Previous Article | Next Article 
Journal of Virology, October 2001, p. 9654-9664, Vol. 75, No. 20
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.20.9654-9664.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Regression of Established Human Papillomavirus Type 16 (HPV-16) Immortalized Tumors In Vivo by Vaccinia Viruses Expressing
Different Forms of HPV-16 E7 Correlates with Enhanced
CD8+ T-Cell Responses That Home to the Tumor Site
Abigail
Lamikanra,1
Zhen-Kun
Pan,1
Stuart N.
Isaacs,2
Tzyy-Choou
Wu,3 and
Yvonne
Paterson1,*
Department of
Microbiology1 and Division of
Infectious Diseases, Department of
Medicine,2 University of Pennsylvania,
Philadelphia, Pennsylvania 19104, and Department of
Pathology, Johns Hopkins University School of Medicine, Baltimore,
Maryland 212053
Received 28 November 2000/Accepted 20 June 2001
 |
ABSTRACT |
Using vaccinia virus as a live vector, we show that the
expression of human papillomavirus type 16 (HPV-16) E7 fused to a nonhemolytic portion of the Listeria
monocytogenes virulence factor, listeriolysin O (LLO),
induces an immune response that causes the regression of established
HPV-16 immortalized tumors in C57BL/6 mice. The vaccinia virus
construct expressing LLO fused to E7 (VacLLOE7) was compared with two
previously described vaccinia virus constructs: one that expresses
unmodified E7 (VacE7) and another that expresses E7 in a form designed
to direct it to intracellular lysosomal compartments and improve major
histocompatibility complex class II-restricted responses
(VacSigE7LAMP-1). C57BL/6 mice bearing established HPV-16 immortalized
tumors of 5 or 8 mm were treated with each of these vaccines. Fifty
percent of the mice treated with VacLLOE7 remained tumor free 2 months
after tumor inoculation, whereas 12 to 25% of the mice were tumor free
after treatment with VacSigE7LAMP-1 (depending on the size of the
tumor). No mice were tumor free in the group given VacE7. Compared to
VacE7, VacSigE7LAMP-1 and VacLLOE7 resulted in increased numbers of
H2-Db-specific tetramer-positive CD8+ T
cells in mouse spleens that produced gamma interferon and tumor necrosis factor alpha upon stimulation with RAHYNIVTF peptide. In
addition, the highest frequency of tetramer-positive T cells was seen
in the tumor sites of mice treated with VacLLOE7. An increased
efficiency of E7-specific lysis by splenocytes from mice immunized with
VacLLOE7 was also observed. These results indicate that the fusion of
E7 with LLO not only enhances antitumor therapy by improving the
tumoricidal function of E7-specific CD8+ T cells but may
also increase the number of antigen-specific CD8+ T cells
in the tumor, the principle site of antigen expression.
 |
INTRODUCTION |
Human papillomavirus (HPV)
type 16 (HPV-16) infection in humans is associated with most cervical
cancers (47), and expression of the early oncogenic
proteins E6 and E7 is required to maintain the transformed state of the
tumor cell. Therefore, E7 is an appropriate tumor-specific antigen and
target for vaccine-based treatment of HPV-16-associated malignancies
(9). Specific immunity against HPV-16 transformed tumors
in murine models has been achieved by a number of vaccine protocols
(reviewed in reference 38). These include administering E7
protein (14, 40), the CD8+ epitope
in E7 specific for H-2Db (13), DNA that codes
for E7 (8), or recombinant vaccinia virus vectors that
express E7 (22, 23). An effective therapeutic response in
most of these situations correlates with the induction of cytotoxic T
lymphocytes (CTLs) specific for the E7 CD8+
epitope, RAHYNIVTF (13).
The role of CD8+ T cells in tumor immunity can be
diverse. Not only are these cells able to lyse tumor targets that
express tumor-specific antigen in the context of major
histocompatibility complex (MHC) class I but also they secrete cellular
mediators, such as gamma interferon (IFN-
) and tumor necrosis factor
alpha (TNF-
). Both IFN-
and TNF-
have potent antitumor effects
(27). The production of inducible nitric oxide synthase by
macrophages requires both TNF-
and IFN-
(12). The
chemokines IP-10 (IFN-
-inducible protein 10) and Mig (monokine
induced by IFN-
) are also produced by macrophages in response to
IFN-
. These chemoattractants mediate the infiltration of NK cells
(37) and also inhibit angiogenesis (2, 32).
TNF-
is also able to recruit NK cells to the tumor, providing a
valuable mechanism by which tumor cells that have lost the expression
of MHC class I molecules can be removed (16, 19). Possible
direct effects of IFN-
on tumor cells include the regulation of
proteosome composition and hence antigen processing (45)
and the upregulation of MHC class I expression (3) to enhance tumor immunogenicity.
Immunization with fusion products that consist of tumor antigen
determinants and a nonantigenic determinant, either as naked DNA or
purified protein, can significantly enhance tumor-specific immunity
(1, 8, 14, 35). Previous work in our laboratory has shown
that a recombinant Listeria monocytogenes
construct that expresses a fusion of influenza virus nucleoprotein (NP) with listeriolysin O (LLO) at the N terminus is able to induce antigen-specific immunity that mediates the protection of mice against
tumors expressing NP (26, 43). The hemolysin LLO is a
secreted pore-forming protein that is essential for the escape of
L. monocytogenes from the
microbicidal environment of the macrophage phagolysosome (15). However, the form of LLO
fused to NP used in these studies had been modified to remove the
sequence that codes for the hemolytic portion of LLO
(24). We recently described (G. Gunn et al., submitted for
publication) a potent E7-based immunotherapeutic agent that
could cause the regression of established HPV-16 immortalized
transplantable mouse tumors and that also used L. monocytogenes as a vaccine vector and the E7 antigen fused to LLO. Interestingly, a similar vector that expressed E7 alone was
quite ineffective in the same model tumor system. There are a number of
genetic differences between these two recombinant listerial
vectors, but a major difference is the form of the antigen expressed.
In order to address whether fusing E7 to LLO (LLOE7) enhances the
immunogenicity of E7, in this study LLOE7 was delivered using a
nonlisterial vector, vaccinia virus, and compared to two other forms of
E7 that are expressed by totally isogenic vaccinia virus constructs and
that are known to have different antitumor potencies. One construct
expresses unmodified E7 (VacE7), and the other expresses E7 fused to
lysosome-associated membrane protein 1 (LAMP-1) designed to
improve MHC class II-restricted responses (VacSigE7LAMP-1)
(22). We show that, compared to other vaccinia virus-based
E7 vaccines, VacLLOE7 is a potent antitumor immunotherapeutic agent
with important clinical potential for the treatment of cervical cancers.
 |
MATERIALS AND METHODS |
Tumor cell lines and maintenance.
The TC-1 cell line
described previously (22) was obtained from the National
Biological Resources Branch, National Cancer Institute, National
Institutes of Health, Frederick, Md. EL4 and EL4-E7 (39)
were kind gifts from Robert Tindle, Sir Albert Sakzewski Virus Research
Center, Royal Children's Hospital, Brisbane, Queensland, Australia.
Each line was maintained in RP-10, which consisted of RPMI 1640 (Cellgro) supplemented with 2 mM L-glutamine, 0.1 mM
minimal essential medium with nonessential amino acids, 1 mM sodium pyruvate, 10 U of penicillin/ml, 10 µg of streptomycin/ml, 10% fetal bovine serum, and 10% NCTC medium (all from GIBCO BRL). TC-1 and EL4-E7 were maintained in RP-10 that also contained 400 µg
of Geneticin/ml. All cells were grown in a 37°C incubator at 95%
humidity and 10% CO2.
DNA constructs and generation of vaccinia virus
recombinants.
To ensure that the vaccines differed only by the
form of E7 expressed, the vaccinia virus recombinants used were
generated by transfection with pSC11-based plasmids. pSC11 is a plasmid that drives foreign gene expression with the vaccinia virus early-late promoter p7.5. Each construct differed only in the fusion product of E7
encoded. Figure 1 is a schematic of each
plasmid that describes the different forms of E7 expressed by each
recombinant.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic of the different forms of E7 expressed by each
vaccinia virus recombinant. In each form, the pSC11 vaccinia virus
vector was used to insert the gene of interest into the thymidine
kinase (TK) gene of the WR host strain of vaccinia virus.
|
|
The portion of LLO that is required for its sulfhydryl-dependent
hemolytic activity was removed by using PCR to exclude amino
acids 442 to 529, which contain the cysteine-dependent active
site of LLO
(
24). An
XhoI site was introduced into the 3'
end
of the resultant truncated gene to allow ligation with the gene
that codes for HPV-16 E7. The resultant fusion of LLO and E7 (LLOE7)
was then cloned into the
XbaI/
NheI site of pAM401
upstream of
the
prfA gene for subsequent expression by
Listeria (Gunn et al.,
submitted).
To allow expression by vaccinia virus, the LLOE7 sequence was cloned
into pSC11. To do this, we first modified a portion of
the LLOE7
sequence by PCR to alter a T
5NT sequence at the
5' end
of the LLOE7 sequence to ensure its proper early transcription
by vaccinia virus. We also introduced restriction sites to permit
in-frame cloning of this fragment of LLO into a previously described
pUC19 plasmid containing the full LLOE7 open reading frame (Gunn
et
al., submitted). The oligonucleotides synthesized for this
modification
were as follows: pGG55LO (3'GCATTTTCG
CTTAAGC5'),
where the underlined sequence represents an
EcoRI site
within
the LLO sequence, and
pGG55UPNXC (5'GGAATTC
CATATGCCCGGGATGA
7TAATGCTAGTCTTTATTACAC
TTATATTAG3'),
where the underlined sequence represents an
NdeI/
XbaI
site. After PCR amplification, the
resultant fragment was digested
with
EcoRI and
NdeI and then ligated into similarly cut pUC19
containing
the nonhemolytic sequence of LLO fused to E7. From
here, the modified
fusion protein was excised using
XmaI and inserted
into the
XmaI site of pSC11. Successful introduction of these
changes
(without loss of the original sequence that codes for
LLOE7) was
confirmed by
sequencing.
The recombinant virus was isolated by standard procedures
(
7). Briefly, the pSC11LLOE7 construct was used to
transfect
CV1 cells that had been infected with wild-type vaccinia
virus
strain WR (Western Reserve). Cell lysates obtained from this
infection-transfection
step contained vaccinia virus recombinants that
were plaque purified
three times on a thydimidine
kinase-deficient cell line in the
presence of bromodeoxyuridine
and 5-bromo-4-chloro-3-indolyl-

-
D-galactopyranoside
(X-Gal) staining. Expression of the LLOE7 fusion product by
plaque-purified
vaccinia virus was verified by Western blotting using
an antibody
directed against the LLO protein sequence. VacSigE7LAMP-1
and
VacE7 were made as described previously (
44) using the
same
vaccinia virus vector (pSC11) and host strain of vaccinia virus
(WR).
In vivo treatment of tumors.
Eight- to 10-week-old female
C57BL/6 mice (Charles River Laboratories) were injected subcutaneously
(s.c.) in the flank with 1 × 105 or 2 × 105 viable TC-1 cells in either
phosphate-buffered saline (PBS) or Matrigel (BD Biosciences).
TC-1 suspensions in Matrigel were prepared by adding 400 µl of
Matrigel to 2 × 105 TC-1 cells in 100 µl
of PBS. Upon the appearance of palpable tumors (7 days later), groups
of eight mice were injected twice intraperitoneally (i.p.) on days
11 and 18 after tumor inoculation with 107
PFU of vaccinia virus. Tumor sizes were assessed every 2 to 3 days
using calipers to determine the average diameter of each tumor. Mice
were sacrificed when tumor sizes exceeded 25 mm.
In vitro CTL induction and activity.
Eight- to 10-week-old
female C57BL/6 mice were injected twice i.p. with
107 PFU of vaccinia virus as described above.
Thirteen days later, the spleens from two mice per vaccination group
were pooled and homogenized in RP-10 using nylon mesh bags.
Erythrocytes were lysed using Tris ammonium chloride solution and
washed twice in RP-10. Primary cultures of 2 × 106 splenocytes/ml were incubated in upright T75
flasks with irradiated (30,000 rads) TC-1 tumor cells in 25 ml of RP-10
for 6 days. The ratio of splenocytes to TC-1 cells for each group was
100:1. Following this period, cells from each primary culture were
prepared for a conventional 5-h chromium release assay at increasing
effector/target (E:T) ratios using EL4, EL4 plus E7 peptide
(RAHYNIVTF), or EL4-E7 as targets. The amount of
51Cr released into the culture supernatant of
each well was determined by carefully transferring 50 µl of
supernatant into 200 µl of Optiphase Supermix (Wallac, Perkin-Elmer).
Samples were then read using a Microbeta scintillation counter (Wallac,
Perkin-Elmer). The percent specific lysis was determined by using the
following equation: [(test chromium release
spontaneous
chromium release)/(total chromium release
spontaneous chromium
release)] × 100. Spontaneous chromium release was determined by using
51Cr-pulsed targets in the absence of effector
cells, and total chromium release was determined by adding an equal
volume of 2% Triton X-100 to lyse pulsed targets. An average of three
or four specific lysis values for each E:T ratio was then plotted.
Intracellular staining and analysis by flow cytometry.
Mice
were injected twice i.p. on days 7 and 14 with 107 PFU of
vaccinia virus. Splenocytes were harvested 7 days later and incubated
with 1 µM peptide for 5 to 6 h in the presence of the Golgi
transport inhibitor brefeldin A or monensin at a density of
107 cells/ml. Cells were washed twice and incubated in 50 µl of anti-mouse Fc
receptor supernatant 2.4G2 (American Type
Culture Collection) for 1 h or overnight at 4°C. Cells were
stained for surface molecules, permeabilized, fixed using the
permeabilization kit Golgi-Stop or Golgi-Plug (Pharmingen), and then
stained for the cytokines IFN-
and TNF-
. Typically, 400,000 events were acquired using the two-laser flow cytometer FacsCalibur and
analyzed using Cellquest software (Becton Dickinson).
Proliferation assays.
Splenocytes from mice given two i.p.
injections of vaccinia virus 7 days apart were pooled from two mice per
vaccination group 10 days after the final injection. Following the
removal of erythrocytes, the majority of B cells and macrophages were
removed by passing the cells over a nylon wool column. Enriched T cells
(2.5 × 105) were incubated for 66 h in
triplicate with an equal number of syngeneic
-irradiated splenocytes
in a volume of 200 µl with increasing concentrations of recombinant
E7 protein in flat-bottom 96-well plates. Cells were pulsed with 0.5 µCi of [3H]thymidine for the final 18 to
24 h of incubation and harvested onto filter mats using a Titertek
harvester (Wallac, Perkin-Elmer). Samples in Microbetalux scintillant
were then read using the Microbeta scintillation counter.
In vitro tumor analyses.
Tumors from mice were excised and
cut into 2-mm pieces after removal of blood vessels and connective
tissue by dissection. To isolate T cells, tumors were incubated for 30 min, with occasional shaking, in an enzyme mixture that consisted of 2 mg of collagenase P/ml, 1 mg of DNase I/ml,10 U of penicillin/ml, and
10 µg of streptomycin/ml in PBS at 37°C. The digested tissue was
then passed through a nylon mesh bag, and the resultant cells were
washed twice in RP-10 before being stained for flow cytometric analysis
as described previously. Cells in Matrigel plugs were either isolated
as described above or incubated in 300 µl of PBS overnight at 4°C
before removal of the fibrous clot with forceps, passed through a nylon
mesh bag, and then washed in PBS containing 5% fetal bovine serum and 0.05% azide.
 |
RESULTS |
VacLLOE7 is a better TC-1 tumor immunotherapeutic agent
than VacE7 and VacSigE7LAMP-1.
To assess the efficacy of
VacLLOE7 for tumor therapy, we determined its ability to cause
regression of established TC-1 tumors in C57BL/6 mice compared to the
results for VacSigE7LAMP-1- and VacE7-vaccinated mice. A dose of
2 × 105 TC-1 cells were first
injected s.c. into the flank of each mouse. Eleven days later,
when the tumor was at least 8 to 9 mm in size, each mouse was
treated with 107 PFU of vaccinia virus i.p. A
boost of the same dose was given i.p. 7 days later. Tumor sizes were
observed every 2 to 3 days. Five representative time points are shown
in Fig. 2. At 23 days after tumor
inoculation, none of the mice that had received VacE7 were tumor free,
and by day 48, none had survived. In marked contrast to VacE7-treated
mice, three of eight of the mice given VacsigE7LAMP-1 had resolved
their tumors by day 23. However, two of eight of the regressed tumors
grew out, so that at day 48, only one of the eight mice was tumor free.
These results are in agreement with the observation made previously
with these vaccinia virus constructs that VacSigE7LAMP-1 is far more
effective than VacE7 at controlling the growth of TC-1 tumors in vivo
(22). However, it should be noted that in that study
(22), tumor challenges were approximately 10-fold lower
than ours, so that at 7 days, when vaccination took place, only
microscopic tumors were present. Because immunization took place
before tumor growth could be measured, only tumor appearance
after vaccination was monitored and plotted; 100% protection against
tumor appearance by vaccination with VacSigE7LAMP-1 could be
demonstrated (22). We show here that only 12% of animals can be cured of 8- to 9-mm macroscopic tumors using this
vaccine. However, if immunizations are performed when the tumors are 3 to 5 mm in size, 25% of the mice can be cured of their tumors and
remain tumor free (data not shown).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 2.
VacLLOE7 causes long-term regression of tumors
established from 2 × 105 TC-1 cells injected s.c.
into C57BL/6 mice. Mice were injected 11 and 18 days after tumor
challenge with 107 PFU of VacLLOE7, VacSigE7LAMP-1, or
VacE7/mouse i.p. or were left untreated (naive). Eight mice per
treatment group were used, and the cross section for each tumor
(average of two measurements) in each mouse is shown for the indicated
days after tumor inoculation.
|
|
Effective eradication of TC-1 was also observed in mice that received
VacLLOE7. Four of eight of these mice were tumor free
23 days after
tumor inoculation. In contrast to the situation
with VacSigE7LAMP-1, no
tumors escaped in these mice, so that
these mice were still tumor free
at the end of the experiment,
on day 48. The difference between
the average sizes of tumors
in VacSigE7LAMP-1-treated mice and
VacLLOE7-treated mice on day
28 was statistically significant
(
P < 0.05, as determined by Student's
t
test), despite large deviations in tumor size between individual
mice.
We have performed this comparison between VacSigE7LAMP-1
and VacLLOE7
with tumors varying in size between 3 and 8 mm and
have found that 5 of
24 mice remain tumor free in the group immunized
with VacSigE7LAMP-1
compared to 12 of 24 mice remaining tumor
free in the group immunized
with VacLLOE7 (
P < 0.05, as determined
by the
G2 likelihood ratio chi-square test).
Thus, VacLLOE7 is able to
slow the reappearance of TC-1 such that the
mortality of mice
is significantly improved over that seen following
treatment with
VacSigE7LAMP-1 or
VacE7.
E7-specific CD8+ T-cell responses are enhanced in mice
vaccinated with VacLLOE7 and VacSigE7LAMP-1 versus
VacE7.
CTL responses to E6 and E7 have been identified elsewhere
as correlating with effective immunotherapy of HPV immortalized tumors
(9, 13, 24). Thus, we sought to determine whether the
mechanism underlying the improved efficacy of VacLLOE7 involved enhanced lytic activity of cells isolated from mice treated with this
construct. VacLLOE7 was again compared with VacSigE7LAMP-1 and VacE7.
Vaccinia virus expressing human immunodeficiency virus (HIV) Gag
(VacGag), which expresses an irrelevant antigen, was used as a
negative control. Figure 3 shows that
splenocytes from mice treated with VacE7 generated very little lysis
above that seen with VacGag. In contrast, mice given VacSigE7LAMP-1
were able to generate CTLs that had significantly enhanced cytotoxic activity in the presence of E7. However, at an E:T ratio of 25:1, VacLLOE7-induced cells were capable of mediating at least 20% more
lysis than VacSigE7LAMP-1-derived effectors.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 3.
CTL responses to E7 induced by VacLLOE7 surpass those
seen with VacSigE7LAMP-1 and VacE7. Mice were injected twice i.p. 7 days apart with 107 PFU. Thirteen days after the final
injection, spleen cells from two mice per treatment group were
harvested and pooled as described in Materials and Methods. EL4 cells,
EL4 cells pulsed with a peptide from HPV-16 E7 (RAHYNIVTF) (EL4 + E7
peptide), or EL4 cells stably transfected with full-length HPV-16 E7
(EL4E7) were compared with the parental EL4 cell line as targets for
lysis. CTL activity is expressed as the average percent specific lysis
for measurements at each E:T ratio as described in Materials and
Methods. Error bars indicate standard deviations for measurements in
triplicate or quadruplicate. Results shown are representative of three
independent experiments.
|
|
Since many of the tumoricidal effects of CD8
+ T
cells in vivo are mediated through the secretion of the inflammatory
cytokines
TNF-

and IFN-

, we next examined the cytokine profiles
of splenic
E7-specific CD8
+ T cells using an
intracellular staining assay (
25). Figure
4 contains representative dot plots
obtained by flow cytometry
that show the frequencies of E7-specific
CD8
+ T cells among activated
(CD62L
lo) CD8
+ T cells in
culture. The highest frequency of CD8
+ T cells
that produce IFN-

and TNF-

in response to the E7 MHC
class I
epitope is obtained from mice vaccinated with VacLLOE7.
The most
striking observations are that the frequency of T cells
producing
IFN-

and TNF-

in an antigen-specific manner is always
highest in
the spleens of mice treated with either VacSigE7LAMP-1
(0.63%) or
VacLLOE7 (1.56% for IFN-

and 1.31% for TNF-

), while
IFN-

and
TNF-

production is lowest in the spleens of mice given
VacE7
(0.28%).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 4.
Inflammatory cytokine production in response to
RAHYNIVTF by CD8+ T cells is enhanced in the spleens of
mice vaccinated with VacLLOE7. Following two i.p. injections 7 days
apart with 107 PFU of VacGag, VacE7, VacSigE7LAMP-1, or
VacLLOE7, spleen cells from two mice per treatment group were harvested
13 days after the second injection. Whole splenocytes were incubated
with 1 µM HPV-16 E7 peptide RAHYNIVTF for 5 h in the presence of
a Golgi transport inhibitor, and the levels of intracellular IFN-
(A) and TNF- (B) were determined by flow cytometry as described in
Materials and Methods. Values shown are percentages of activated
CD8+ T lymphocytes (gated on CD62L) that are IFN-
positive. IFN- production in the presence of an irrelevant peptide
(AMQMLKETI) from HIV Gag was no more than 10% the value shown for each
vaccinia virus recombinant expressing E7. Responses shown are
representative of three experiments.
|
|
The CD8
+ T cells induced by these different
vaccinia virus constructs were also quantified by determining the
frequency of
T cells in the spleen that are positive for fluorogenic
E7-H2-D
b tetramers. Peptide MHC tetramers have been
used extensively to
determine the numbers of bacterium- and
virus-specific T cells
in animal infection models (
5,
6,
25). MHC tetramers have
also been useful for identifying and
characterizing T cells specific
for tumor antigens in melanoma patients
(
21,
46) and in murine
vaccination protocols with vaccinia
virus (
42). Thus, we wanted
to determine if the number of
IFN-

-secreting T cells corresponds
to the number of T cells that are
positive for E7-H2-D
b tetramers loaded with the dominant
CTL epitope of E7,
RAHYNIVTF.
Interestingly, we found that only about half of the cells that produce
IFN-

when stimulated by RAHYNIVTF stain brightly with
E7-H2-D
b tetramers (Fig.
5A). We also found that unstimulated
CD8
+ T cells, i.e., that had been incubated with
the H-2
d-restricted control peptide from human
immunodeficiency virus
(HIV) Gag (AMQMLKETI), stained much more
brightly with the tetramers
such that almost twice as many cells were
positive for E7-H-2D
b (compare Fig.
5A and Fig.
5B). Of
course, in Fig.
5B none of
the cells show the production of IFN-

because they are not Gag
specific and, therefore, were not stimulated
by the control peptide.
Indeed, this population of cells represents the
ex vivo pool of
E7-specific CD8
+ T cells induced
by vaccination. Figure
5B shows that about twice
as many
tetramer-positive CD8
+ T cells were present in
the spleens of VacSigE7LAMP-1 (1.14%)-
and VacLLOE7
(1.34%)-immunized mice as in those of VacE7 (0.68%)-immunized
mice. We believe that the somewhat duller staining observed in
Fig.
5A
is due to the downregulation of the T-cell receptor (TCR)
on
activated T cells upon stimulation by antigen-presenting cells
(APCs)
presenting RAHYNIVTF. This is probably exacerbated by the
presence of
the Golgi inhibitor monensin, required for the detection
of
intracellular IFN-

, which would block the export of newly
synthesized TCR to the cell surface. The downregulation of TCR
by
engagement with peptide MHC is a well-known phenomenon (
31,
41). Nevertheless, it is obvious from Fig.
5 that VacE7 is less
able to generate RAHYNIVTF-specific CD8
+
T cells than VacSigE7LAMP-1 and VacLLO-E7, which induce approximately
equal numbers of IFN-

-secreting T cells and tetramer-positive
T
cells on stimulation with the immunodominant epitope (Fig.
5A)
or
tetramer-positive T cells ex vivo (Fig.
5B).

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 5.
VacLLOE7 and VacSigE7LAMP-1 induce similar numbers of
tetramer-positive T cells that are specific for E7-H2-Db
and that secrete IFN- in response to the HPV-16 peptide RAHYNIVTF.
Spleen cells from mice vaccinated twice i.p. with each vaccinia virus
construct were harvested 7 days after the last vaccination, incubated
with 1 µM HPV-16 E7 (A) or HIV Gag (B) peptide, and stained for
surface markers as described in Materials and Methods. Cells were gated
on CD8+ CD62Llo, and IFN- production by
E7-H2-Db tetramer-positive cells was determined.
IFN- production in the presence of an irrelevant peptide (AMQMLKETI)
from HIV Gag was less than 10% the value shown for each vaccinia virus
recombinant expressing E7. Responses shown are representative of two
independent experiments.
|
|
Therefore, the data described here indicate that the ability of each of
these vaccinia virus constructs to eradicate TC-1
tumors correlates
with their ability to induce E7-specific CTLs
that recognize the
RAHYNIVTF-H2
b complex. The frequency of
E7-H2
b-specific cells that produce the inflammatory
cytokines IFN-
and TNF-

also supports the involvement of
CD8
+ effector cells in the treatment of
established TC-1
tumors.
CD4+ T-cell-mediated responses to E7 are
undetectable by proliferation measurements in mice vaccinated with
VacLLOE7.
Previous studies have shown that modification
of the E7 sequence to target it to peptide MHC class II loading
compartments, via the Lamp-1 signal sequence and the N-terminal
sequence, enhances the CD4+-restricted response
to E7 over that seen with VacE7 (44). Not only were
vaccinia virus constructs expressing SigE7LAMP-1 able to induce
enhanced proliferative responses to the E7 CD4+
T-cell epitope, but these T cells were also required to mediate protection against TC-1 challenge (22).
The superior CTL activity and cytokine-secreting potential of
CD8
+ T cells from VacLLOE7 mice over those seen
with mice treated
with VacE7 therefore indicated that mice receiving
this treatment
may also have good CD4
+ T-cell
helper responses directed to E7. To test this hypothesis,
we examined
the proliferative activity of T cells from mice vaccinated
with VacGag,
VacE7, VacSigE7LAMP-1, and
VacLLOE7.
As expected, the proliferative response to E7 by T cells isolated from
mice treated with VacSigE7LAMP-1 was higher than that
seen with
cells isolated from VacE7-treated mice (Fig.
6). However,
to our surprise, very little
proliferation specific for E7 was
detected in cultures with T cells
from VacLLOE7-vaccinated mice.
In addition to this finding,
we were unable to consistently detect
CD4
+
T cells that secrete IFN-

in response to either the class II
epitope
contained within E7 (residues 31 to 62) or E7 protein
(data not shown).
Thus, in the absence of CD4
+ T-cell help that is
specific for E7, VacLLOE7 can induce CD8
+ T cells
that specifically target cells that express E7.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 6.
In vitro proliferative responses to exogenous E7 protein
are significantly reduced in the spleens of mice vaccinated
with VacLLOE7. Mice were given two i.p. injections of
107 PFU of VacGAG, VacE7, VacSigE7LAMP-1, or
VacLLOE7. Ten days after the last injection, spleen cells
from two mice per vaccination group were harvested and enriched for T
cells over nylon wool columns. T cells from each vaccination group were
incubated with equal numbers of syngeneic -irradiated APCs as
described in Materials and Methods. T-cell proliferation is shown as
the mean of triplicate measurements of [3H]thymidine
incorporation at each concentration of E7. Error bars are
standard deviations of the mean at each dose. Results shown are
representative of two experiments.
|
|
CD8+ tetramer-positive T-cell numbers are enhanced in
the tumors of mice treated with VacLLOE7.
Mice immunized with
VacLLOE7 have poor proliferative responses to E7 protein compared to
VacSigE7LAMP-1-immunized mice but better control the growth of
TC-1 tumors in vivo. In addition, VacLLOE7 induces better
CD8+ T-cell immunity in the spleen than
VacSigE7LAMP-1, which is more effective than VacE7. We therefore
examined whether these RAHYNIVTF-specific CD8+ T
cells were present in the tumors of mice treated with each vaccinia
virus construct. As described earlier for the tumor regression studies,
2 × 105 TC-1 cells were injected s.c. into
C57BL/6 mice, and each treatment group was injected twice i.p. with the
relevant vaccinia virus construct. Seven days after the final
injection, spleens and tumors from mice in each group were removed and
analyzed for E7-specific CD8+ T-cell contents.
The spleens from two or three mice were pooled, as were the tumors.When
the tumor had regressed completely, a biopsy of the tissue at the tumor
site was performed. These cells were homogenized in the same way as the
cells obtained from mice that still bore tumors at the site of
implantation and resembled lymphocytes in size, as determined by their
forward and side scatter fluorescence-activated cell sorting profiles
(data not shown).
The cells remaining at the site of tumor inoculation were examined for
T cells specific for E7-H2-D
b. These were clearly visible
without in vitro stimulation or gating
for activated T cells (Fig.
7). The number of tetramer-positive
cells
in the tumors of mice given VacGAG constituted ~1% of
lymphocytes
infiltrating the tumor. In mice that had been treated
with VacE7,
tetramer-positive T cells represented ~4% of the
total lymphocytes
in the tumor, whereas ~8% of the infiltrating
lymphocytes in mice
treated with VacSigE7LAMP-1 were tetramer
positive. Most striking
is that almost 16% of lymphocytes present at
the site of tumor
inoculation in VacLLOE7-treated mice were tetramer
positive, indicating
that the enhanced production of CTLs in the
spleens of vaccinated
mice (Fig.
3) translated into effector cells in
the tumor.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 7.
Ex vivo frequencies of E7-H2-Db-specific
tetramer-positive CD8+ T cells in the tumors of mice
treated with VacLLOE7 are enhanced over those seen with
VacSigE7LAMP-1 and VacE7. Tumors were homogenized in the presence of
collagenase and DNase to aid in the isolation of T lymphocytes. Cells
were gated for live lymphocytes based on their forward scatter and side
scatter to exclude cellular debris, and CD8+ T cells
reactive for E7-H2-Db were identified without in vivo
stimulation or gating for activated T cells.
|
|
Because the clinical response to vaccination was heterogeneous for each
vaccine, resulting in the necessity of harvesting
tumors of various
sizes for each group, tumor cells were mixed
with Matrigel prior to
s.c. inoculation. Matrigel is a reconstructed
basement membrane in
which solid tumors can grow and interact
with infiltrating cells
(
18,
34) and as such is often used
to study tumor invasion
of basement membrane as well as angiogenesis
and tumor infiltration.
Matrigel plugs of the same size were harvested
from each vaccine group
7 days after the last immunization. Half
the plug from each mouse was
treated with DNase and collagenase,
while the other half was left
untreated. The cells isolated from
the tumors in each group were pooled
as before. Table
1 summarizes
our
observations using Matrigel-embedded tumors in vivo. As observed
in the
absence of Matrigel, the number of tetramer-positive T
cells
specific for E7-H2-D
b and located at the site
of the tumor was markedly enhanced in
mice treated with
VacLLOE7 or VacSigE7LAMP-1. Again, mice treated
with VacE7
had the lowest frequency. This trend was also observed
for tumors that
had been homogenized with enzyme compared with
those that had not been
incubated with DNase and collagenase.
This result indicates that
the enzymatic digestion of tumors does
not have a great impact on cell
surface receptors.
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Enhanced accumulation of E7-specific CD8+ T
cells in TC-1 tumors of mice treated with VacLLOE7 is not
influenced by collagenase and DNase treatment of
tumorsa
|
|
We also used E7-H2-D
b tetramers to measure the impact of
TC-1 tumors on the number of E7-specific CD8
+ T
cells left in the spleen following treatment with each of the
vaccinia
virus constructs. In vitro, tetramer-positive spleen
cells were
discernible to very similar extents (0.14 to 0.31%)
in all treatment
groups, including those given VacGag (Fig.
8A).
Stimulation of spleen cells with the
RAHYNIVTF epitope, to determine
the proportion of
CD8
+ tetramer-positive T cells capable of
producing IFN-

, demonstrated
that IFN-

production by cells from
VacE7-immunized mice was as
high (1.68%) as that seen with immune
cells from mice treated
with VacLLOE7 (1.42%) and
VacSigE7LAMP-1 (1.21%). This finding
is in contrast to the inferior
IFN-

production by T cells from
VacE7-immunized mice compared to the
other two vaccine constructs
in the absence of TC-1 tumors (Fig.
4 and
5).

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 8.
IFN- secretion by E7-H2-Db-specific
tetramer-positive CD8+ cells in the spleens of
tumor-bearing mice is indistinguishable between mice receiving
different vaccinia virus constructs expressing E7. Spleen cells from
vaccinated mice were harvested and stimulated as described in the
legend to Fig. 5. Plots are of percentages of activated
(CD62Llo) CD8+ cells that secreted IFN- in
response to the HIV Gag control peptide (A) or RAHYNIVF (B).
|
|
Thus, the higher numbers of E7-specific T cells at the site of tumor
inoculation in mice treated with VacLLOE7 suggest that
the
differences in efficacies of the vaccine constructs described
here may
be due not just to the levels of CD8
+ T cells
induced but also to the ability of these T cells to exit
the periphery
and home in on the tumor
site.
 |
DISCUSSION |
In this report, we demonstrate an as-yet-undescribed
immunity-enhancing function of nonhemolytic LLO expressed as a fusion protein with E7 by vaccinia virus.
In the past, a role for both CD4+ and
CD8+ effectors specific for E7 in the eradication
of tumors has been demonstrated (22, 40). However, others
have shown that protection against E7 immortalized tumors is more
dependent on CD8+ T-cell responses to E7 than on
CD4+ T-cell responses (13). More
pertinent to the work described in this report, Chen et al.
(8) have found that the administration of DNA encoding a
fusion of the gene for E7 with the gene for heat shock protein (HSP) 70 (HSP-70) results in CD8+ T-cell responses to E7
in the absence of CD4+ T-cell responses. As with
the observations made in this study, such immune responses were able to
cause the regression of TC-1 tumors in vivo. Therefore, the ability of
VacLLOE7 to induce the regression of established TC-1 tumors
in the absence of a proliferative CD4+ T-cell
response to E7 is in agreement with previous work studying the
treatment of HPV-16 immortalized tumors using immunity-enhancing therapy.
The reduced proliferative responses to exogenous E7 in vitro in the
spleens of mice vaccinated with VacLLOE7 may be due to an
ability of LLO to specifically enhance CD8+
T-cell responses. For example, other investigators have shown that
fusion of HSP-70 to ovalbumin specifically enhances
CD8+ T-cell responses to the ovalbumin peptide
SIINFEKL (35) independently of CD4+
T-cell help (17). HSP fusions may achieve this result
because of the ability of HSPs to transport misfolded proteins to the ubiquitination pathway and therefore bypass the MHC class II pathway (4) or because of their innate ability to potentiate the
Th1 response (29) and enhance the expression of
costimulatory molecules on professional APCs (10, 20, 30)
such that CD4+ T-cell help is no longer required.
Since the region of HSP-70 required for CTL enhancement does not
include the peptide binding domain used for the transport of proteins
(17), the latter explanation may be more likely. It is
possible that LLOE7 uses similar mechanisms to achieve potent CTL
activity in the absence of CD4+ T-cell responses
to E7. We believe that LLOE7 more effectively targets the protein for
rapid proteolysis in the cytosol due to the presence of a PEST-like
sequence (28) near the amino terminus of LLO
(11). This would enhance the presentation of E7 in the MHC
class I pathway of antigen processing, leading to enhanced CD8+ T-cell responses. It would also decrease the
access of E7 to the endocytic pathway and thus reduce E7 peptide
loading of MHC class II molecules, with subsequent poor
CD4+ T-cell responses to E7. In this scenario,
CD4+ T-cell responses to antigens derived from
the vaccinia virus vector may provide help during the priming of
CD8+ T cells. We are currently investigating the
possible role of LLO in the trafficking of its fusion partner to proteosomes.
We believe that boosting the number of preexisting
CD8+ T cells specific for E7 mediates the
resolution of TC-1 following treatment with VacLLOE7. This
notion is supported by the enhanced CTL activity and E7
tetramer-positive CD8+ T cells in the spleens of
mice treated with VacLLOE7. However, VacSigE7LAMP-1 is also
capable of inducing a significant population of splenic
antigen-specific CD8+ T cells, a finding which
may explain the ability of this vaccine to eradicate tumors during the
first 2 weeks of treatment. Long-term eradication of TC-1 tumors, which
occurs only in mice treated with VacLLO-E7, is more likely to
be affected by the migration of E7-specific CD8+
T cells to peripheral sites of antigen expression. The significantly enhanced numbers of tetramer-positive T cells specific for
E7-H2-Db at the tumor site of mice treated with
VacLLOE7 is an indicator of this scenario. The selective
expression of a number of different adhesion molecules (e.g., CD44) and
chemokine receptors (e.g., CCR5) may mediate the expedient exit of
E7-specific CD8+ T cells from the spleen and
draining lymph nodes to the tumor site (33, 36).
The findings in this paper therefore provide an additional option for
the enhancement of immune responses to E7 and a possible immunotherapeutic agent for cervical cancers. The enhanced numbers of
CD8+ T cells that are specific for E7 and that
produce IFN-
together with their ability to persist at the
tumor site following treatment with a vaccinia virus recombinant
that expresses LLOE7 may assist in overcoming the mechanisms used
by tumors to evade host immunity in vivo.
 |
ACKNOWLEDGMENTS |
We thank our colleagues at the University of Pennsylvania, George
Gunn, Gregory Beatty, Christian Peters, and Asha Abdool, for very
helpful suggestions and technical assistance.
This work was supported by grants CA 72108 (to T.-C.W. and Y.P.),
CA69632 (to Y.P.), and AI40957 (to S.N.I.)
 |
FOOTNOTES |
*
Corresponding author. Mailing address: 323 Johnson
Pavilion, 3610 Hamilton Walk, Philadelphia, PA 19104-6076. Phone: (215) 898-3461. Fax: (215) 573-4666. E-mail:
yvonne{at}mail.med.upenn.edu.
 |
REFERENCES |
| 1.
|
Acres, B.,
V. Apostolopoulos,
J.-M. Balloul,
D. Wreschner,
P.-X. Xing,
D. Ali-Hadji,
N. Bizouarne,
M. P. Kieny, and I. F. C. McKenzie.
2000.
MUC1-specific immune responses in human MUC1 transgenic mice immunized with various human MUC1 vaccines.
Cancer Immunol. Immunother.
48:588-594[CrossRef][Medline].
|
| 2.
|
Angiolillo, A.,
C. Sgadari,
D. Taub,
F. Liao,
J. Farber,
S. Maheshwari,
H. Kleinman,
G. Reaman, and G. Tosato.
1995.
Human interferon-inducible protein is a potent inhibitor of angiogenesis in vivo.
J. Exp. Med.
182:155-162[Abstract/Free Full Text].
|
| 3.
|
Boehm, U.,
T. Klamp,
M. Groot, and J. C. Howard.
1997.
Cellular responses to interferon- .
Annu. Rev. Immunol.
15:749-795[CrossRef][Medline].
|
| 4.
|
Brodsky, J. L.
1996.
Post-translational protein translation: not all HSC70s are created equal.
Trends Biochem. Sci.
21:122-126[CrossRef][Medline].
|
| 5.
|
Busch, D. H.,
I. M. Phillips,
S. Vijh, and E. G. Pamer.
1998.
Coordinate regulation of complex T cell populations responding to bacterial infection.
Immunity
8:353-362[CrossRef][Medline].
|
| 6.
|
Callan, M. F. C.,
L. Tan,
N. Annels,
G. S. Ogg,
J. D. K. Wilson,
C. A. O'Callaghan,
N. Steven,
A. J. McMichael, and A. B. Rickenson.
1998.
Direct visualization of antigen specific CD8+ T cells during the primary immune response to Epstein Barr virus.
J. Exp. Med.
187:1395-1402[Abstract/Free Full Text].
|
| 7.
|
Chakrabarti, S.,
K. Brechling, and B. Moss.
1985.
Vaccinia virus expression vector: coexpression of beta-galactosidase provides visual screening of recombinat virus plaques.
Mol. Cell. Biol.
5:3403-3409[Abstract/Free Full Text].
|
| 8.
|
Chen, C. H.,
T. L. Wang,
C. F. Hung,
Y. Yang,
R. A. Young,
D. M. Pardoll, and T. C. Wu.
2000.
Enhancement of DNA vaccine potency by linkage of antigen gene to an HSP-70 gene.
Cancer Res.
60:1035-1042[Abstract/Free Full Text].
|
| 9.
|
Chen, L. P.,
E. K. Thomas,
S. L. Hu,
I. Hellstrom, and K. E. Hellstrom.
1991.
Human papillomavirus type 16 nucleoprotein E7 is a tumor rejection antigen.
Proc. Natl. Acad. Sci. USA
88:110-114[Abstract/Free Full Text].
|
| 10.
|
Chen, W.,
U. Syldath,
K. Bellmann,
V. Burkart, and H. Kolb.
1999.
Human 60-kDa heat shock protein: a danger signal to the innate immune system.
J. Immunol.
162:3212-3219[Abstract/Free Full Text].
|
| 11.
|
Decatur, A. L., and D. A. Portnoy.
2000.
A PEST-like sequence in Listeriolysin O essential for Listeria monocytogenes pathogenicity.
Science
290:992-995[Abstract/Free Full Text].
|
| 12.
|
Drapier, J. C.,
J. Wietzerbin, and J. B. Hibbs, Jr.
1988.
Interferon-gamma and tumor necrosis factor induce the L-arginine-dependent cytotoxic effector mechanism in murine macrophages.
Eur. J. Immunol.
18:1587-1592[Medline].
|
| 13.
|
Feltkamp, M. C.,
H. L. Smits,
M. P. Vierboom,
R. P. Minnaar,
B. M. de Jongh,
J. W. Drijfhout,
J. ter Schegget,
C. J. Melief, and W. M. Kast.
1993.
Vaccination with cytotoxic T lymphocyte epitope-containing peptide protects against a tumor induced by human papillomavirus type 16-transformed cells.
Eur. J. Immunol.
23:2242-2249[Medline].
|
| 14.
|
Fernando, G.,
B. Murray,
J. Zhou, and I. Frazer.
1999.
Expression, purification and immunological characterization of the transforming protein E7, from cervical cancer-associated human papillomavirus type 16.
Clin. Exp. Immunol.
115:397-403[CrossRef][Medline].
|
| 15.
|
Gedde, M.,
D. Higgins,
T. Tilney, and D. Portnoy.
2000.
Role of listeriolysin in cell-to-cell spread of Listeria monocytogenes.
Infect. Immun.
68:999-1003[Abstract/Free Full Text].
|
| 16.
|
Glas, R.,
L. Franksson,
C. Une,
M.-L. Eloranta,
C. Öhlen,
A. Örn, and K. Kärre.
2000.
Recruitment and activation of natural killer (NK) cells in vivo determined by the target cell phenotype: an adaptive component of NK cell-mediated responses.
J. Exp. Med.
191:129-138[Abstract/Free Full Text].
|
| 17.
|
Huang, Q.,
J. F. Richmond,
K. Suzue,
H. N. Eisen, and R. Young.
2000.
In vivo cytotoxic T lymphocyte elicitation by mycobacterial heat shock protein 70 fusion proteins maps to a discrete domain and is CD4+ T cell dependent.
J. Exp. Med.
191:403-408[Abstract/Free Full Text].
|
| 18.
|
Johansson, B., and U. Nannmark.
1996.
Ultrastructure of interactions between activated murine natural killer cells and melanoma cells in an extracellular matrix (Matrigel) environment.
Nat. Immun.
15:98-106[Medline].
|
| 19.
|
Kashii, Y.,
R. Giorda,
R. B. Herberman,
T. L. Whiteside, and N. L. Vujanovic.
1999.
Constitutive expression and role of the TNF family ligands in apoptotic killing of tumor cells by human NK cells.
J. Immunol.
163:5358-5366[Abstract/Free Full Text].
|
| 20.
|
Kol, A. T.,
T. Bourcier,
A. H. Lichtman, and P. Libby.
1990.
Chlamydial and human heat shock protein 60s activate human vascular endothelium, smooth muscle cells, and macrophage.
J. Clin. Investig.
103:571-577[Medline].
|
| 21.
|
Lee, P. P.,
C. Yee,
P. A. Savage,
L. Fong,
D. Brockstedt,
J. S. Weber,
D. Johnson,
S. Swetter,
J. Thompson,
P. Greenberg,
M. Roederer, and M. M. Davis.
1999.
Characterization of circulating T cells specific for tumor-associated antigens in melanoma patients.
Nat. Med.
5:677-685[CrossRef][Medline].
|
| 22.
|
Lin, K.-Y.,
F. Guarnieri,
K. F. Staveley-O'Carroll,
H. Levitsky,
J. T. August,
D. Pardoll, and T.-C. Wu.
1996.
Treatment of established tumors with a novel vaccine that enhances major histocompatibility class II presentation of tumor antigen.
Cancer Res.
56:21-26[Abstract/Free Full Text].
|
| 23.
|
Meneguzzi, G.,
C. Cerni,
M. P. Kieny, and R. Lathe.
1991.
Immunization against human papillomavirus type 16 tumor cells with recombinant vaccinia viruses expressing E6 and E7.
Virology
181:62-69[CrossRef][Medline].
|
| 24.
|
Michel, E.,
K. A. Reich,
R. Favier,
P. Berche, and P. Cossart.
1990.
Attenuated mutants of the intracellular bacterium Listeria monocytogenes obtained by single amino acid substitutions in listeriolysin O.
Mol. Microbiol.
4:167-178.
|
| 25.
|
Murali-Krishna, K.,
J. D. Altman,
M. Suresh,
D. J. Sourdive,
A. J. Zajac,
J. D. Miller,
J. Slansky, and R. Ahmed.
1998.
Counting antigen specific CD8 T cells: a reevaluation of bystander activation during viral infection.
Immunity
8:177-187[CrossRef][Medline].
|
| 26.
|
Pan, Z.-K.,
G. Ikonomidis,
A. Lazenby,
D. Pardoll, and Y. Paterson.
1995.
A recombinant Listeria monocytogenes vaccine expressing a model tumour antigen protects mice against lethal tumour cell challenge and causes regression of established tumours.
Nat. Med.
1:471-477[CrossRef][Medline].
|
| 27.
|
Prevost-Blondel, A.,
E. Roth,
F. M. Rosenthal, and H. Pircher.
2000.
Crucial role of TNF- in CD8 T cell-mediated elimination of 3LL-A9 Lewis lung carcinoma cells in vivo.
J. Immunol.
164:3645-3651[Abstract/Free Full Text].
|
| 28.
|
Rechsteiner, M., and S. W. Rogers.
1996.
PEST sequences and regulation by proteolysis.
Trends Biochem. Sci.
21:267-271[CrossRef][Medline].
|
| 29.
|
Rico, A.,
S. Angel,
C. Alonso, and J. Requena.
1999.
Immunostimulatory properties of the Leishmania infantum heat shock proteins HSP70 and HSP83.
Mol. Immunol.
36:1131-1139[CrossRef][Medline].
|
| 30.
|
Ruedl, C.,
M. Kopf, and M. F. Bachmann.
1999.
CD8+ T cells mediate CD40-independent maturation of dendritic cells in vivo.
J. Exp. Med.
189:1875-1883[Abstract/Free Full Text].
|
| 31.
|
SanJose, E.,
A. Borroto,
F. Niedergang,
A. Alcover, and B. Alarcon.
2000.
Triggering the TCR complex causes the downregulation of nonengaged receptors by a signal transduction-dependent mechanism.
Immunity
12:161-170[CrossRef][Medline].
|
| 32.
|
Sgadari, C.,
J. Farber,
A. Angiolillo,
F. Liao,
J. Teruya-Feldstein,
P. Burd,
L. Yao,
G. Gupta,
C. Kanegane, and G. Tosato.
1997.
Mig, the monokine induced by interferon gamma, promotes tumor necrosis in vivo.
Blood
89:2635-2643[Abstract/Free Full Text].
|
| 33.
|
Springer, T.
1994.
Traffic signals for lymphocyte recirculation and leukocyte emigration: the multiple paradigm.
Cell
76:301-314[CrossRef][Medline].
|
| 34.
|
Sterling-Levis, K.,
L. White,
A. Trickett,
C. Gramacho,
S. Pittman, and V. Tobias.
1993.
Heterotransplantation of early B-lineage acute lymphoblastic leukemia using a solubilized attachment matrix (Matrigel).
Cancer Res.
53:1222-1225[Abstract/Free Full Text].
|
| 35.
|
Suzue, K.,
X. Zhou,
H. Eisen, and R. Young.
1997.
Heat shock fusion proteins as vehicles for antigen delivery into the major histocompatibility complex class I presentation pathway.
Proc. Natl. Acad. Sci. USA
94:13146-13151[Abstract/Free Full Text].
|
| 36.
|
Taub, D.,
K. Conlon,
A. Lloyd,
J. Oppenheim, and D. Kelvin.
1993.
Preferential migration of activated CD4+ and CD8+ T cells in response to MIP-1 and MIP-1 .
Science
260:355-358[Abstract/Free Full Text].
|
| 37.
|
Taub, D. D.,
T. J. Sayers,
C. R. Carter, and J. R. Ortaldo.
1995.
and Chemokines induce NK cell migration and enhance NK-mediated cytolysis.
J. Immunol.
155:3877-3888[Abstract].
|
| 38.
|
Tindle, R.
1996.
Human papillomavirus vaccines for cervical cancer.
Curr. Opin. Immunol.
8:643-650[CrossRef][Medline].
|
| 39.
|
Tindle, R. W.,
S. Croft,
K. Herd,
K. Malcolm,
A. F. Geczy,
T. Stewart, and G. M. Fernando.
1995.
A vaccine conjugate of `ISCAR' immunocarrier and peptide epitopes of the E7 cervical cancer-associated protein of human papillomavirus type 16 elicits specific Th1- and Th2-type responses in immunized mice in the absence of oil-based adjuvants.
Clin. Exp. Immunol.
101:265-271[Medline].
|
| 40.
|
Tindle, R. W.,
G. J. Fernando,
J. C. Sterling, and I. H. Frazer.
1991.
A "public" T-helper epitope of E7 transforming protein of human papillomavirus 16 provides cognate help for several E7 B-cell epitopes from cervical cancer-associated human papillomavirus genotypes.
Proc. Natl Acad. Sci. USA
88:5887-5891[Abstract/Free Full Text].
|
| 41.
|
Valitutti, S.,
S. Muller,
M. Salio, and A. Lanzavecchia.
1997.
Degradation of T cell receptor (TCR)-CD3- complexes after antigenic stimulation.
J. Exp. Med.
185:1859-1864[Abstract/Free Full Text].
|
| 42.
|
Valmori, D.,
F. Levy,
I. Miconnet,
P. Zajac,
G. C. Spagnoli,
D. Rimoldi,
D. Lienard,
V. Cerundolo,
J. C. Cerottini, and P. Romero.
2000.
Induction of potent antitumor CTL responses by recombinant vaccinia encoding Melan-A peptide analogue.
J. Immunol.
164:1125-1131[Abstract/Free Full Text].
|
| 43.
|
Weiskirch, L. M., and Y. Paterson.
1997.
Listeria monocytogenes. A potent vaccine vector for neoplastic and infectious disease.
Immunol. Rev.
158:159-169[CrossRef][Medline].
|
| 44.
|
Wu, T.-C.,
F. G. Guarnieri,
K. F. Staveley-O'Carroll,
R. P. Viscidi,
H. I. Levitsky,
L. Hedrick,
K. R. Cho,
J. T. August, and D. M. Pardoll.
1995.
Engineering an intracellular pathway for major histocompatibilty complex class II presentation of antigens.
Proc. Natl. Acad. Sci. USA
92:11671-11675[Abstract/Free Full Text].
|
| 45.
|
Yang, Y.,
J. B. Waters,
K. Fruh, and P. A. Peterson.
1992.
Proteosomes are regulated by interferon : implications for antigen processing.
Proc. Natl. Acad. Sci. USA
89:4928-4932[Abstract/Free Full Text].
|
| 46.
|
Yee, C.,
P. A. Savage,
P. P. Lee,
M. M. Davis, and P. D. Greenberg.
1999.
Isolation of high avidity melanoma-reactive CTL from heterogenous populations using peptide-MHC tetramers.
J. Immunol.
162:2227-2234[Abstract/Free Full Text].
|
| 47.
|
zur Hausen, H.
1991.
Human papillomaviruses in the pathogenesis of anogenital cancer.
Virology
184:9-13[Medline].
|
Journal of Virology, October 2001, p. 9654-9664, Vol. 75, No. 20
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.20.9654-9664.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Chen, X., Bai, F., Sokol, L., Zhou, J., Ren, A., Painter, J. S., Liu, J., Sallman, D. A., Chen, Y. A., Yoder, J. A., Djeu, J. Y., Loughran, T. P., Epling-Burnette, P. K., Wei, S.
(2009). A critical role for DAP10 and DAP12 in CD8+ T cell-mediated tissue damage in large granular lymphocyte leukemia. Blood
113: 3226-3234
[Abstract]
[Full Text]
-
Maciag, P. C., Seavey, M. M., Pan, Z.-K., Ferrone, S., Paterson, Y.
(2008). Cancer Immunotherapy Targeting the High Molecular Weight Melanoma-Associated Antigen Protein Results in a Broad Antitumor Response and Reduction of Pericytes in the Tumor Vasculature. Cancer Res.
68: 8066-8075
[Abstract]
[Full Text]
-
Liao, J. B., Publicover, J., Rose, J. K., DiMaio, D.
(2008). Single-Dose, Therapeutic Vaccination of Mice with Vesicular Stomatitis Virus Expressing Human Papillomavirus Type 16 E7 Protein. CVI
15: 817-824
[Abstract]
[Full Text]
-
Bae, S. H., Park, Y.-J., Park, J.-B., Choi, Y. S., Kim, M. S., Sin, J.-I.
(2007). Therapeutic Synergy of Human Papillomavirus E7 Subunit Vaccines plus Cisplatin in an Animal Tumor Model: Causal Involvement of Increased Sensitivity of Cisplatin-Treated Tumors to CTL-Mediated Killing in Therapeutic Synergy. Clin. Cancer Res.
13: 341-349
[Abstract]
[Full Text]
-
Laheru, D. A., Pardoll, D. M., Jaffee, E. M.
(2005). Genes to vaccines for immunotherapy: how the molecular biology revolution has influenced cancer immunology. Molecular Cancer Therapeutics
4: 1645-1652
[Abstract]
[Full Text]
-
Sewell, D. A., Shahabi, V., Gunn, G. R. III, Pan, Z.-K., Dominiecki, M. E., Paterson, Y.
(2004). Recombinant Listeria Vaccines Containing PEST Sequences Are Potent Immune Adjuvants for the Tumor-Associated Antigen Human Papillomavirus-16 E7. Cancer Res.
64: 8821-8825
[Abstract]
[Full Text]
-
Verch, T., Pan, Z.-K., Paterson, Y.
(2004). Listeria monocytogenes-Based Antibiotic Resistance Gene-Free Antigen Delivery System Applicable to Other Bacterial Vectors and DNA Vaccines. Infect. Immun.
72: 6418-6425
[Abstract]
[Full Text]
-
Devaraj, K., Gillison, M. L., Wu, T.-C.
(2003). DEVELOPMENT OF HPV VACCINES FOR HPV-ASSOCIATED HEAD AND NECK SQUAMOUS CELL CARCINOMA. CROBM
14: 345-362
[Abstract]
[Full Text]
-
Zhong, B., Jiang, K., Gilvary, D. L., Epling-Burnette, P. K., Ritchey, C., Liu, J., Jackson, R. J., Hong-Geller, E., Wei, S.
(2003). Human neutrophils utilize a Rac/Cdc42-dependent MAPK pathway to direct intracellular granule mobilization toward ingested microbial pathogens. Blood
101: 3240-3248
[Abstract]
[Full Text]
-
Kennedy, R. C., Shearer, M. H., Watts, A. M., Bright, R. K.
(2003). CD4+ T Lymphocytes Play a Critical Role in Antibody Production and Tumor Immunity against Simian Virus 40 Large Tumor Antigen. Cancer Res.
63: 1040-1045
[Abstract]
[Full Text]
-
Kim, T.-Y., Myoung, H.-J., Kim, J.-H., Moon, I.-S., Kim, T.-G., Ahn, W.-S., Sin, J.-I.
(2002). Both E7 and CpG-Oligodeoxynucleotide Are Required for Protective Immunity against Challenge with Human Papillomavirus 16 (E6/E7) Immortalized Tumor Cells: Involvement of CD4+ and CD8+ T Cells in Protection. Cancer Res.
62: 7234-7240
[Abstract]
[Full Text]