930-2938[Abstract].
|
| 32.
|
Koenig, S.,
H. E. Gendelman,
J. N. Orenstein,
M. C. Dal Canto,
G. H. Pezeshkpour,
M. Yungbluth,
F. Janotta,
A. Aksamit,
M. A. Martin, and A. S. Fauci.
1986.
Detection of AIDS virus in macrophages in brain tissue from AIDS patients with encephalopathy.
Science
233:1089-1093[Abstract/Free Full Text].
|
| 33.
|
Koyanagi, Y.,
W. A. O'Brien,
J. Q. Zhao,
D. W. Golde,
J. C. Gasson, and I. S. Y. Chen.
1988.
Cytokines alter production of HIV-1 from primary mononuclear phagocytes.
Science
241:1673-1675[Abstract/Free Full Text].
|
| 34.
|
Lahdevirta, J.,
C. P. J. Maury,
A. M. Teppo, and H. Repo.
1988.
Elevated levels of circulating cachectin/tumor necrosis factor in patients with acquired immunodeficiency syndrome.
Am. J. Med.
85:289-291[CrossRef][Medline].
|
| 35.
|
Ledebur, H. C., and T. P. Parks.
1995.
Transcriptional regulation of the intercellular adhesion molecule-1 gene by inflammatory cytokines in human endothelial cells.
J. Biol. Chem.
270:933-943[Abstract/Free Full Text].
|
| 36.
|
Miles, S. A.,
A. R. Rezai,
J. F. Salazar-Gonzalez,
M. VanderMeyden,
R. H. Stevens,
D. M. Logan,
R. T. Mitsuyasu,
T. Taga,
T. Hirano,
T. Kishimoto, and O. Martinez-Maza.
1990.
AIDS Kaposi sarcoma-derived cells produce and respond to interleukin-6.
Proc. Natl. Acad. Sci. USA
87:4068-4072[Abstract/Free Full Text].
|
| 37.
|
Mink, S.,
B. Haenig, and K. H. Klempnauer.
1997.
Interaction and functional collaboration of p300 and C/EBP .
Mol. Cell. Biol.
17:6609-6617[Abstract].
|
| 38.
|
Natsuka, S.,
S. Akira,
Y. Nishio,
S. Hashimoto,
T. Sugita,
H. Isshiki, and T. Kishimoto.
1992.
Macrophage differentiation-specific expression of NF-IL6, a transcription factor for interleukin-6.
Blood
79:460-466[Abstract/Free Full Text].
|
| 39.
|
Osborn, L.,
S. Kunkel, and G. J. Nabel.
1989.
Tumor necrosis factor and interleukin 1 stimulate the human immunodeficiency virus enhancer by the activation of the nuclear factor B.
Proc. Natl. Acad. Sci. USA
86:2336-2340[Abstract/Free Full Text].
|
| 40.
|
Pear, W. S.,
G. P. Nolan,
M. L. Scott, and D. Baltimore.
1993.
Production of high-titer helper-free retroviruses by transient transfection.
Proc. Natl. Acad. Sci. USA
90:8392-8396[Abstract/Free Full Text].
|
| 41.
|
Poli, G.,
P. Bressler,
A. Kinter,
E. Duh,
W. C. Timmer,
A. Rabson,
J. S. Justement,
S. Stanley, and A. S. Fauci.
1990.
Interleukin 6 induces human immunodeficiency virus expression in infected monocytic cells alone and in synergy with tumor necrosis factor by transcriptional and post-transcriptional mechanisms.
J. Exp. Med.
172:151-158[Abstract/Free Full Text].
|
| 42.
|
Poli, G.,
A. Kinter,
J. S. Justement,
J. H. Kehrl,
P. Bressler,
S. Stanley, and A. S. Fauci.
1990.
Tumor necrosis factor functions in an autocrine manner in the induction of human immunodeficiency virus expression.
Proc. Natl. Acad. Sci. USA
87:782-785[Abstract/Free Full Text].
|
| 43.
|
Poli, G.,
A. L. Kinter,
E. Vicenzi, and A. S. Fauci.
1994.
Cytokine regulation of acute and chronic HIV infection in vitro: from cell lines to primary mononuclear cells.
Res. Immunol.
145:578-582[CrossRef][Medline].
|
| 44.
|
Poli, G.,
A. L. Kinter, and A. S. Fauci.
1994.
Interleukin 1 induces expression of the human immunodeficiency virus alone and in synergy with interleukin 6 in chronically infected U1 cells: inhibition of inductive effects by the interleukin 1 receptor agonist.
Proc. Natl. Acad. Sci. USA
91:108-112[Abstract/Free Full Text].
|
| 45.
|
Poli, V.
1998.
The role of C/EBP isoforms in the control of inflammatory and native immunity functions.
J. Biol. Chem.
273:29279-29282[Free Full Text].
|
| 46.
|
Prieto, J.,
A. Eklund, and M. Patarroyo.
1994.
Regulated expression of integrins and other adhesion molecules during differentiation of monocytes into macrophages.
Cell. Immunol.
156:191-211[CrossRef][Medline].
|
| 47.
|
Ruocco, M. R.,
X. Chen,
C. Ambrosino,
E. Dragonetti,
W. Liu,
M. Mallardo,
G. De Falco,
C. Palmieri,
G. Franzoso,
I. Quinto,
S. Venuta, and G. Scala.
1996.
Regulation of HIV-1 long terminal repeats by interaction of C/EBP (NF-IL6) and NF- B/Rel transcription factors.
J. Biol. Chem.
271:22479-22486[Abstract/Free Full Text].
|
| 48.
|
Samaniego, F.,
P. D. Markham,
R. Gendelman,
R. C. Gallo, and B. Ensoli.
1997.
Inflammatory cytokines induce endothelial cells to produce and release basic fibroblast growth factor and to promote Kaposi's sarcoma-like lesions in nude mice.
J. Immunol.
158:1887-1894[Abstract].
|
| 49.
|
Schreiber, E.,
P. Matthias,
M. M. Muller, and W. Schaffner.
1989.
Rapid detection of octamer binding proteins with "miniextracts" prepared from a small number of cells.
Nucleic Acids Res.
17:6419[Free Full Text].
|
| 50.
|
Schrier, R. D.,
J. A. McCutchan, and C. A. Wiley.
1993.
Mechanisms of immune activation of human immunodeficiency virus in monocytes/macrophages.
J. Virol.
67:5713-5720[Abstract/Free Full Text].
|
| 51.
|
Schwartz, C.,
P. Catez,
O. Rohr,
D. Lecestre,
D. Aunis, and E. Schaeffer.
2000.
Functional interactions between C/EBP, Sp1, and COUP-TF regulate human immunodeficiency virus type 1 gene transcription in human brain cells.
J. Virol.
74:65-73[Abstract/Free Full Text].
|
| 52.
|
Shattock, R. J.,
J. S. Friedland, and G. E. Griffin.
1993.
Release of human immunodeficiency virus by THP-1 cells and human macrophages is regulated by cellular adherence and activation.
J. Virol.
67:3569-3575[Abstract/Free Full Text].
|
| 53.
|
Sheppard, K.,
D. W. Rose,
Z. K. Haque,
R. Kurokawa,
E. McInerney,
S. Westin,
D. Thanos,
M. G. Rosenfeld,
C. K. Glass, and T. Collins.
1999.
Transcriptional activation by NF- B requires multiple coactivators.
Mol. Cell. Biol.
19:6367-6378[Abstract/Free Full Text].
|
| 54.
|
Shukaliak, J. A., and K. Dorovini-Zis.
2000.
Expression of the beta-chemokines RANTES and MIP-1 beta by human brain microvessel endothelial cells in primary culture.
J. Neuropathol. Exp. Neurol.
59:339-352[Medline].
|
| 55.
|
Spencer, D., and R. Price.
1992.
Human immunodeficiency virus and the central nervous system.
Annu. Rev. Microbiol.
46:655-693[CrossRef][Medline].
|
| 56.
|
Steger, D. J.,
A. Eberharter,
S. John,
P. A. Grant, and J. L. Workman.
1998.
Purified histone acetyltransferase complexes stimulate HIV-1 transcripts from preassembled nucleosomal arrays.
Proc. Natl. Acad. Sci. USA
95:12924-12929[Abstract/Free Full Text].
|
| 57.
|
Stent, G.,
L. Irving,
S. Lewin, and S. M. Crowe.
1995.
The kinetics of surface expression of CD11/CD18 integrins and CD54 on monocytes and macrophages.
Clin. Exp. Immunol.
100:366-376[Medline].
|
| 58.
|
Stratowa, C., and M. Audette.
1995.
Transcriptional regulation of the human intercellular adhesion molecule-1 gene: a short overview.
Immunobiology
193:293-304[Medline].
|
| 59.
|
Tesmer, V. M.,
A. Rajadhyaksha,
J. Babin, and M. Bina.
1993.
NF-IL6-mediated transcriptional activation of the long terminal repeat of the human immunodeficiency virus type 1.
Proc. Natl. Acad. Sci. USA
90:7298-7302[Abstract/Free Full Text].
|
| 60.
|
Vanden Berghe, W.,
K. De Bosscher,
E. Boone,
S. Plaisance, and G. Haegeman.
1999.
The nuclear factor- B engages CBP/p300 and histone acetyltransferase activity for transcriptional activation of the interleukin-6 gene promoter.
J. Biol. Chem.
274:32091-32098[Abstract/Free Full Text].
|
| 61.
|
Wedel, A., and H. W. Ziegler-Heitbrock.
1995.
The C/EBP family of transcription factors.
Immunobiology
193:171-185[Medline].
|
| 62.
|
Williams, S.,
C. Cantwell, and P. Johnson.
1991.
A family of C/EBP related proteins capable of forming covalently linked leucine zipper dimers in vitro.
Genes Dev.
5:1553-1567[Abstract/Free Full Text].
|
Journal of Virology, October 2001, p. 9703-9712, Vol. 75, No. 20
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.20.9703-9712.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Mameli, G., Deshmane, S. L., Ghafouri, M., Cui, J., Simbiri, K., Khalili, K., Mukerjee, R., Dolei, A., Amini, S., Sawaya, B. E.
(2007). C/EBPbeta regulates human immunodeficiency virus 1 gene expression through its association with cdk9. J. Gen. Virol.
88: 631-640
[Abstract]
[Full Text]
-
Wilson, R. L., Fuentes, S. M., Wang, P., Taddeo, E. C., Klatt, A., Henderson, A. J., He, B.
(2006). Function of Small Hydrophobic Proteins of Paramyxovirus. J. Virol.
80: 1700-1709
[Abstract]
[Full Text]
-
Devadas, K., Hardegen, N. J., Wahl, L. M., Hewlett, I. K., Clouse, K. A., Yamada, K. M., Dhawan, S.
(2004). Mechanisms for Macrophage-Mediated HIV-1 Induction. J. Immunol.
173: 6735-6744
[Abstract]
[Full Text]
-
Rohr, O., Marban, C., Aunis, D., Schaeffer, E.
(2003). Regulation of HIV-1 gene transcription: from lymphocytes to microglial cells. J. Leukoc. Biol.
74: 736-749
[Abstract]
[Full Text]
-
Sundstrom, J.B., Martinson, D.E., Mosunjac, M., Bostik, P., McMullan, L.K., Donahoe, R.M., Gravanis, M.B., Ansari, A.A.
(2003). Norepinephrine Enhances Adhesion of HIV-1-Infected Leukocytes to Cardiac Microvascular Endothelial Cells. Exp. Biol. Med.
228: 730-740
[Abstract]
[Full Text]
-
Lin, Y., Bright, A. C., Rothermel, T. A., He, B.
(2003). Induction of Apoptosis by Paramyxovirus Simian Virus 5 Lacking a Small Hydrophobic Gene. J. Virol.
77: 3371-3383
[Abstract]