Previous Article | Next Article 
Journal of Virology, October 2001, p. 9613-9622, Vol. 75, No. 20
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.20.9613-9622.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Functional Interaction Map of Lyssavirus
Phosphoprotein: Identification of the Minimal Transcription
Domains
Yves
Jacob,*
Eléonore
Real, and
Noël
Tordo
Laboratoire des Lyssavirus, Institut Pasteur,
75724 Paris Cedex 15, France
Received 16 May 2001/Accepted 11 July 2001
 |
ABSTRACT |
Lyssaviruses, the causative agents of rabies encephalitis, are
distributed in seven genotypes. The phylogenetically distant rabies
virus (PV strain, genotype 1) and Mokola virus (genotype 3) were used
to develop a strategy to identify functional homologous interactive
domains from two proteins (P and N) which participate in the viral
ribonucleoprotein (RNP) transcription-replication complex. This
strategy combined two-hybrid and green fluorescent protein-reverse
two-hybrid assays in Saccharomyces cerevisiae to
analyze protein-protein interactions and a reverse genetic assay in
mammalian cells to study the transcriptional activity of the
reconstituted RNP complex. Lyssavirus P proteins contain two N-binding
domains (N-BDs), a strong one encompassing amino acid (aa) 176 to the C
terminus and a weak one in the 189 N-terminal aa. The N-terminal
portion of P (aa 52 to 189) also contains a homomultimerization site.
Here we demonstrate that N-P interactions, although weaker, are
maintained between proteins of the different genotypes. A minimal
transcriptional module of the P protein was obtained by fusing the
first 60 N-terminal aa containing the L protein binding site to the
C-terminal strong N-BD. Random mutation of the strong N-BD on P protein
identified three highly conserved K residues crucial for N-P
interaction. Their mutagenesis in full-length P induced a
transcriptionally defective RNP. The analysis of homologous interactive
domains presented here and previously reported dissections of the P
protein allowed us to propose a model of the functional interaction
network of the lyssavirus P protein. This model underscores the central
role of P at the interface between L protein and N-RNA template.
 |
INTRODUCTION |
The etiological agents of rabies
encephalitis constitute the Lyssavirus genus in the
Rhabdoviridae family (38). Phylogenetic analysis distinguished seven genotypes which in turn segregated into
two major phylogroups with distinct pathogenic and immunogenic characteristics (1). Phylogroup 1 encompasses genotype 1 (GT1) (classical rabies virus), GT4 (Duvenhage virus), GT5 (European bat lyssavirus type 1), GT6 (European bat lyssavirus type 2), and GT7
(Australian bat lyssavirus). Phylogroup 2 comprises GT2 (Lagos bat
virus) and GT3 (Mokola virus). The PV strain rabies virus (GT1) and
Mokola virus (GT3) can be considered prototypes for phylogroups
1 and 2, respectively.
Lyssaviruses have a 12-kb nonsegmented negative-strand genomic RNA
tightly wrapped by the nucleoprotein (N) (34). This N-RNA complex constitutes the template for the RNA-dependent RNA polymerase (L) and its cofactor, the phosphoprotein (P). All four elements form
the ribonucleoprotein (RNP) complex which successively operates in
transcriptional then replicative modes during cell infection. The
transcription process, characterized by the recognition of gene start
and stop signals, produces a short positive-strand leader RNA and five
capped and polyadenylated mRNAs encoding, successively, N, P, M (matrix
protein), G (glycoprotein), and L. Replication produces genome-length
encapsidated positive-strand RNA, which serves in turn as a template
for amplification of the negative-strand genomic RNA. The switch from
transcription to replication is still debated, but studies on vesicular
stomatitis virus (VSV), the working model for rhabdoviruses, implicate
the amount of available N protein for genome encapsidation. N alone tends to aggregate nonspecifically in the cytoplasm, and one role of P,
via N-P complexes, is to prevent this aggregation and to keep N in a
suitable form for specific encapsidation (9, 14, 17, 22, 24, 26,
27). P also participates in the genome expression strategy by
mediating attachment of the L polymerase core to the N-RNA template
(32). It is thus clear that all four elements of the RNP
complex establish close interactions. Understanding these interactions
and localizing the protein domains involved would not only elucidate
the functional strategy of genome expression but also offer potential
targets of pharmacological interest in diseases where vaccination still
remains the only efficient prophylactic tool. To date, the lyssavirus N
protein, because it is highly refractory to deletion analysis, and L
protein, because of its large size, have been poorly studied. The last
566 C-terminal residues of the rabies L protein have been shown to
contain the only P protein binding site (6). In addition,
the rabies N protein was shown to contain a large
NH2 core (amino acids [aa] 1 to 376)
encompassing the specific RNA binding site (aa 298 to 352) followed by
a trypsin-sensitive site separating a C tail (aa 377 to 450) (18,
20). Structural analysis by electron microscopy showed that one
N protein interacts with nine nucleotides (10, 33), that
the NH2 core is sufficient to form RNP
(18), and that P interacts with the C tail
(32). A second P protein binding site has been observed on
N (5). The rabies P protein has been, by far, the most
extensively studied. Coimmunoprecipitation experiments have identified
two independent N-binding sites which were slightly differently mapped
in two studies: aa 69 to 177 and aa 173 to 297 (mainly aa 268 to 297)
for the CVS strain (5) and aa 1 to 131 (mainly aa 1 to 20)
and aa 69 to 273 (mainly aa 250 to 273) for the ERA strain
(11). The first 19 N-terminal residues of P also contain
the major L-binding site (6). Two cellular kinases, rabies
virus protein kinase and protein kinase C, phosphorylate
specific serine residues at positions 63 to 64 and 162 to 210 or 271, respectively (15), but this phosphorylation is not
required for P oligomerization, which involves a large C-terminal
domain mapped between aa 52 and 297 (13). Finally, it was
recently demonstrated that the region 139 to 172 of lyssavirus P
protein including the DXKSXQ motif interacts strongly with the cytoplasmic dynein light chain (LC8), an element of the
microtubule-associated motors involved in minus-end directed axonal
transport (19, 28). This could explain how the RNP is
transported along the neuron axons from the peripheral site of
inoculation to the central nervous system. Despite this substantial
amount of data, our understanding of the dynamics of interactions
between the four partners of the RNP complex and of their functional
roles in transcription and replication remains limited. The present
work addresses these questions by combining two-hybrid and green
fluorescent protein (GFP)-reverse two-hybrid assays in
Saccharomyces cerevisiae to analyze protein-protein
interactions and a reverse genetic assay in mammalian cells to assess
the functionality of the RNP complex. The functional identification of
the interactive domains was performed on proteins from the two
divergent lyssaviruses, rabies virus and Mokola virus, in order to
delineate an organizational network shared by all members of the
Lyssavirus genus.
 |
MATERIALS AND METHODS |
Plasmid construction.
Fusion proteins used as bait and prey
in two-hybrid assays contained the complete open reading frame (ORF) of
the relevant polypeptide, respectively, fused to the Gal4p DNA binding
domain (BD) cloned in pAS2
(Laboratoire du Métabolisme des
ARNs, Institut Pasteur, Paris, France) and to the Gal4p activation
domain (AD) cloned in pACTII (Clontech). The constructs used in the
reverse genetic assay were inserted behind the T7 promoter in
pBluescript SK+/
(Stratagene). All constructs were obtained by PCR of
cDNA clones or reverse transcription (RT)-PCR of viral RNA from
purified virus using primers with convenient flanking restriction
sites. Standard manufacturer's protocols were followed for RNA
extraction using the TRIzol reagent (Life Technologies), for RT using
Expand Reverse Transcriptase (Roche) and for PCR using Expand
high-fidelity PCR system (Roche). Fusion joints and the complete ORF of
the PCR-generated fusions were sequenced on an ABI 377 automatic
sequencer (Perkin-Elmer).
The full-length PV strain rabies virus P gene from aa 1 through 297 (P-Rab), as well as deletion mutants lacking aa 1 to 57 (P-Rab?58-297), aa 1 to 189 (P-Rab?190-297), aa 176 to 297 (P-Rab?1-175), and aa 1 to 60 fused to aa 176 to 297 (P-Rab?61-175)
were inserted into the NcoI restriction site of the vectors
pACTII, pAS2
, and/or pBluescript SK+/
. The full-length (aa 1 to
450) PV strain rabies virus (N-Rab) and Mokola virus (N-Mok) N genes,
the full-length Mokola virus P gene from aa 1 through 303 (P-Mok), as
well as its deletion mutants lacking aa 1 to 56 (P-Mok?57-303), aa 1 to 185 (P-Mok?186-303), and aa 177 to 303 (P-Mok?1-176) were inserted into the BamHI restriction site of the vectors pACTII,
pAS2
, and/or pBluescript SK+/
. The L gene of rabies virus
(L-Rab32) was cloned by RT-PCR using specific primers adding
NcoI (5') and EcoRI (3') restriction sites. The
PCR product was inserted into NcoI/EcoRI-digested
pBluescript SK+/
containing an NcoI/EcoRI adapter between the BamHI and HindIII sites.
All plasmids were amplified in Escherichia coli strain
DH5
and purified by chromatography on Qiagen columns.
Yeast two-hybrid analysis.
The two-hybrid system is based on
the ability of the yeast transcription factor GAL4 to be divided into
two separable and functional domains: an N-terminal domain which binds
to specific DNA sequences upstream of activation sequence G (BD)
and a C-terminal acidic domain necessary to activate transcription
(AD). In order to analyze the interaction between two proteins X and Y
these two GAL4 domains are cloned separately in 2µm plasmids fused in frame with proteins X and Y. Plasmids encoding GAL4BD-X (pAS2
-X) and GAL4AD-Y (pACTII-Y) were introduced into the S. cerevisiae strain SFY 526 with deletions of
trp1, his3, gal4, and
gal80, auxotrophic for Leu and Trp, and containing a
GAL1-lacZ reporter gene (16). If X and Y
interact, GAL4BD and GAL4AD are brought close together, reconstituting
a functional GAL4 transcription factor which is able to drive
expression of the GAL1-lacZ reporter gene. Thus, the
interaction of the tested proteins is assayed by measuring
-galactosidase activity.
Yeast SFY526 was transformed with the two plasmids (pAS2


-X and
pACTII-Y) using the LiCl procedure (
12). Transformed
cells
were plated on Sabouraud dextrose (SD)-Trp-Leu minimal medium
plates, and colonies were streaked 4 to 5 days later on plates
of SD
minimal medium lacking Trp and Leu (SD-

Trp-

Leu) for

-galactosidase
activity
assay.
-Galactosidase assays.
Activation of the LacZ reporter
gene has been measured by quantitative liquid assays on permeabilized
cells with the LacZ chromogenic substrate ONPG
(o-nitrophenyl-
-D-galactoside)
(Sigma catalog no. N1127) as described (25).
-Galactosidase units are expressed as the optical density at 405 nm × 1,000/optical density at 600 nm of assayed culture × volume assayed (in milliliters × time in minutes). Assays were
done at least in triplicate for each independent transformant. Values
represent the mean, and the standard errors were between 10 to 20% of
the mean.
P-Mok
1-176 random mutant library.
The P-Mok
1-176
random mutant library was fused in frame to a positive selectable
marker, the GFP gene (4). This was performed in two steps.
First the EGFP gene (Clontech) was amplified with primers FUS-GFP 5'
(5' CGGGATCCATGGGTAAAGGAGAAGAAC 3') and FUS-GFP 3' (5'
GAAGATCTTATTTGTATAGTTCATCCATGCC 3') and the
BamHI-BglII fragment was cloned into the
BamHI site of pACTII (Clontech). The resulting pACT-GFP
vector contained a polylinker with an SfiI and a
BamHI site 5' of the GFP gene.
In a second step, random mutations of the P-Mok

1-176 gene were
generated using PCR under suboptimal conditions to reduce
the fidelity
of DNA synthesis by
Taq DNA polymerase (Pharmacia).
The
following primer set was used: primer Sfi (5' CATATGGCCATGGAGGCC
3'), complementary to the
SfiI site of P-Mok

1-176
in pACTII,
and primer FUS-P-Mok

1-176 (5'
TATGAAGATCTCTCTGCCTCCTCGAGCCGGGCCAT
3'), which introduces a
BglII site at the 3' end of P-Mok

1-176
gene. The PCR
conditions were similar to those in the standard
protocol
(
23) except for a nucleotide bias (1 mM dGTP, dCTP,
and
dTTP and 0.2 mM dATP, giving a dGTP/dATP ratio of 5) and 0.5
mM
Mn
2+ (
29). P-Mok

1-176 DNA (2 µg) was used as matrix, and only 20
cycles of amplification were
performed. The amplification product
was cloned into the pACT-GFP
vector using
SfiI and
BamHI sites.
This produced
an in-frame fusion of P-Mok?1-176 mutants with EGFP.
An overall
mutation frequency of 4% was determined by sequencing
10 randomly
picked clones. The base substitution matrix is characterized
essentially by transitions (T

C, 43%; A

G, 36%) and to a lesser
level by transversions (A

T, 11%; T

A, 5%).
Reverse two-hybrid analysis.
Reverse two-hybrid analyses
were performed as previously described in reference 36.
Briefly, engineered yeast strain MAV 103 (generous gift of Gibco-BRL),
in which URA3 expression is tightly regulated by a promoter
containing GAL4 binding sites (SPALn) was cotransformed with
N-Mok-GAL4BD and a library of P-Mok
1-176 mutants. Since
GAL4-inducible URA3 alleles confer a fluoroorotic acid
(FOA)-sensitive phenotype, growth on medium containing SD-
Leu-
Trp plus 0.1% 5-FOA (catalog no. 16193; Lancaster Synthesis Ltd.) only
selects P-Mok
1-176 mutants altered in their capacity to interact
with N-Mok (Fig. 1). In a second step,
weakly interactive mutants were selected using medium containing
SD-
Leu-
Trp-
His plus 10 mM 3-aminotriazole (3-AT) (Sigma catalog
no. A.8056). We developed in parallel a positive selection using GFP
fluorescence in order to eliminate noninformative mutants having
nonsense mutations, deletions, or insertions.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 1.
GFP-reverse two-hybrid screening procedure for the
GAL4AD P-Mok 1-176 random mutation library. The EGFP gene (Clontech)
was introduced in frame with mutated P-Mok 1-176 inserts as a
positive selectable marker. A titration experiment for both negative
and positive phenotypes was preliminarily done with MAV 103 yeast cells
expressing wt P-Mok 1-176-GFP fusion in pACTII and N-Mok in
pAS2 . This interaction allowed growth on plates with up to 100 mM
3-AT and a total growth inhibition with 0.1% 5-FOA. Under these
conditions, strong and weak mutations affecting P-Mok 1-176
interaction with N-Mok were selected from the mutant library by
using a two-step protocol with sequential growth selection
(36) combined with a positive selection for strong EGFP
fluorescence. First, MAV 103 yeast cells cotransformed with the
P-Mok 1-176 random mutant library and N-Mok were selected on plates
containing SD- Leu- Trp- Ura plus 0.1% 5-FOA. Large EGFP-positive
yeast colonies (strong mutants) were patched on plates containing
SD- Leu- Trp plus 0.1% 5-FOA. Colonies on 5-FOA medium were
replica-plated to SD- Leu- Trp medium to allow recovery for 24 h. They were subjected to a second selection on plates containing
SD- Leu- Trp- His plus 10 mM 3-AT, and strongly expressing EGFP
colonies (weak mutants) were patched on plates containing
SD- Leu- Trp- His plus 10 mM 3-AT. After plasmid rescue, the
phenotypes of mutagenized alleles were verified by patching the
colonies on selective media and microscopically checking for EGFP
fluorescence.
|
|
Reverse genetic assay.
The reverse genetic assay was based
on the method in reference 31 with modifications (P. Le
Mercier et al., submitted for publication). BSR cells
(30) were grown in Dulbecco's modified Eagle's medium,
Glutamax I (Gibco) supplemented with 8% fetal calf serum (FCS), and
gentamicin (40 mg/liter). The cells were plated at 2.5 × 105 cells per well in a 24-well plate and
incubated at 37°C for 24 h. The medium was then removed and the
cells were infected with T7 recombinant vaccinia virus vTF7-3
(multiplicity of infection of 10 PFU per cell) in Dulbecco's modified
Eagle's medium in order to obtain a cytoplasmic expression of T7-RNA
polymerase. After 30 min the medium was removed and the cells were
transfected with plasmids in which viral N, P, and L ORFs and a
minigenome cDNA are under the control of the T7 promoter (1 µg of
pT7-N and pT7-P, 0.2 µg of pT7-L-32, and 0.5 µg of minigenome
plasmid pDI.mut) using polyethylenimine (PEI) (Aldrich catalog no.
40,872-7). Briefly, 4.5 mg of pure PEI was diluted in 8 ml of water,
neutralized with HCl, adjusted to 10 ml, and filtered through a
0.2-µm-pore-size filter (Millipore). PEI and plasmid DNA solutions
were each diluted in 50 µl of 150 mM NaCl (PEI/DNA ratio of 1.5),
kept 10 min at room temperature, mixed and vortexed, and then added to
the cell supernatants without FCS. After 2 h, the transfection
medium was removed and fresh medium with 5% FCS was added, and the
cells were incubated at 37°C for 48 h. pDI.mut cDNA cassette (Le
Mercier et al., submitted) is transcribed by T7-RNA polymerase to
produce a PV strain rabies minigenome (RNA-Rab) composed of the trailer and leader sequences, as well as, respectively, the L stop and N start
transcription signals flanking an antisense luciferase RNA. In
addition, to perfectly mimic the extremities of the wild-type (wt)
viral genome, the minigenome RNA is flanked by a hammerhead ribozyme
and a hepatitis-delta virus genomic ribozyme at the 5' and 3' ends,
respectively. The T7-expressed N, P, and L proteins and the RNA
minigenome form a functional RNP template resulting in luciferase gene
transcription, and thus the amount of luciferase activity is related to
the transcriptional activity of the RNP.
Luciferase assay.
At 48 h after transfection, cells
were washed with phosphate-buffered saline and overlaid with 200 µl
of lysis buffer (25 mM Tris-phosphate [pH 7.8], 2 mM dithiothreitol,
10% glycerol, 10% Triton X-100) for 10 min at room temperature. The
extracts were centrifuged 3 min at 4,000 × g, and
luciferase expression was measured using a Berthold luminometer by
injecting 100 µl of luciferase assay reagent (Promega catalog no.
E1501) into 10 µl of each supernatant and counting for 10 s.
Luciferase activity was measured in triplicate; values represent the
mean (standard error < 10% of the mean).
 |
RESULTS |
Two-hybrid intragenotypic analysis.
P and N self-association
properties were first analyzed for both rabies and Mokola viruses using
the two-hybrid method (Fig. 2A). A strong
transactivation was obtained when P-Mok-AD and P-Mok-BD were
coexpressed (66 U, 100%), indicating P-Mok homo-oligomerization. Similar homo-oligomerization was obtained with P-Rab (100 U, 100%). P
protein deletion mutants were tested for their interaction with full-length P (P-full). A dramatic increase of
-galactosidase activity (347%) was observed when the P-Mok N-terminal half
(P-Mok
186-303) was coexpressed with P-Mok-full. This elevated
transactivation compared to P-Mok-full is classic in two-hybrid systems
(see other examples below) and probably due to better domain folding in
the absence of steric hindrance (35). In contrast, the
C-terminal half (P-Mok
1-176) interacted very weakly (4%) with
P-Mok-full. A similar interaction pattern was obtained with the P-Rab
N-terminal half (P-Rab
190-297, 62%) and C-terminal half
(P-Rab
1-175, <1%). In addition, the P-Rab
190-297 was capable
of substantial homo-oligomerization (51%). Taken together, these
results argue for a lyssavirus P oligomerization domain located between
aa 1 and 185 or 189. Since an alignment of the P-Mok and P-Rab amino
acid sequences reveals two highly conserved regions around aa 1 to 60 and aa 200 to 280 (Fig. 3), the
interaction potential of the highly conserved N-terminal domain was
studied. P-Mok
57-303 interacted poorly with P-Mok-full (23%), and
P-Rab
58-297 failed to interact with P-Rab-full. This suggests that
most of the multimerization region has either been deleted in these
mutants or that its proper folding requires larger flanking regions.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 2.
Interactions between lyssavirus N and P proteins
measured in the yeast two-hybrid system in S.
cerevisiae. Full-length or deletion mutants of the PV strain
rabies virus (Rab, GT1, limits in black type) and the Mokola virus
(Mok, GT3, limits in outlined type) were fused with either the GAL4AD
or the GAL4 DNA BD. Transcription of the reporter gene (LacZ) under the
control of the GAL4 DNA-binding regulatory elements indicated
interaction between the two fusion proteins of interest. The amount of
-galactosidase indicates the intensity of the interaction. (A)
Intragenotypic interactions. -Galactosidase activities (means of a
triplicate) are represented in black letters for Rab and in outlined
letters for Mok. The values in parentheses represent the percentage of
activity of each interaction compared to interaction between
full-length P or N proteins (100%). (B) Intergenotypic N-P
interactions expressed in -galactosidase activity (means of a
triplicate).
|
|

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 3.
Comparison of lyssavirus P proteins. Sequence alignment
of the P proteins of PV strain rabies virus (Rab, GT1) and Mokola virus
(Mok, GT3) is shown. Dashes represent gaps introduced to optimize the
alignment. Grey boxes outline identical residues (overall identity,
48%).
|
|
A similar dissection was impossible to perform with N protein due to
its high sensitivity to deletion (
20). In addition,
lyssavirus N protein is toxic for yeast cells. However,
homo-oligomerization
was observed for N-Mok-full (64 U). Interactions
between full-length
P and N proteins were observed with proteins from
either virus
(P-Rab/N-Rab, 340 U, 100%; P-Mok/N-Mok, 140 U, 100%).
When P deletion
mutants were assayed, the strongest interaction with
homologous
N-full was observed with the C-terminal half
(P-Rab

1-175, 75%;
P-Mok

1-176, 480%). Although the N-terminal
part of P (P-Rab

190-297,
16%; P-Mok

186-303, 101%) also
interacted with homologous N-full,
the strength of this interaction was
fivefold less than that observed
with the C-terminal half. These
results argue that lyssavirus
P proteins have two N-BDs, a stronger one
in the C-terminal half
(aa 176 or 177 to aa 297 or 303) and a weaker
one in the N-terminal
half (aa 1 to 185 or
189).
Two-hybrid intergenotypic analysis.
When lyssavirus
intergenotypic oligomerizations where analyzed (Fig. 2B), N-Rab-full
and N-Mok-full, which are 81% identical (2), showed
substantial interaction (81 U) despite their toxicity for yeast. On the
other hand, P-Rab-full and P-Mok-full also showed a significant
interaction (27 U), suggesting oligomerization between these
orthologous proteins that are only 48% identical. Furthermore, P-Rab
190-297 was sufficient for an interaction with P-Mok-full (data not shown), arguing that the oligomerization motif in the N-terminal half of lyssavirus P proteins is conserved, although it is
not part of the highly conserved N-terminal end up to aa 56 or 57, as
previously demonstrated (Fig. 2A).
When lyssavirus intergenotypic P-N interaction was analyzed (Fig.
2B)
significant

-galactosidase activity (140 U, 100%) was
observed with
N-Rab-full-P-Mok-full, and as in the intragenotypic
context, the
C-terminal half, P-Mok

1-176, provided reproducibly
a slightly
greater interaction with N-Rab-full (174 U, 124%) than
the N-terminal
half, P-Mok

186-303 (130 U, 90%), did. The symmetrical
observation
was made when N-Mok-full was coexpressed with P-Rab-full
(22 U, 100%),
P-Rab

1-175 (19 U, 86%) and P-Rab

190-297 (0%).
Surprisingly,
intergenotypic interactions were globally sixfold
more intense in the
combination P-Mok-N-Rab than P-Rab-N-Mok.
The reason for that is
unclear but could be related to the observation
that nucleoproteins
from nonsegmented negative-strand RNA viruses
are folded into a large
N-terminal globular core and an exposed
C-terminal 80 aa tail predicted
to interact with the P protein
(
3,
8,
20,
21,
32). The C
tails from N-Rab and N-Mok
are only 69% identical compared to 81% for
the entire protein,
and this variability could explain the differences
in P protein
binding
intensities.
Reverse two-hybrid screening of important residues of the strongest
N-BD in the C-terminal half of P.
To precisely define which amino
acid residues of P are implicated in N-P interaction, a library of
mutants was generated by random PCR mutagenesis of the strongest P-Mok
N-BD (P-Mok
1-176). This library was screened using a GFP-reverse
two-hybrid system, where dissociation of the interaction is a selective
advantage (Fig. 1) (H. Endoh et al., submitted for publication). After
having verified that fusion of P-Mok
1-176 with GFP did not modify
its interaction with N-Mok and that the frequency of reversion to 5-FOA
resistance was low (0.01%), 1.5 × 106
clones coexpressing P-Mok
1-176 mutants GFP-AD and N-Mok-BD were plated on medium containing SD-
Leu-
Trp-
URA plus 0.1% 5-FOA. After 24 h of recovery on SD-
Leu-
Trp medium, FOA-resistant
colonies (2%) were selected for histidine prototrophy on selection
medium lacking His. This selection segregated amino acid changes which partially affect N-P-Mok
1-176 interaction (weak mutations)
(37). Among FOA-resistant colonies, three GFP phenotypes
were observed: GFP-negative colonies containing nonsense mutations; GFP
faintly positive colonies resulting from read-through of nonsense
mutations; and strongly positive GFP colonies. Ten plasmids from the
third set of clones were reintroduced into yeast cells containing
N-Mok-BD to confirm their 5-FOA resistance and strong GFP positive
phenotype, and their inserts were sequenced (Fig.
4a). Six weak binding mutant clone
inserts were also sequenced (Fig. 4b). While the distribution of the
mutations in weak mutants was essentially random, strong mutants were
more frequently mutated in a short lysine-rich stretch (210FSKKYKF216).
Of nine mutations affecting this stretch, five corresponded to charge
modifications of at least one of the three lysine residues to glutamic
acid. We converted all three lysine residues in full-length P-Mok into
glutamic acids. In the classical two-hybrid system, this mutant (PS1)
protein displayed threefold less interaction with N-Mok (48 U, 34%),
strongly supporting the idea that these lysines play a key role in N-P
binding but also underlining the coexistence in the N-terminal half of
P-Mok of the second independent N-BD, of lower affinity, which remained efficient in PS1. Interestingly, the PS1 mutant interaction with P-Mok
was of similar intensity to that of P-Mok self-interaction (70 U,
106%), verifying that the N-terminal half, involved in P
oligomerization, is not affected.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 4.
Comparison of the strong and weak mutants of the
strongest N-BD of P-Mok. Similarity profile (upper part) and sequence
alignment for the 10 strong (dark line) (a) and 6 weak (grey line) (b)
P-Mok 1-176 mutants. The corresponding lysine-rich stretch, found
to be frequently mutated, is underlined (position 210 to 216).
|
|
Functional analysis by reverse genetics.
To evaluate the
functionality of intra- and intergenotypic RNP complexes, a reverse
genetic assay was developed (Le Mercier et al., submitted). Viral N, P,
and L cDNAs as well as a viral minigenomic cDNA were cloned in T7
expression vector and cotransfected into T7 recombinant vaccinia
virus-infected BSR cells. The minigenomic RNA (RNA-Rab), which is
vastly overproduced by T7 RNA polymerase, successively encompasses the
following (from the 5' to the 3' end): hammerhead ribozyme, rabies
virus trailer sequence, antisense RNA from luciferase gene, rabies
virus leader sequence, and hepatitis-delta virus genomic ribozyme. This
T7 RNA polymerase transcript after ribozyme cleavage perfectly mimics
the extremities of the wild type viral genomic RNA. Thus, the
minigenomic RNA and the N, P, and L proteins expressed from the
respective mRNAs form a functional RNP. This RNP could serve as
template for two successive RNA synthetic functions: transcription and
then replication. In this assay transcription consists of production of
both a small leader RNA and a capped and polyadenylated luciferase RNA
whose level is measured by luciferase activity. Only transcription is
evaluated in this case, which does not formally exclude a functionality
of the RNP complex at the replicative level. In Fig.
5 the reference level corresponds to the
luciferase activity obtained with minigenome RNA-Rab and full-length proteins N-Rab, P-Rab, and L-Rab (line A). As shown in
lines B to E each component of the RNP complex is required for
transcriptional activity. P-Rab
190-297, which contains the P-oligomerization domain and the weak N-BD, induced a partially active
RNP (line F), while P-Rab
1-175, which contains the strong N-BD,
failed (line G). This difference could be explained by the absence in
P-Rab
1-175 of the essential L interacting domain located in the
N-terminal 19 aa, as described for the CVS P protein (6). Accordingly, when the N-terminal 60 aa of P-Rab were fused to P-Rab
1-175 (P-Rab
61-175) a strong transcriptional activity was restored (line H). Interestingly, simultaneous expression of
P-Rab
1-175 and P-Rab
190-297 only displays the residual activity
observed with P-Rab
190-297 alone (line I). Since these two
fragments did not interact in the two-hybrid assay (data not shown),
this underlines the absolute necessity of a physical link between the
L-BD and the strong N-binding site to get a functional transcription
complex. The substitution of the P-Rab or N-Rab proteins by P-Mok or
N-Mok proteins resulted in a heterogenotypic RNP with lower but
significant activity (lines J and K) as expected from the sequence
divergence (2). Swapping both N-Mok and P-Mok in a
minigenome RNA-L-Rab context still decreased the activity (line L),
suggesting that the RNA-L complex has stringent requirements for
homologous P and/or N. The PS1 P-Mok mutant was unable to reconstitute
a functional RNP with either N-Rab or N-Mok (lines M and N), although
it maintained a significant interaction with N-Mok, through the weak
N-binding site.

View larger version (63K):
[in this window]
[in a new window]
|
FIG. 5.
Functionality of reconstituted RNP measured by reverse
genetics. Luciferase activity was measured in triplicate, and values
are expressed as a percentage of the reference activity. The reference
value (100%) is the activity obtained with minigenomic RNA and
full-length N, P, and L proteins of the PV strain rabies virus (Rab,
line A). The background luciferase level is noted as <0.2%, and the
values of 0.5% or more are significantly above the background level.
Lines B to E correspond to control experiments and demonstrate that
each component is necessary for transcriptional activity. The results
using intergenotypic components (lines J to N) are displayed with a
gray background.
|
|
 |
DISCUSSION |
Previous studies have demonstrated interactions between the
elements of the rabies virus RNP complex (6, 5, 11, 18, 20,
32). They used cross-linking or coimmunoprecipitation of N, P,
and L proteins expressed in bacteria or in eukaryotic cells. These
studies focused on different strains of rabies virus from GT1 of the
Lyssavirus genus: CVS, ERA, or SADB19. In the present study,
we combined an in vivo two-hybrid interactive domain mapping of
primarily P but also of N protein, with a reverse genetic assay to
analyze the transcriptional functionality of the reconstituted RNP
complex. In addition, this combined analysis was applied to two
phylogenetically distant lyssaviruses representative of the two
principal phylogroups: the PV strain rabies virus (GT1, phylogroup 1)
and the Mokola virus (GT3, phylogroup 2) (1). Both
intragenotypic and intergenotypic interactions were studied, based on
the rationale that N and P proteins coming from the two different
viruses should be able to reconstitute genotypically heterogeneous RNPs
capable of significant transcriptional activity although lower than
that of homogeneous RNP. The observation that P-Mok gave a lower
transcriptional activity than N-Mok in an otherwise RNP-Rab context was
not surprising since N is the more conserved protein (81% identity),
while P proteins from Mokola virus and rabies virus are only 48%
identical, with the similarity mostly concentrated in two highly
conserved domains restricted to aa 1 to 60 and aa 200 to 280 (Fig. 6).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 6.
Functional interaction map of lyssavirus phosphoprotein.
Similarity profile between the PV strain rabies virus and Mokola virus
P proteins (similarity plot program of GCG, window 20 aa). The P
protein domains involved in oligomerization or in interaction with L
and N lyssavirus proteins or with the dynein LC8 are mapped. The
stretches particularly important for the interaction are indicated by
thick lines, and the KKYK motif is noted.
|
|
Oligomerization properties were demonstrated for both rabies and Mokola
virus N and P proteins, in an intragenotypic or an intergenotypic
context. Deletion analysis of the P protein suggested that its
multimerization domain is located within the N-terminal half (aa 1 to
185 or 189). However, the highly conserved first 57 residues do not
appear to be implicated, even though they include a region with
coiled-coil forming potential (aa 1 to 30) frequently involved in
protein oligomerization (7). This result is in good
agreement with that from cross-linking of CVS strain rabies virus P
protein mutants produced in bacteria, delineating the oligomerization
domain in the region of aa 52 to 297 (13). Taken together,
these data suggest that the lyssavirus P protein oligomerization domain
is mainly contained in aa 52 to 185 or 189, i.e., in the central highly
variable part of the protein (Fig. 6).
Coimmunoprecipitation experiments with P and N proteins have previously
shown two independent N-binding sites along the rabies P protein. Using
BSR (baby hamster kidney) cell extracts expressing both proteins from
the CVS strain (5; D. Blondel, personal communication),
these two sites were mapped to aa 69 to 138 and aa 173 to 297, of which the distal part, aa 268 to 297, is absolutely required for
N-binding. Using an in vitro coupled transcription-translation system
and Sf9 cell extracts expressing both proteins from the ERA strain
(11), it was found that the region of aa 1 to 131 was able
to bind N when both proteins where synthesized simultaneously, while aa
69 to 273 could bind whether the proteins were produced simultaneously
or separately. The distal part of each domain (aa 1 to 20 and aa 250 to
273, respectively) appeared critical for N binding. Our results with
both the PV rabies strain and Mokola viruses are consistent with the
existence of two independent N-BDs along lyssavirus P protein but
clearly modulate their respective functional importance. The
carboxy-terminal domain (C-terminal half, aa 176 or 177 to aa 297 or
303) plays the major role in P-N binding since it is about fivefold
more intense than that of the amino-terminal domain (N terminal half,
aa 1 to 185 or 189). The reverse two-hybrid method demonstrated that
the short lysine-rich motif FSKKYKF (position 210 to 216 in
P-Mok and 209 to 215 in P-Rab), conserved in the seven different
genotypes of lyssaviruses (S. Nadin-Davis, personal communication), was
of critical importance for the N-protein binding competence of the P
C-terminal domain. However, the triple mutant PS1, corresponding to a
full-length P-Mok in which these three K are mutated to E, still binds
to N-Mok, although threefold less efficiently than wt P-Mok-full, and
is still able to oligomerize with P-Mok-full. This result indicates
that the N-terminal domain of P is able to display interactions
independently. In summary, our results are in reasonable agreement with
the previous results and can be combined with them to predict that the
lyssavirus P protein harbors two independent N-binding sites. One site
of primary importance residing in the C-terminal half (aa 176 or 177 to
aa 297 or 303) and encompassing two very important stretches, the
lysine-rich motif (aa 209 or 210 to aa 215 or 216) and the C-terminal
tail (aa 268 or 269 to aa 297 or 303). Another site of secondary
importance in the N-terminal half probably lies between aa 69 and 138, i.e., possibly partially overlapping with the oligomerization domain (aa 57 to 185 or 189) (Fig. 6). The existence of a third weak N-binding
site in the very first 20 aa of P (11) is unclear, but it
should be noted that the two-hybrid method revealed a weak interaction
between N-Rab and the first 57 N-terminal residues of P-Rab, a result
which was not confirmed with the similar domain of P-Mok.
The reverse genetics analysis allowed us to complete the in vivo
binding studies by examining transcriptional functionality in a
reconstituted RNP complex. Whereas P-Mok gave substantial transcription
in an RNP-Rab context, the PS1 mutant did not, suggesting that an
efficient N-binding site in the C-terminal half of P is needed to
promote transcription. However, the C-terminal domain of P alone, in
spite of its strong interaction with N protein, is unable to
reconstitute a functional RNP, whereas the N-terminal domain alone had
residual transcriptional activity. In addition, the fusion of the first
60 N-terminal aa of P to the carboxy-terminal domain (P-Rab
61-175)
restored full transcriptional functionality, despite the probable lack
of the weak N-binding site (aa 69 to 138) as well as the
oligomerization domain (aa 52 to 185 or 189) in the mutant. This result
supports the idea that the N-terminal L protein binding site, which was
mapped to the first 19 residues of P with a stabilizing effect of aa 20 to 52 (6), is essential for P transcriptional function and
sufficient when associated with the major N-protein binding site in the
C-terminal domain. However, colinearity between these domains is
needed since coexpression of P-Rab
1-175 and P-Rab
190-297
failed to restore functionality. Thus, deletion of the region of aa 61 to 175, which encompasses the weak N-binding site, is not deleterious
for transcription. One can, however, presume that this region is of
primary importance for replication, which was not measured in our
reverse genetics assay. It was previously shown for VSV that P protein
plays a key role during replication by complexing the N protein and
keeping it in a convenient form for encapsidation (17).
The second weak N-protein binding site could be crucial for this P
replicative function. The previous observation that the N-terminal
domain (aa 1 to 131) of the ERA rabies virus P protein is only able to bind N when both proteins are synthesized simultaneously
(11) supports the argument for this chaperone-like
function of the weak N-protein binding site for P on N during
replication. A recent model of VSV RNP assembly proposes that an N
dimer interacts with one molecule of P and that five such 2:1 N-P
complexes form a barrel-like oligomer, corresponding to one turn of the
RNP helix (14). The role of the P protein in this model is
to promote the correct assembly of the N-oligomer, which in the absence
of P forms random aggregates. In contrast, the rabies N protein
overexpressed in the baculovirus system naturally forms an N-RNA ring
structure without requiring P coexpression and even if the C-terminal
tail of N, carrying the P binding site, is deleted. This suggests that the chaperone-like function of lyssavirus P on N would not be crucial
for N multimerization in RNP (32).
In summary, the combination of in vivo two-hybrid and reverse genetic
approaches associated with an intergenotypic swapping strategy within
the Lyssavirus genus has allowed a more precise delineation
of interactive domains of the lyssavirus P protein and a definition of
their respective functionality in the RNP context. Figure 6 proposes a
functional interaction map of this protein, which occupies a nodal role
in the network of functional protein-protein interaction by providing a
bridge at the interface between N-RNA complex, L, and cellular factors.
In this P protein model, the very conserved first 60 aa mainly act for
L recruitment, the L binding site being more restricted to the first 19 aa. The consecutive variable domain carries the oligomerization domain (aa 52 to 185 or 189) and a weak N-binding site (aa 69 to 138) which
are not required for transcription but are probably implicated in
replication. This region also contains the domain of interaction with
the cytoplasmic dynein light chain LC8 (aa 139 to 172), a cellular
factor implicated in retrograde axonal transport that mediates the RNP
transport along the neuron axons (19, 28). Finally, the
C-terminal half (aa 176 or 177 to aa 297 or 303), including the region
of aa 268 to 297, demonstrated to be important for rabies virus,
encompasses the main transcriptionally important N-binding site which
contains a very conserved region with the lysine-rich motif
FSKKYKF (aa 209 or 210 to aa 215 or 216).
 |
ACKNOWLEDGMENTS |
We thank Alain Jacquier and Micheline Fromont-Racine (Unité
de Génétique des Interactions Macromoléculaires,
Institut Pasteur), Pierre Legrain and Jean-Christophe Rain
(Hybrigenics, Paris, France), Marc Vidal (Dana Farber Cancer Institute,
Boston, Mass.), and Michael Brasch (Life Technologies) for helpful
discussions and the generous gift of yeast strains and plasmid vectors;
Philippe Le Mercier for providing the reverse genetic cassette; and
Charles Roth for helpful comments and suggestions. We are greatly
indebted to Yvette Forteville, Malika Campanaro, and Karine Wiszniowski for technical assistance.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratoire des
Lyssavirus, Institut Pasteur, 25 rue du Dr Roux, 75724 Paris Cedex 15, France. Phone: (33) 1-45 68 87 53. Fax: (33) 1-40 61 32 56. E-mail:
yjacob{at}pasteur.fr.
 |
REFERENCES |
| 1.
|
Badrane, H.,
C. Bahloul,
P. Perrin, and N. Tordo.
2001.
Evidence of two Lyssavirus phylogroups with distinct pathogenicity and immunogenicity.
J. Virol.
75:3268-3276[Abstract/Free Full Text].
|
| 2.
|
Bourhy, H.,
B. Kissi, and N. Tordo.
1993.
Molecular diversity of the Lyssavirus genus.
Virology
194:70-81[CrossRef][Medline].
|
| 3.
|
Buchholz, C. J.,
C. Retzler,
H. E. Homann, and W. J. Neubert.
1994.
The carboxy-terminal domain of Sendai virus nucleocapsid protein involved in complex formation between phosphoprotein and nucleocapsid-like particles.
Virology
204:770-776[CrossRef][Medline].
|
| 4.
|
Chalfie, M.,
Y. Tu,
G. Euskirchen,
W. W. Ward, and D. C. Prasher.
1994.
Green fluorescent protein as a marker for gene expression.
Science
263:802-805[Abstract/Free Full Text].
|
| 5.
|
Chenik, M.,
K. Chebli,
Y. Gaudin, and D. Blondel.
1994.
In vivo interaction of rabies virus phosphoprotein (P) and nucleoprotein (N): existence of two N-binding sites on P protein.
J. Gen. Virol.
75:2889-2896[Abstract/Free Full Text].
|
| 6.
|
Chenik, M.,
M. Schnell,
K. K. Conzelmann, and D. Blondel.
1998.
Mapping the interacting domains between the rabies virus polymerase and phosphoprotein.
J. Virol.
72:1925-1930[Abstract/Free Full Text].
|
| 7.
|
Curran, J.,
R. Boeck,
N. Lin-Marq,
A. Lupas, and D. Kolakofsky.
1995.
Paramyxovirus phosphoproteins form homotrimers as determined by an epitope dilution assay, via predicted coiled coils.
Virology
214:139-149[CrossRef][Medline].
|
| 8.
|
Curran, J.,
H. Homann,
C. Buchholz,
S. Rochat,
W. Neubert, and D. Kolakofsky.
1993.
The hypervariable C-terminal tail of the Sendai paramyxovirus nucleocapsid protein is required for template function but not for RNA encapsidation.
J. Virol.
67:4358-4364[Abstract/Free Full Text].
|
| 9.
|
Davis, N. L.,
H. Arnheiter, and G. W. Wertz.
1986.
Vesicular stomatitis virus N and NS proteins form multiple complexes.
J. Virol.
59:751-754[Abstract/Free Full Text].
|
| 10.
|
Flamand, A.,
H. Raux,
Y. Gaudin, and R. W. H. Ruigrok.
1993.
Mechanisms of rabies neutralization.
Virology
194:302-313[CrossRef][Medline].
|
| 11.
|
Fu, Z. F.,
Y. Zengh,
W. H. Wunner,
H. Koprowski, and B. Dietzschold.
1994.
Both the N- and the C-terminal domains of the nominal phosphoprotein of rabies virus are involved in the binding to the N protein.
Virology
200:590-597[CrossRef][Medline].
|
| 12.
|
Gietz, R. D.,
R. H. Schiestl,
A. R. Willems, and R. A. Woods.
1995.
Studies on the transformation of intact yeast cells by the LiAc/SS-DNA/PEG procedure.
Yeast
11:355-360[CrossRef][Medline].
|
| 13.
|
Gigant, B.,
F. Iseni,
Y. Gaudin,
M. Knossow, and D. Blondel.
2000.
Neither phosphorylation nor the amino-terminal part of rabies virus phosphoprotein is required for its oligomerization.
J. Gen. Virol.
81:1757-1761[Abstract/Free Full Text].
|
| 14.
|
Green, T. J.,
S. Macpherson,
S. Qiu,
J. Lebowitz,
G. W. Wertz, and M. Luo.
2000.
Study of the assembly of vesicular stomatitis virus N protein: role of the P protein.
J. Virol.
74:9515-9524[Abstract/Free Full Text].
|
| 15.
|
Gupta, A. K.,
D. Blondel,
S. Choudhary, and A. K. Banerjee.
2000.
The phosphoprotein of rabies virus is phosphorylated by a unique cellular protein kinase and specific isomers of protein kinase C.
J. Virol.
74:91-98[Abstract/Free Full Text].
|
| 16.
|
Harper, J. W.,
G. R. Adami,
N. Wei,
K. Keyomarsi, and S. J. Elledge.
1993.
The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases.
Cell
75:805-816[CrossRef][Medline].
|
| 17.
|
Howard, M., and G. Wertz.
1989.
Vesicular stomatitis virus RNA replication: a role for the NS protein.
J. Gen. Virol.
70:2683-2694[Abstract/Free Full Text].
|
| 18.
|
Iseni, F.,
A. Barge,
F. Baudin,
D. Blondel, and R. W. H. Ruigrok.
1998.
Characterization of rabies virus nucleocapsids and recombinant nucleocapsid-like structures.
J. Gen. Virol.
79:2909-2919[Abstract].
|
| 19.
|
Jacob, Y.,
H. Badrane,
P. E. Ceccaldi, and N. Tordo.
2000.
Cytoplasmic dynein LC8 interacts with lyssavirus phosphoprotein.
J. Virol.
74:10217-10222[Abstract/Free Full Text].
|
| 20.
|
Kouznetzoff, A.,
M. Buckle, and N. Tordo.
1998.
Identification of a region of the rabies virus N protein involved in direct binding to the viral RNA.
J. Gen. Virol.
79:1005-1013[Abstract].
|
| 21.
|
Krishnamurthy, S., and S. K. Samal.
1998.
Identification of regions of bovine respiratory syncytial virus N protein required for binding to P protein and self-assembly.
J. Gen. Virol.
79:1399-1403[Abstract].
|
| 22.
|
La Ferla, F., and R. Peluso.
1989.
The 1:1 N-NS protein complex of vesicular stomatitis virus is essential for efficient genome replication.
J. Virol.
63:3852-3857[Abstract/Free Full Text].
|
| 23.
|
Leung, D. W.,
E. Chen, and D. V. Goeddel.
1989.
A method for random mutagenesis of a defined DNA segment using a modified polymerase chain reaction.
Technique J. Methods Cell Mol. Biol.
1:11-15.
|
| 24.
|
Masters, P. S., and A. K. Banerjee.
1988.
Resolution of multiple complexes of phosphoprotein NS with nucleocapsid protein N of vesicular stomatitis virus.
J. Virol.
62:2651-2657[Abstract/Free Full Text].
|
| 25.
|
Miller, J. H.
1972.
Experiments in molecular genetics.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 26.
|
Peluso, R.
1988.
Kinetic, quantitative, and functional analysis of multiple forms of the vesicular stomatitis virus nucleocapsid protein in infected cells.
J. Virol.
62:2799-2807[Abstract/Free Full Text].
|
| 27.
|
Peluso, R. W., and S. U. Moyer.
1988.
Viral proteins required for in vitro replication of vesicular stomatitis virus defective-interfering particle genome RNA.
Virology
162:369-376[CrossRef][Medline].
|
| 28.
|
Raux, H.,
A. Flamand, and D. Blondel.
2000.
Interaction of the rabies virus P protein with the LC8 dynein light chain.
J. Virol.
74:10212-10216[Abstract/Free Full Text].
|
| 29.
|
Rice, G. C.,
D. V. Goeddel,
G. Cachianes,
J. Woronicz,
E. Y. Chen,
S. R. Williams, and D. W. Leung.
1992.
Random PCR mutagenesis screening of secreted proteins by direct expression in mammalian cells.
Proc. Natl. Acad. Sci. USA
89:5467-5471[Abstract/Free Full Text].
|
| 30.
|
Sato, M.,
N. Maida,
H. Yoshida,
M. Urade,
S. Saito,
T. Miyazaki,
T. Shibata, and M. Watanabe.
1977.
Plaque formation of herpes virus hominidis type 2 and rubella virus in variants isolated from the colonies of BHK21/WI-2 cells formed in soft agar.
Arch. Virol.
53:269-273[CrossRef][Medline].
|
| 31.
|
Schnell, M. J.,
T. Mebatsion, and K. K. Conzelmann.
1994.
Infectious rabies viruses from cloned cDNA.
EMBO J.
13:4195-4203[Medline].
|
| 32.
|
Schoehn, G.,
F. Iseni,
M. Mavrakis,
D. Blondel, and R. W. H. Ruigrok.
2001.
Structure of recombinant rabies virus nucleoprotein-RNA complex and identification of the phosphoprotein binding site.
J. Virol.
75:490-498[Abstract/Free Full Text].
|
| 33.
|
Thomas, D.,
W. W. Newcomb,
J. C. Brown,
J. S. Hall,
J. F. Hainfeld,
B. L. Trus, and A. C. Steven.
1985.
Mass and molecular composition of vesicular stomatitis virus: a scanning transmission electron microscopy analysis.
J. Virol.
54:598-607[Abstract/Free Full Text].
|
| 34.
|
Tordo, N.,
K. Charlton, and A. Wandeler.
1998.
Rhabdoviruses: rabies, p. 665-692.
In
B. W. J. Mahy, and L. Collier (ed.), Microbiology and microbial infections, vol. 1. Arnold, London, United Kingdom.
|
| 35.
|
Transy, C., and P. Legrain.
1995.
The two-hybrid: an in vivo protein-protein interaction assay.
Mol. Biol. Rep.
21:119-127[CrossRef][Medline].
|
| 36.
|
Vidal, M.,
R. K. Brachmann,
A. Fattaey,
E. Harlow, and J. D. Boeke.
1996.
Reverse two-hybrid and one-hybrid systems to detect dissociation of protein-protein and DNA-protein interactions.
Proc. Natl. Acad. Sci. USA
93:10315-10320[Abstract/Free Full Text].
|
| 37.
|
Vidal, M.,
P. Braun,
E. Chen,
J. D. Boeke, and E. Harlow.
1996.
Genetic characterization of a mammalian protein-protein interaction domain by using a yeast reverse two-hybrid system.
Proc. Natl. Acad. Sci. USA
93:10321-10326[Abstract/Free Full Text].
|
| 38.
|
Walker, P. J.,
A. Benmansour,
R. Dietzgen,
R. X. Fang,
A. O. Jackson,
G. Kurath,
J. C. Leong,
S. Nadin-Davies,
R. D. Tesh,
N. Tordo,
M. H. V. Van Regenmortel,
C. M. Fauquet, and D. H. L. Bishop (ed.).
2000.
Rhabdoviridae.
Academic Press, Orlando, Fla.
|
Journal of Virology, October 2001, p. 9613-9622, Vol. 75, No. 20
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.20.9613-9622.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Marston, D. A., McElhinney, L. M., Johnson, N., Muller, T., Conzelmann, K. K., Tordo, N., Fooks, A. R.
(2007). Comparative analysis of the full genome sequence of European bat lyssavirus type 1 and type 2 with other lyssaviruses and evidence for a conserved transcription termination and polyadenylation motif in the G-L 3' non-translated region. J. Gen. Virol.
88: 1302-1314
[Abstract]
[Full Text]
-
Mendoza, J.-A., Jacob, Y., Cassonnet, P., Favre, M.
(2006). Human Papillomavirus Type 5 E6 Oncoprotein Represses the Transforming Growth Factor {beta} Signaling Pathway by Binding to SMAD3. J. Virol.
80: 12420-12424
[Abstract]
[Full Text]
-
Vidy, A., Chelbi-Alix, M., Blondel, D.
(2005). Rabies Virus P Protein Interacts with STAT1 and Inhibits Interferon Signal Transduction Pathways. J. Virol.
79: 14411-14420
[Abstract]
[Full Text]
-
Brzozka, K., Finke, S., Conzelmann, K.-K.
(2005). Identification of the Rabies Virus Alpha/Beta Interferon Antagonist: Phosphoprotein P Interferes with Phosphorylation of Interferon Regulatory Factor 3. J. Virol.
79: 7673-7681
[Abstract]
[Full Text]
-
Real, E., Rain, J.-C., Battaglia, V., Jallet, C., Perrin, P., Tordo, N., Chrisment, P., D'Alayer, J., Legrain, P., Jacob, Y.
(2004). Antiviral Drug Discovery Strategy Using Combinatorial Libraries of Structurally Constrained Peptides. J. Virol.
78: 7410-7417
[Abstract]
[Full Text]
-
Toriumi, H., Honda, Y., Morimoto, K., Tochikura, T. S., Kawai, A.
(2002). Structural relationship between nucleocapsid-binding activity of the rabies virus phosphoprotein (P) and exposure of epitope 402-13 located at the C terminus. J. Gen. Virol.
83: 3035-3043
[Abstract]
[Full Text]