Previous Article | Next Article 
Journal of Virology, January 2001, p. 782-788, Vol. 75, No. 2
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.2.782-788.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Characterization of the AdoMet-Dependent
Guanylyltransferase Activity That Is Associated with the N Terminus of
Bamboo Mosaic Virus Replicase
Yi-Ija
Li,
Yi-Jun
Chen,
Yau-Heiu
Hsu, and
Menghsiao
Meng*
Graduate Institute of Agricultural
Biotechnology, National Chung Hsing University, Taichung, Taiwan
40227, Republic of China
Received 7 February 2000/Accepted 15 October 2000
 |
ABSTRACT |
Bamboo mosaic virus (BaMV), a member of the potexvirus group,
infects primarily members of the Bambusoideae. Open reading frame 1 (ORF1) of BaMV encodes a 155-kDa polypeptide that has long been
postulated to be a replicase involved in the replication and formation
of the cap structure at the 5' end of the viral genome. To identify and
characterize the enzymatic activities associated with the N-terminal
domain of the BaMV ORF1 protein, the intact replicase and two
C-terminally truncated proteins were expressed in Saccharomyces
cerevisiae. All three versions of BaMV ORF1 proteins could be
radiolabeled by [
-32P]GTP, which is a characteristic
of guanylyltransferase activity. The presence of
S-adenosylmethionine (AdoMet) was essential for this
enzymatic activity. Thin-layer chromatography analysis suggests that
the radiolabeled moiety linked to the N-terminal domain of the BaMV
ORF1 protein is m7GMP. The N-terminal domain also exhibited
methyltransferase activity that catalyzes the transfer of the
[3H]methyl group from AdoMet to GTP or
guanylylimidodiphosphate. Therefore, during cap structure formation in
BaMV, methylation of GTP may occur prior to transguanylation as for
alphaviruses and brome mosaic virus. This study establishes the
association of RNA capping activity with the N-terminal domain of the
replicase of potexviruses and further supports the idea that the
reaction sequence of RNA capping is conserved throughout the
alphavirus-like superfamily of RNA viruses.
 |
INTRODUCTION |
Bamboo mosaic virus (BaMV), a member
of potexvirus group, has a plus-strand RNA genome (~6.4 kb) with a 5'
m7G(5')ppp(5')G cap structure and a 3' poly(A) tail
(18). The 4.1-kb open reading frame 1 (ORF1) gene of BaMV
encodes a 155-kDa polypeptide (17). The presence of
conserved motifs such as GKS and GDD, signatures of helicase (6,
10) and polymerase (6, 13), respectively, led to
the prediction that the 155-kDa protein may have an RNA helicase
activity in the middle region and a polymerase activity in the
C-terminal domain. The RNA-dependent RNA polymerase activity of the
155-kDa viral protein was recently corroborated by showing that the
Escherichia coli-expressed viral protein was able to
synthesize complementary RNA molecules using 3' end fragments of either
the plus or minus strand of a BaMV RNA transcript as a template and
that this polymerase activity was abolished when the GDD motif was
deleted (16). The N-terminal region of the ORF1 product of
potexviruses also shows distant similarity to the putative Sindbis
virus-like methyltransferase (24), suggesting that the N
terminus of the BaMV 155-kDa protein may be responsible for the cap
formation at the 5' ends of genomic and subgenomic RNA transcripts.
Figure 1 shows the assumed domain
organization of the 155-kDa BaMV replicase and the conserved His, Asp,
and Arg residues found in the Sindbis virus-like methyltransferase.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Domain organization of the replicase (1,365 amino
acids) of BaMV. A highly hydrophilic region and a proline-rich stretch
are thought to divide the 155-kDa replicase into methyltransferase,
helicase, and RNA-dependent RNA polymerase (RdRp) domains. B1, B2 (908 amino acids), and B3 (442 amino acids) represent the intact BaMV
replicase and two C-terminally truncated proteins expressed in yeast in
this study. The conserved residues (His, Asp, Arg, and Tyr) of the
Sindbis virus-like methyltransferase found in the N terminus of the
BaMV replicase are indicated. (B) Alignment of partial sequences of the
N termini of BaMV replicase, 1a protein of brome mosaic virus (BMV),
and nsP1 proteins of Semliki Forest virus (SFV) and Sindbis virus
(SIV). Asterisks, conserved residues including His, Asp, and Arg. The
association of mRNA capping activities with nsP1 of Semliki Forest
virus and Sindbis virus and 1a of brome mosaic virus has been
established (2, 4, 12, 14, 19).
|
|
The 5'-terminal cap structure m7G(5')pppN is a
characteristic of eukaryotic mRNAs that is required for translation and
stability. The formation of the cap requires three consecutive
enzymatic activities according to the studies of capping reactions in
mammalian and Saccharomyces cerevisiae cells and several
viral systems. The proposed reaction scheme is summarized as the
following (21, 28):
|
(1)
|
|
(2)
|
(The reaction at step 2 can be divided further into two
half-reactions: enzyme +

p

p

pG

enzyme-

pG + ppi and enzyme

pG +
'p
'pN(pN)
n 
G

p
'p
'pN(pN)
n + enzyme.)
|
(3)
|
where AdoMet is
S-adenosylmethionine and AdoHcy is
S-adenosylhomocysteine. RNA 5'-triphosphatase removes the 5'

phosphate
of nascent mRNA (step 1), after which mRNA
guanylyltransferase
donates a GMP moiety, derived from GTP, to form a
5'-5' triphosphate
linkage, typical for a cap structure (step 2). In
the step 2 reaction,
the GMP moiety is linked first to the enzyme as a
covalently bound
intermediate (the first half-reaction) and then
transferred to
the 5' diphosphate terminus of the RNA molecule (the
second half-reaction).
Thereafter, the cap is methylated by AdoMet at
position 7 of the
terminal guanosine, yielding a cap 0 structure and
AdoHcy (step
3). A variety of RNA viruses have evolved diverse pathways
for
cap formation (
29). For example, GTP is methylated
before the
transguanylation reaction in alphaviruses (
1)
and brome mosaic
virus (
4,
12).
Because the capping of cellular mRNAs is a nuclear function, it is not
accessible to cytoplasmic viruses. Thus, BaMV, replicating in the
cytoplasm of host cells, should be equipped with its own mRNA capping
system. It was also interesting to know whether the capping activity of
BaMV has characteristics similar to those of alphaviruses and brome
mosaic virus since these viruses all belong to the large
alphavirus-like superfamily of RNA viruses. To test the hypothesis that
the N-terminal domain of the 155-kDa polypeptide harbors RNA capping
activity, the ORF1-encoded polypeptide was expressed, in different
lengths, in Saccharomyces cerevisiae and the activities
associated with the viral proteins were characterized. The results show
that the N-terminal domain of the 155-kDa viral protein indeed harbors
an AdoMet-dependent guanylyltransferase activity. The viral protein
forms a covalent complex with m7GMP as for alphaviruses and
brome mosaic virus. This discovery further supports the idea that the
order of the capping reaction is conserved among members of the
alphavirus-like superfamily, although there are limited sequence
similarities among them.
 |
MATERIALS AND METHODS |
Chemicals.
Nucleotides and nucleotide analogs such as GTP,
dGTP, GDP, GMP, m7GMP, and guanylylimidodiphosphate (GIDP)
were purchased from Sigma. AdoMet was from Boehringer Mannheim, and
32P-labeled nucleotides and
Ado[methyl-3H]Met were from NEN.
Plasmid construction.
Plasmid pYES2 (Invitrogen) was used to
carry the BaMV cDNAs for viral protein expression in S. cerevisiae INVSc1 (MAT
his3-
1 leu2 trp1-289
ura3-52). Primer pair
5'-CCCAAGCTTATGGCACTCGTTTCTAAAGTCTTTGAC and 5'-GCCAGATCTAGAGAGTAGGTCAGTTATCCG was
used to amplify the full-length cDNA of BaMV ORF1 (4,095 nucleotides
[nt]) in a 50-µl PCR mixture that contained 1 ng of pBL (carrying
the full-length cDNA of BaMV), 0.32 µM (each) primer, 0.2 mM (each)
deoxyribonucleotide, and 2.5 U of Pfu polymerase. Sequences
AAGCTT and TCTAGA
represent the engineered cutting sites of HindIII
and XbaI, respectively, and the sequences in italics are
within the coding region of BaMV ORF1. The PCR was carried out for 30 cycles (94°C for 45 s, 65°C for 45 s, 72°C for 8 min),
followed by a 10-min extension at 72°C. Another set of primers,
5'-CCCAAGCTTATGGCACTCGTTTCTAAAGTCTTTGAC and
5'-GCTCTAGAGCTCATTTGGGCTCCAAGGGTTCATC,
was used to amplify a 3'-end-deleted BaMV ORF1 (2,724 nt) that
encodes both the putative methyltransferase and helicase domains,
whereas
5'-CCCAAGCTTATGGCACTCGTTTCTAAAGTCTTTGAC and
5'-GCTCTAGAGCTCATTCGGTAGTTGCTGCGTCTGT
were used for the amplification of an even shorter 3'-end-deleted
fragment of ORF1 (1,326 nt) that encodes only the putative
methyltransferase domain under the PCR conditions described above. The
PCR-amplified cDNAs were then digested with HindIII and
XbaI, ligated with pYES2, and transformed into E. coli Top10F (Invitrogen) to obtain expression vector pYEB1 (containing a 4,095-nt cDNA), pYEB2 (containing a 2,724-nt cDNA), and
pYEB3 (containing a 1,326-nt cDNA). The expressed viral proteins encoded by plasmids pYEB1, pYEB2, and pYEB3 are abbreviated B1 (1,365 amino acids), B2 (908 amino acids), and B3 (442 amino acids), respectively (Fig. 1).
Plasmid pET29 (Novagen) was used for the expression of the N-terminal
domain of the BaMV ORF1 product in
E. coli. Primer pair
5'-GTGCGGCA
CATATGGCACTCGTTTCTAAAGTCTTTGAC
and
5'-CTTGCG
AAGCTTA
AGCCGCTTTGCATTCTGGT was used to amplify a 1,449-nt cDNA fragment containing the 5'
end of BaMV ORF1 in a PCR.
CATATG and
AAGCTT represent the engineered
cutting sites of
NdeI and
HindIII, respectively. The sequences
in italics are within the coding region of BaMV ORF1. The conditions
of
PCR were as described above. The endoribonuclease-digested
cDNA
fragment was inserted into pET29 and transformed into
E. coli BL21(DE3). This construct (pEBM2984) allows the production
of
the N-terminal portion (the first 483 amino acids) of the 155-kDa
protein in
E. coli cells.
Expression of recombinant viral proteins in yeast cells.
To
express the viral proteins in yeast cells, plasmids pYEB1, pYEB2, and
pYEB3 were transferred separately into S. cerevisiae cells
by electroporation (pulse controller; Bio-Rad) under conditions of 1.5 kV, 25 µF, and 200
. The transformed yeast cells were selected by
growing them in glucose-containing SC agar (2% glucose, 0.67% yeast
nitrogen base without amino acids, 0.2% Kiwibrew solution, 2% agar).
The absence of uracil in SC agar provides a selective pressure for the
cells carrying plasmid derivatives of pYES2. The acquisition of the
desired plasmid by yeast cells was confirmed by the amplification of
the respective cDNA fragment by PCR.
To induce the BaMV proteins in yeast, recombinant cells grown in 10 ml
of glucose-containing SC medium were pelleted down,
washed, and
resuspended in 10 ml of galactose-containing SC medium
(2% galactose).
The cultivation was continued for another 24 h
at 30°C. The
harvested pellets were suspended in 0.25 ml of ice-cold
protein extract
buffer (40 mM Tris [pH 8.0], 80 mM NaCl, 1.6 mM
EDTA, 4 mM
dithiothreitol [DTT], 4 mM EGTA, 4 mM phenylmethylsulfonyl
fluoride),
and disrupted at 4°C by vigorous mixing (10 times for
30 s each)
with 0.45 g of acid-treated glass beads (0.3 to 0.45
mm) in a
1.5-ml Eppendorff tube. The cell extract was then subjected
to
centrifugation at 18,000 ×
g for 10 min at 4°C. The
pellet
fraction (P18) was further fractionated by sucrose
discontinuous-gradient
centrifugation. A 2-ml sample, which contained
60% (wt/wt) sucrose,
was first overlaid on top of a 1.3-ml 67%
sucrose solution in
an SW41Ti (Beckman) ultracentrifuge tube. Then 7.1- (50%) and
1.6-ml (10%) sucrose solutions were laid onto the tube. All
sucrose
solutions contained 100 mM NaCl and 50 mM Tris (pH 7.5).
Centrifugation
(35,000 rpm) was carried out at 4°C for 20
h.
Preparation of antibodies against the N-terminal portion of the
BaMV ORF1 product.
The N-terminal domain of the 155-kDa viral
protein was produced by E. coli BL21(DE3) cells harboring
pEBM2984 under conditions described previously (16). The
insoluble E. coli-expressed truncated protein was thereafter
purified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE). The electroeluted protein from the corresponding protein
band was then injected into rabbits to raise antibodies. The antibodies
were purified by passing the rabbit serum through a DEAE Affi-Gel blue
gel column (Bio-Rad).
Immunoprecipitation and Western blotting.
For
immunoprecipitation, the SDS-denatured sample of the
guanylyltransferase assay was diluted 20-fold with TET buffer (1% Triton X-100, 50 mM Tris [pH 7.5], 150 mM NaCl, 5 mM EDTA) and then
mixed with antibodies conjugated to CNBr-activated Sephadex beads.
After 2 h of gentle mixing, the beads were washed six times with
TET buffer and subjected to SDS-PAGE analysis. The antibodies, which
are specific for the N terminus of the ORF1 product of BaMV, were also
used in Western blot analysis.
Activity assay.
The guanylyltransferase activity was
detected by the formation of 32P-labeled proteins after
incubation of proteins with [
-32P]GTP (9,
27). Unless otherwise stated, the standard reaction was carried
out at 30°C for 1 h in a 20-µl reaction buffer that contained
5 µl of enzyme preparation, 10 µCi of [
-32P]GTP
(3,000 Ci/mmol), 50 mM Tris (pH 7.5), 5 mM DTT, 2 mM MgCl2, 10 mM KCl, 1.2% n-octyl-
-D-glucopyranoside,
and 100 µM AdoMet. The reaction was stopped by adding SDS (final
concentration, 2%) and was followed by 3 min of boiling. The reaction
products were analyzed by SDS-PAGE and visualized by autoradiography or phosphorimager.
The methyltransferase activity was detected by the transfer of
[
3H]methyl from
Ado[
methyl-
3H]Met to a methyl acceptor
(
14). The reaction was carried out
at 30°C for 50 min in
a 25-µl solution that contained 50 mM Tris
(pH 7.5), 2 mM
MgCl
2, 2 mM DTT, 1.2%
n-octyl-

-
D-glucopyranoside,
10 µM AdoMet,
0.75 µCi of Ado[
methyl-
3H]Met (80 Ci/mmol),
10 µl of enzyme solution, and 10 mM methyl
acceptor. At the end of
the reaction, 1 ml of 10 mM ammonium acetate
(pH 8.5) was added, and
the reaction products were adsorbed to
1 ml DEAE-Sephadex in a Pasteur
pipette, washed with the same
buffer containing 100 mM NaCl, and then
eluted with the same buffer
containing 500 mM NaCl. The incorporated
3H on the methyl acceptor was measured by liquid
scintillation.
The covalent linkage of [
3H]methyl to BaMV protein was
performed at 30°C for 20 min in a 30-µl solution that contained 50 mM
Tris (pH 7.5), 10 mM KCl, 2 mM MgCl
2, 5 mM DTT, 1.2%
n-octyl-

-
D-glucopyranoside,
5 µCi of
Ado[
methyl-
3H]Met (80 Ci/mmol), and 10 µl of enzyme solution. To determine
the effect of GTP on methylation
of proteins, 100 µM GTP was included
in the reaction mixture. The
reaction was stopped by adding SDS
to a final concentration of 2% and
was followed by boiling for
3 min. The sample was analyzed by SDS-PAGE
in a 10% polyacrylamide
gel, and products were visualized by
fluorography.
Thin-layer chromatography (TLC) analysis of guanylate
moiety.
The reaction products of the guanylyltransferase assay
were separated by SDS-PAGE, and the 32P-labeled proteins
were eluted from the gel and concentrated. The protein samples were
then incubated at 65°C for 10 min with 0.5 N HCl or 0.5 N NaOH or
incubated at 37°C for 20 min with 3.8 M acidic hydroxylamine (pH 4.3)
as described by Jose et al. (9). The treated samples were
then spotted on a polyethylenimine cellulose plate, developed with
formic acid buffer (0.5 M formic acid, 0.5 M LiCl2), and
visualized by autoradiography.
 |
RESULTS |
Viral protein expression in yeast cells.
In order to study the
inherent activities associated with the N-terminal region of the BaMV
155-kDa protein, we constructed three yeast-expression vectors in this
study. Plasmid pYEB1 encodes the entire 155-kDa replicase (B1), while
pYEB2 and pYEB3 encode C-terminally truncated proteins with deduced
sizes of 100 (B2) and 50 kDa (B3), respectively. The positions of
truncation were based on the assumption that the long hydrophilic
stretch between amino acids 406 and 520 and the proline-rich segment
from amino acid 895 to 910 may represent the borders of functional
domains. The expression of B1, B2, and B3 proteins in yeast was
determined by Western blotting analysis (Fig.
2). After centrifugation of cell extracts
at 18,000 × g, B1 and B2 were found in both soluble (S18) and insoluble (P18) fractions, while B3, the putative
methyltransferase domain, was present mostly in the P18 fraction.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 2.
Expression of the BaMV replicase (B1) and two
C-terminally truncated proteins (B2 and B3) in S. cerevisiae. Yeast cells harboring the desired plasmid were
disrupted, and the supernatant (S18) and pellet (P18) after
centrifugation at 18,000 × g were analyzed by
SDS-10% PAGE. The BaMV proteins were detected by rabbit antibodies
directed against the N-terminal portion of BaMV replicase. S2,
extracted proteins from yeast cells harboring plasmid pYES2
(Invitrogen).
|
|
Detection of guanylyltransferase activity.
The formation of
the covalently bound GMP-enzyme complex was used as an index for
guanylyltransferase activity. In the initial trial we incubated protein
samples with [
-32P]GTP with or without AdoMet and
analyzed the reaction products by denaturing SDS-PAGE. The results
indicate that B1, B2, and B3 proteins from the pellet fraction (P18)
formed covalently bound complexes with [32P]GMP (Fig.
3). The proteins from the supernatant
fraction (S18), however, did not show the corresponding bands (data not
shown). The complex formed only when AdoMet was included in the
reaction buffer. The band that migrated slightly above the B3 protein
and that appeared in every sample including S2 (the yeast background control) was suspected to be the cellular mRNA guanylyltransferase of
yeast (53 kDa) according to its apparent molecular mass
(26). The labeling reaction of the yeast cellular mRNA
guanylyltransferase does not require AdoMet. Therefore, the AdoMet
dependence of activity distinguishes BaMV guanylyltransferase from the
yeast counterpart. In order to alleviate the interference of the yeast
enzyme in the activity assay, we further purified the BaMV protein in
the P18 fraction with a discontinuous sucrose gradient. Western
blotting analysis of the fractionated samples (B3 in this case) showed that a portion of the viral protein floated to the interface between the 10 and 50% sucrose solution (Fig.
4), suggesting that this part of the
viral protein is membrane associated. Similar to the B3 protein, the B1
and B2 proteins could also be found in the membrane fraction (Fig.
5A). All three membrane-associated viral proteins exhibited guanylyltransferase activity only in the presence of
AdoMet, and obviously B3 had stronger activity than B2 and B1 (Fig.
5B). The result also shows that the background activity caused by the
yeast protein was alleviated, so the membrane fraction was used in a
subsequent guanylyltransferase assay. To confirm the
32P-labeled protein as a BaMV protein, the reaction
products of the guanylyltransferase assay were immunoprecipitated using
antibodies against the N-terminal portion of the BaMV replicase and
then the labeling of B2 and B3 by [
-32P]GTP was
examined by SDS-PAGE analysis (Fig. 6).
The requirement of AdoMet to form the covalent 32P-labeled
proteins was observed again. No yeast cellular capping enzyme was found
after immunoprecipitation. The aforementioned data show that the
N-terminal portion of the BaMV replicase indeed harbors a
guanylyltransferase activity and that the presence of AdoMet is crucial
for this activity.

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 3.
AdoMet-dependent guanylyltransferase activity. The
yeast-expressed BaMV proteins from the pellet fraction (P18) were
incubated with [ -32P]GTP under the conditions
described in Materials and Methods and analyzed by SDS-PAGE. The viral
proteins (B1, B2, and B3) were radiolabeled only when AdoMet (100 µM)
was included in the reaction buffer (arrows). The band immediately
above B3 and shown in every lane probably represents the yeast cellular
mRNA guanylyltransferase (53 kDa). S2, proteins from the P18 fraction
of yeast cells harboring plasmid pYES2.
|
|

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 4.
Partition of B3 protein in a discontinuous sucrose
gradient. The truncated protein (B3) from the P18 fraction was loaded
onto a discontinuous sucrose gradient and subjected to
ultracentrifugation as described in Materials and Methods. After
centrifugation, the samples from the membrane fraction (interface
between 10 and 50% sucrose), intermediate fraction (50% sucrose),
sample loading layer (60% sucrose), and pellet fraction (bottom of
tube) were collected and analyzed by Western blotting.
|
|

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 5.
(A) Western blotting analysis of the viral proteins (B1,
B2, and B3) in the membrane fraction. The yeast membrane fraction
containing each viral protein was obtained from the discontinuous
sucrose gradient and was analyzed with rabbit antiserum directed
against the N-terminal portion of the BaMV replicase. (B)
Guanylyltransferase assay of the membrane-associated viral proteins.
The assay buffer was as described in Materials and Methods and included
100 µM AdoMet and 5 µl of enzyme solution. The intensity of each
viral protein in the Western blotting analysis (A) suggests that
approximately equal amounts of viral protein were used in each assay.
S2, proteins from the P18 fraction of yeast cells the harboring plasmid
pYES2.
|
|

View larger version (69K):
[in this window]
[in a new window]
|
FIG. 6.
Immunoprecipitation of the 32P-labeled B2
and B3 proteins. The B2 or B3 protein from the membrane fraction was
incubated with [ -32P]GTP in the presence or absence of
AdoMet (100 µM). The reaction mixtures were then incubated with
antiserum against the N-terminal portion of the BaMV replicase, and the
precipitated samples were analyzed by SDS-PAGE and autoradiography. S2,
proteins from the membrane fraction of yeast cells harboring plasmid
pYES2.
|
|
Characteristics of BaMV guanylyltransferase activity.
Other
nucleoside triphosphates including [
-32P]ATP,
[
-32P]UTP, and [
-32P]CTP were used to
verify the nucleotide selection in the guanylyltransferase assay. The
results showed that both B2 and B3 were labeled by [
-32P]GTP but not by either
[
-32P]ATP, [
-32P]UTP, or
[
-32P]CTP (Fig. 7). The
time course of the 32P labeling of the viral proteins
showed that the extent of labeling increased with the incubation time
and reached a plateau after 30 min (data not shown). The activity was
also dependent on the concentration of AdoMet; the more AdoMet, the
stronger was the activity (data not shown). EDTA (5 mM) abolished the
activity, suggesting that Mg2+ is crucial. AdoHcy (100 µM) or pyrophosphate (5 mM) was also included in the reaction buffer
to determine the effects on the product. The result showed that AdoHcy
was unable to stimulate the activity and, in fact, that it had a
slightly inhibitory effect against the function of AdoMet. On the other
hand, pyrophosphate (5 mM) annihilated transguanylation completely
(data not shown). This suggests strong binding of pyrophosphate to the
enzyme, and the loss of activity may be caused by the competition
between pyrophosphate and GTP binding.

View larger version (72K):
[in this window]
[in a new window]
|
FIG. 7.
Nucleotide selection of the BaMV guanylyltransferase
activity. The B2 or B3 protein from the membrane fraction was incubated
with [ -32P]GTP, [ -32P]ATP,
[ -32P]UTP, or [ -32P]CTP under
standard reaction conditions as described in Materials and Methods. The
reaction products were analyzed by SDS-PAGE and autoradiography. S2,
proteins from the membrane fraction of yeast cells harboring plasmid
pYES2.
|
|
TLC analysis of the guanylate moiety.
The AdoMet dependence of
guanylyltransferase activity could have different implications. AdoMet
could act as an effector that induces protein conformational changes
and stimulates transguanylation. Alternatively, GTP could be methylated
first by AdoMet and subsequently transferred as an m7GMP
moiety onto the active site of the enzyme as for alphaviruses and brome
mosaic virus. Two approaches were employed to clarify this uncertainty.
In the first attempt, we looked into whether the methyl group from
AdoMet would covalently link to the BaMV protein by incubating the B3
protein with Ado[methyl-3H]Met in the presence
or absence of GTP. The results showed that the B3 protein was actually
labeled by 3H and that this reaction occurred only when GTP
was present (Fig. 8). The second attempt
was to identify the guanylate moiety released from the
32P-labeled BaMV protein. The 32P-labeled B3
was isolated by SDS-PAGE and concentrated by ultracentrifugation. The
protein was then treated with HCl, hydroxylamine, or NaOH, and the
products were separated by TLC. The linkage of the
32P-labeled moiety to B3 was susceptible to acidic
conditions but resistant to alkaline conditions, indicating a
phosphoamide type of chemical bonding between the guanylate moiety and
the protein (Fig. 9). The migration of
the acid-released 32P-labeled moiety suggests that the
guanylate moiety is identical to the standard m7GMP. It
should be noted that the slightly higher mobility of m7GMP
in HCl than in acidic hydroxylamine was also found in the standards.
Taken together, the above data suggest that GTP is first methylated by
the methyl donor, AdoMet, and then covalently linked to an active-site
residue of the BaMV capping enzyme through a phosphoamide bond. The
active-site residue therefore most probably is lysine, histidine, or
arginine. In the subsequent reaction, the m7GMP is
transferred to the 5'-diphosphate terminus of the RNA to complete the
capping process.

View larger version (71K):
[in this window]
[in a new window]
|
FIG. 8.
Methylation of B3 protein by
Ado[methyl-3H]Met. The B3 protein from the
membrane fraction was incubated with
Ado[methyl-3H]Met in the presence or absence
of 100 µM GTP as described in Materials and Methods. The reaction
products were then analyzed by SDS-PAGE and fluorography. S2, proteins
from the membrane fraction of yeast cells harboring plasmid pYES2.
|
|

View larger version (96K):
[in this window]
[in a new window]
|
FIG. 9.
TLC analysis of the guanylate moiety released from the
32P-labeled B3 protein. The 32P-labeled B3
protein was treated with either HCl, NaOH, or acidic hydroxylamine, and
the treated samples were then analyzed by TLC and detected by
autoradiography as described in Materials and Methods. The standards
GTP, GDP, GMP, m7GMP (in hydroxylamine), and
m7GMP (in HCl) were run along with the analyzed products on
a same TLC sheet and visualized by UV illumination (spots A to E,
respectively).
|
|
Detection of methyltransferase activity.
The methylation of B3
by Ado[methyl-3H]Met and the identification of
m7GMP linked to B3 point to the existence of a
methyltransferase activity on B3. To verify this possibility, B3 was
incubated with Ado[methyl-3H]Met along with
several potential methyl acceptors. The potential acceptors were then
recovered with DEAE-Sephadex, and the labeling of 3H on the
acceptors was counted by liquid scintillation. The average results of three independent experiments are shown in Fig.
10. Although the incorporation of
3H was low, GTP could be methylated by
Ado[methyl-3H]Met in a statistically
significant way. GIDP, a nonhydrolyzable analog of GTP, was a better
acceptor than GTP by a factor of approximately fourfold under the
reaction conditions described in Materials and Methods. The methylation
of GMP, m7GMP, and dGTP was insignificant.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 10.
Methyltransferase activity of the B3 protein. Various
potential methyl acceptors (10 mM) were incubated with B3 protein and
Ado[methyl-3H]Met. The methylated acceptor was
recovered by a DEAE-Sephadex column and counted by liquid
scintillation. CL, acceptor was omitted from the reaction mixture; S2,
proteins from the membrane fraction of yeast cells harboring plasmid
pYES2. The results are averages from three independent experiments.
|
|
 |
DISCUSSION |
ORF1 of potexviruses encodes a polypeptide whose size is larger
than 150 kDa. This viral protein has long been proposed to be a
replicase with polymerase activity residing at the C terminus and
methyltransferase activity residing at the N terminus. The association
of RNA-dependent RNA polymerase activity with the C-terminal domain has
been demonstrated previously (16). In this study, the
full-length 155-kDa protein of BaMV and two C-terminally truncated
proteins were expressed in S. cerevisiae. The activity assay
and immunoprecipitation indicate that both the full-length and the
truncated viral proteins have guanylyltransferase activity. The
methyltransferase assay also showed that the N-terminal portion has
methyltransferase activity that catalyzes the transfer of a methyl
group from AdoMet to GTP or GIDP. Therefore, our present study proves
that the N terminus of the 155-kDa protein, from amino acid 1 to 442, harbors both guanylyltransferase and methyltransferase activities.
Among the three recombinant proteins, B3 showed the strongest
guanylyltransferase activity (Fig. 5). It is possible that the helicase
domains in B2 and B1 hydrolyze GTP and, consequently, reduce the
activity of transguanylation. The N-terminal portion of the BaMV
replicase was also expressed in E. coli cells with and
without an S tag, a 15-amino-acid peptide specifically interacting with
S protein derived from pancreatic RNase A, fused at the N terminus. No
activity was found in either of the E. coli-expressed proteins (data not shown). A problem of viral protein folding in
E. coli or interference caused by the S tag might be the
cause for enzyme inactivity.
Most replicase activities of the alphavirus-like superfamily, including
alphaviruses and various plant viruses, were isolated from membrane
fractions (11, 15, 23, 25). For Semliki Forest virus,
membrane attachment has been demonstrated to be through the interaction
of nsP1 (3). Moreover, the capping activity of nsP1
requires the association with anionic membrane phospholipids. The
RNA-dependent RNA polymerase activity capable of synthesizing the BaMV
genomic and subgenomic RNA transcripts was also identified in the
membrane fraction from the BaMV-infected plant cell extract (C. H. Tsai, unpublished data). The B3 protein expressed in yeast was found
mainly in the P18 fraction, whereas B1 and B2 were found in both the
P18 and S18 fractions. Fractionation of viral proteins by sucrose
discontinuous-gradient centrifugation supports the association of B3
protein with the membrane. Similar to what was found for nsP1 of
Semliki Forest virus, membrane association could be crucial for BaMV
capping activity since activities were found in the P18 fractions but
not in the S18 fractions. BaMV capping activity may require a membrane
environment to resume a correct protein conformation or orientation.
The competition of yeast proteins in S18 for the utilization of GTP and
AdoMet should offer another explanation. BaMV proteins need to be
purified from the S18 fraction to further address the necessity of
membrane association for transguanylation activity.
In general, the capping reaction at the 5' end of eukaryotic mRNA is
accomplished by three consecutive enzymatic reactions. They involve RNA
triphosphatase, mRNA guanylyltransferase, and RNA (guanine-7-)
methyltransferase. The order of these three catalytic reactions in
alphaviruses and brome mosaic virus varies in that methylation of GTP
occurs prior to transguanylation (1, 4, 12). It was
therefore interesting to know whether potexviruses have similar
characteristics with respect to the capping reactions. In the present
study, we found that the guanylyltransferase activity of BaMV is AdoMet
dependent and that m7GMP is the moiety linked to the
enzyme. The evidence provided in this study supports the conservation
of the capping reaction throughout members within the alphavirus-like
superfamily regardless of sequence dissimilarity among these capping
enzymes. The N terminus of the BaMV replicase also exhibited
methyltransferase activity. GIDP is a better methyl acceptor than GTP,
and the preference was also found in nsP1 of Sindbis virus
(20). For the 1a protein of brome mosaic virus, the
formation of the adduct of m7GMP and 1a protein inhibited
its own methyltransferase activity (4). It is possible
that a similar phenomenon occurred in the BaMV capping enzyme when GTP
was used as the methyl acceptor. GIDP is nonhydrolyzable; therefore it
cannot link covalently to the B3 protein, and this may presumably
render GIDP a better methyl acceptor. dGTP, a very good methyl acceptor
in the case of the 1a protein, was a poor acceptor in this study.
Despite the conservation of the main characteristics of the capping
reaction, other subtle properties such as substrate specificity may
differ between members of the alphavirus-like superfamily. Indeed, the
overall sequence similarity between the first 450 amino acids of the
BaMV replicase and the first half of 1a of brome mosaic virus is no
more than 10% based on the Clustal method.
Notwithstanding these distant relationships, several amino acid
residues were found to be conservative among the capping enzymes of
members within the alphavirus-like superfamily (24). The alignment of partial amino acid sequences of the capping enzymes from
alphaviruses, brome mosaic virus, and BaMV is shown in Fig. 1. The
importance of the conserved His residue for guanylyltransferase activity has been established by mutation analyses for Sindbis virus
(30), Semliki Forest virus (2), and brome
mosaic virus (4). In contrast, its role in
methyltransferase activity is controversial in that the activity
decreased in Sindbis virus and brome mosaic virus, but actually
increased in Semliki Forest virus, when the His residue was mutated.
Mutation of the conserved Arg residue resulted in loss of
methyltransferase activity and viral infectivity in Sindbis virus
(30) and concomitant loss of guanylyltransferase and
methyltransferase activities in Semliki Forest virus (2)
and brome mosaic virus (4). Despite the above efforts, the
in-depth function of these conserved residues remains obscure and
requires extensive study. For the capping enzyme of yeast
(5) and some well-studied viruses such as vaccinia virus
(22) and Chlorella virus (7, 8),
the GMP moiety is attached to the enzyme via a lysine residue within a
conserved active site motif (KXDG). No such conserved motif was found
in the capping enzymes in the alphavirus-like superfamily. Based on a
mutational result, Ahola and Ahlquist inferred that the conserved His
residue links to m7GMP (4). Further physical
evidence such as peptide mapping and X-ray structure certainly would
help to resolve these uncertainties.
 |
ACKNOWLEDGMENTS |
Y.-I.L. and Y.-J.C. contributed equally to this work.
This work was supported by grants NSC 87-2311-B-005-001-B11 and NSC
88-2311-B-005-001-B11 from the National Science Council, Republic of China.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Graduate
Institute of Agricultural Biotechnology, National Chung Hsing
University, 250 Kuo-Kuang Rd., Taichung, Taiwan 40227, Republic of
China. Phone: 886-4-2840328. Fax: 886-4-2853527. E-mail:
mhmeng{at}dragon.nchu.edu.tw.
 |
REFERENCES |
| 1.
|
Ahola, T., and L. Kääriäinen.
1995.
Reaction in alphavirus mRNA capping: formation of a covalent complex of nonstructural protein nsP1 with 7-methyl-GMP.
Proc. Natl. Acad. Sci. USA
92:507-511[Abstract/Free Full Text].
|
| 2.
|
Ahola, T.,
P. Laakkonen,
H. Vihinen, and L. Kääriäinen.
1997.
Critical residues of Semliki Forest virus RNA capping enzyme involved in methyltransferase and guanylyltransferase-like activities.
J. Virol.
71:392-397[Abstract].
|
| 3.
|
Ahola, T.,
A. Lampio,
P. Auvinen, and L. Kääriäinen.
1999.
Semliki Forest virus mRNA capping enzyme requires association with anionic membrane phospholipids for activity.
EMBO J.
18:3164-3172[CrossRef][Medline].
|
| 4.
|
Ahola, T., and P. Ahlquist.
1999.
Putative RNA capping activities encoded by brome mosaic virus: methylation and covalent binding of guanylate by replicase protein 1a.
J. Virol.
73:10061-10069[Abstract/Free Full Text].
|
| 5.
|
Fresco, L. D., and S. Buratowski.
1994.
Active site of the mRNA-capping enzyme guanylyltransferase from Saccharomyces cerevisiae: similarity to the nucleotidyl attachment motif of DNA and RNA ligases.
Proc. Natl. Acad. Sci. USA
91:6624-6628[Abstract/Free Full Text].
|
| 6.
|
Habili, N., and R. H. Symons.
1989.
Evolutionary relationship between luteoviruses and other RNA plant viruses based on sequence motifs in their putative RNA polymerase and nucleic acid helicase.
Nucleic Acids Res.
17:9543-9555[Abstract/Free Full Text].
|
| 7.
|
Håkansson, K.,
A. J. Doherty,
S. Shuman, and D. B. Wigley.
1997.
X-ray crystallography reveals a large conformational change during guanyl transfer by mRNA capping enzymes.
Cell
89:545-553[CrossRef][Medline].
|
| 8.
|
Ho, C. K.,
J. L. Van Etten, and S. Shuman.
1996.
Expression and characterization of an RNA capping enzyme encoded by Chlorella virus PBCV-1.
J. Virol.
70:6658-6664[Abstract/Free Full Text].
|
| 9.
|
Jose, M.-C.,
G. Sutton,
N. Ramadevi, and P. Roy.
1998.
Guanylyltransferase and RNA 5'-triphosphatase activities of the purified expressed VP4 protein of blue tongue virus.
J. Mol. Biol.
280:859-866[CrossRef][Medline].
|
| 10.
|
Kadaré, G., and A.-L. Haenni.
1997.
Virus-encoded RNA helicases.
J. Virol.
71:2583-2590[Medline].
|
| 11.
|
Kao, C. C., and J.-H. Sun.
1996.
Initiation of minus-strand RNA synthesis by the brome mosaic virus RNA-dependent RNA polymerase: use of oligoribonucleotide primers.
J. Virol.
70:6826-6830[Abstract/Free Full Text].
|
| 12.
|
Kong, F.,
K. Sivakumaran, and C. Kao.
1999.
The N-terminal half of the brome mosaic virus 1a protein has RNA capping-associated activities: specificity for GTP and S-adenosylmethionine.
Virology
259:200-210[CrossRef][Medline].
|
| 13.
|
Koonin, E. V., and V. V. Dolja.
1993.
Evolution and taxonomy of positive-strand RNA viruses: implication of comparative analysis of amino acid sequence.
Biochem. Mol. Biol.
28:375-430.
|
| 14.
|
Laakkonen, P.,
M. Hyvönen,
J. Peränen, and L. Kääriäinen.
1994.
Expression of Semliki Forest virus nsP1-specific methyltransferase in insect cells and in Escherichia coli.
J. Virol.
68:7418-7425[Abstract/Free Full Text].
|
| 15.
|
Laakkonen, P.,
T. Ahola, and L. Kääriäinen.
1996.
The effects of palmitoylation on membrane association of Semliki Forest virus RNA capping enzyme.
J. Biol. Chem.
271:28567-28571[Abstract/Free Full Text].
|
| 16.
|
Li, Y.-I.,
Y.-E. Cheng,
Y.-L. Huang,
C.-H. Tsai,
Y.-H. Hsu, and M. Meng.
1998.
Identification and characterization of the Escherichia coli-expressed RNA-dependent RNA polymerase of bamboo mosaic virus.
J. Virol.
72:10093-10099[Abstract/Free Full Text].
|
| 17.
|
Lin, N.-S.,
F.-Z. Lin,
T.-Y. Huang, and Y.-H. Hsu.
1992.
Genome properties of bamboo mosaic virus.
Phytopathology
82:731-734.
|
| 18.
|
Lin, N.-S.,
B.-Y. Lin,
N.-W. Lo,
C.-C. Hu,
T.-Y. Chow, and Y.-H. Hsu.
1994.
Nucleotide sequence of the genomic RNA of bamboo mosaic potexvirus.
J. Gen. Virol.
75:2513-2518[Abstract/Free Full Text].
|
| 19.
|
Mi, S.,
R. Durbin,
H. V. Huang,
C. M. Rice, and V. Stollar.
1989.
Association of the Sindbis virus RNA methyltransferase activity with the nonstructural protein nsP1.
Virology
170:385-391[CrossRef][Medline].
|
| 20.
|
Mi, S., and V. Stollar.
1991.
Expression of Sindbis virus nsP1 and methyltransferase activity in Escherichia coli.
Virology
184:423-427[CrossRef][Medline].
|
| 21.
|
Mizumoto, K., and Y. Kaziro.
1987.
Messenger RNA capping enzymes from eukaryotic cells.
Prog. Nucleic Acid Res. Mol. Biol.
34:1-28[Medline].
|
| 22.
|
Niles, E. G., and L. A. Christen.
1993.
Identification of the vaccinia virus mRNA guanylyltransferase active site lysine.
J. Biol. Chem.
268:24986-24989[Abstract/Free Full Text].
|
| 23.
|
Osman, T. A. M., and K. W. Buck.
1996.
Complete replication in vitro of tobacco mosaic virus RNA by a template-dependent, membrane-bound RNA polymerase.
J. Virol.
70:6227-6234[Abstract].
|
| 24.
|
Rozanov, M. N.,
E. V. Koonin, and A. E. Gorbalenya.
1992.
Conservation of the putative methyltransferase domain: a hallmark of the `Sindbis-like' supergroup of positive-strand RNA viruses.
J. Gen. Virol.
73:2129-2134[Abstract/Free Full Text].
|
| 25.
|
Russo, P.,
P. Laakkonen,
T. Ahola, and L. Kääriäinen.
1996.
Synthesis of Semliki Forest virus RNA polymerase components nsP1 through nsP4 in Saccharomyces cerevisiae by expression of cDNA encoding the nonstructural polyprotein.
J. Virol.
70:4086-4089[Abstract].
|
| 26.
|
Shibagaki, Y.,
N. Itoh,
H. Yamada,
S. Hagata, and K. Mizumoto.
1992.
mRNA capping enzyme: isolation and characterization of the gene encoding mRNA guanylyltransferase subunit from Saccharomyces cerevisiae.
J. Biol. Chem.
267:9521-9528[Abstract/Free Full Text].
|
| 27.
|
Shuman, S.
1990.
Catalytic activity of vaccinia mRNA capping enzyme subunits coexpressed in Escherichia coli.
J. Biol. Chem.
265:11960-11966[Abstract/Free Full Text].
|
| 28.
|
Shuman, S.
1995.
Capping enzyme in eukaryotic mRNA synthesis.
Prog. Nucleic Acid Res. Mol. Biol.
50:101-129[Medline].
|
| 29.
|
Shuman, S., and B. Schwer.
1995.
RNA capping enzyme and DNA ligase: a superfamily of covalent nucleotidyltransferase.
Mol. Microbiol.
17:405-410[Medline].
|
| 30.
|
Wang, H.-L.,
J. O'Rear, and V. Stollar.
1996.
Mutagenesis of the Sindbis virus nsP1 protein: effects on methyltransferase activity and viral infectivity.
Virology
217:527-531[CrossRef][Medline].
|
Journal of Virology, January 2001, p. 782-788, Vol. 75, No. 2
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.2.782-788.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Draghici, H.-K., Varrelmann, M.
(2009). Evidence that the Linker between the Methyltransferase and Helicase Domains of Potato Virus X Replicase Is Involved in Homologous RNA Recombination. J. Virol.
83: 7761-7769
[Abstract]
[Full Text]
-
Cheng, C.-W., Hsiao, Y.-Y., Wu, H.-C., Chuang, C.-M., Chen, J.-S., Tsai, C.-H., Hsu, Y.-H., Wu, Y.-C., Lee, C.-C., Meng, M.
(2009). Suppression of Bamboo Mosaic Virus Accumulation by a Putative Methyltransferase in Nicotiana benthamiana. J. Virol.
83: 5796-5805
[Abstract]
[Full Text]
-
Lin, J.-W., Ding, M.-P., Hsu, Y.-H., Tsai, C.-H.
(2007). Chloroplast phosphoglycerate kinase, a gluconeogenetic enzyme, is required for efficient accumulation of Bamboo mosaic virus. Nucleic Acids Res
35: 424-432
[Abstract]
[Full Text]
-
Chen, I-H., Chou, W.-J., Lee, P.-Y., Hsu, Y.-H., Tsai, C.-H.
(2005). The AAUAAA Motif of Bamboo Mosaic Virus RNA Is Involved in Minus-Strand RNA Synthesis and Plus-Strand RNA Polyadenylation. J. Virol.
79: 14555-14561
[Abstract]
[Full Text]
-
Lin, J.-W., Chiu, H.-N., Chen, I-H., Chen, T.-C., Hsu, Y.-H., Tsai, C.-H.
(2005). Structural and Functional Analysis of the cis-Acting Elements Required for Plus-Strand RNA Synthesis of Bamboo Mosaic Virus. J. Virol.
79: 9046-9053
[Abstract]
[Full Text]
-
Huang, Y.-L., Hsu, Y.-H., Han, Y.-T., Meng, M.
(2005). mRNA Guanylation Catalyzed by the S-Adenosylmethionine-dependent Guanylyltransferase of Bamboo Mosaic Virus. J. Biol. Chem.
280: 13153-13162
[Abstract]
[Full Text]
-
Huang, Y.-L., Han, Y.-T., Chang, Y.-T., Hsu, Y.-H., Meng, M.
(2004). Critical Residues for GTP Methylation and Formation of the Covalent m7GMP-Enzyme Intermediate in the Capping Enzyme Domain of Bamboo Mosaic Virus. J. Virol.
78: 1271-1280
[Abstract]
[Full Text]
-
Vlot, A. C., Menard, A., Bol, J. F.
(2002). Role of the Alfalfa Mosaic Virus Methyltransferase-Like Domain in Negative-Strand RNA Synthesis. J. Virol.
76: 11321-11328
[Abstract]
[Full Text]
-
Li, Y.-I., Shih, T.-W., Hsu, Y.-H., Han, Y.-T., Huang, Y.-L., Meng, M.
(2001). The Helicase-Like Domain of Plant Potexvirus Replicase Participates in Formation of RNA 5' Cap Structure by Exhibiting RNA 5'-Triphosphatase Activity. J. Virol.
75: 12114-12120
[Abstract]
[Full Text]
-
Johnson, K. N., Johnson, K. L., Dasgupta, R., Gratsch, T., Ball, L. A.
(2001). Comparisons among the larger genome segments of six nodaviruses and their encoded RNA replicases. J. Gen. Virol.
82: 1855-1866
[Abstract]
[Full Text]
-
Magden, J., Takeda, N., Li, T., Auvinen, P., Ahola, T., Miyamura, T., Merits, A., Kaariainen, L.
(2001). Virus-Specific mRNA Capping Enzyme Encoded by Hepatitis E Virus. J. Virol.
75: 6249-6255
[Abstract]
[Full Text]