Previous Article | Next Article 
Journal of Virology, January 2001, p. 661-671, Vol. 75, No. 2
Department of Immunology, The Scripps
Research Institute, La Jolla, California 92037,1
and Département de Biochimie Médicale, Centre
Medical Universitaire, Geneva 1228, Switzerland2
Received 16 August 2000/Accepted 25 October 2000
N-terminal modifications of the chemokine RANTES bind to C-C
chemokine receptor 5 (CCR5) and block human immunodeficiency virus type
1 (HIV-1) infection with greater efficacy than native RANTES. Modified
RANTES compounds induce rapid CCR5 internalization and much slower
receptor reexpression than native RANTES, suggesting that receptor
sequestration is one mode of anti-HIV activity. The rates of CCR5
internalization and reexpression were compared using the potent
n-nonanoyl (NNY)-RANTES derivative and CD4+ T
cells derived from donors with different CCR5 gene polymorphisms. NNY-RANTES caused even more rapid receptor internalization and slower
reexpression than aminooxypentane (AOP)-RANTES. Polymorphisms in the
promoter and coding regions of CCR5 significantly affected the receptor
reexpression rate after exposure of cells to NNY-RANTES. These
observations may be relevant for understanding the protective effects
of different CCR5 genotypes against HIV-1 disease progression.
C-C chemokine receptor 5 (CCR5)
binds the chemokines MIP-1 Donor genotyping.
Anonymous DNA samples from adult donors
participating in the volunteer blood donor pool of The Scripps Research
Institute General Clinical Research Center were amplified with PCR
primers flanking CCR5 promoter polymorphisms or the 32-bp deletion in exon 4. The V64I allelic variant in CCR2 was detected by restriction fragment length polymorphism by a modification of the procedure described previously (37). The 3' primer for amplification
of the polymorphic region of CCR2 was replaced with the antisense primer 5' ATGAGAGGGTAACACCCGAG 3'. The 129-bp product was
subsequently digested as described elsewhere (37). Single
nucleotide polymorphisms were detected by automated sequencing of the
PCR products (5 to 10 clones per donor). A subset of donors were typed
for the G/A polymorphism at position Cell isolation and separation.
Peripheral blood mononuclear
cells were separated from whole blood from coded, genotyped donors by
Ficoll-Hypaque density sedimentation. Purified CD4+ T cells
were separated from other mononuclear cells by depletion of
CD8+, CD14+, CD16+, and
CD19+ cells by antibody treatment and magnetic bead
separation. The purified CD4+ T cells were activated by 3 days of exposure to phytohemagglutinin (PHA-P; 2 µg/ml; Boehringer
Mannheim) followed by the addition of 20 U of recombinant human
interleukin-2. Activated CD4+ T cells were used for CCR5
modulation experiments after 10 to 14 days of activation, a time chosen
to maximize baseline CCR5 expression (6, 66).
Analysis of CCR5 expression.
Surface-exposed CCR5 was
identified with the anti-CCR5 antibody PA12 (42), kindly
provided by Progenics Pharmaceuticals, Inc. (Tarrytown, N.Y.). Staining
of CCR5 by PA12 is not affected by binding of RANTES (42).
Preliminary experiments confirmed that PA12 staining was not inhibited
by prior incubation of CD4+ T cells with NNY-RANTES at
4°C, but that staining with the anti-CCR5 antibody 2D7
(66) was inhibited. All staining of cells was performed at
4°C in the presence of 0.02% sodium azide to prevent further internalization of CCR5. Binding of PA12 antibody was detected with
phycoerythrin-conjugated donkey anti-mouse immunoglobulin G (Jackson
ImmunoResearch). The number of stained cells and the intensity of
staining were evaluated by flow cytometry using a FACScalibur
instrument and CellQuest software (Becton Dickinson Immunocytometry
Systems, Mountain View, Calif.). The collected data (usually 10,000 events) were gated by forward and right angle light scatter to
distinguish small cells from lymphoblasts. Under the culture conditions
used, 85 to 90% of the CD4+ T cells were small and 5 to
10% were lymphoblasts. Unless otherwise indicated, results are
presented for the predominant small cell population.
CCR5 recycling rates.
The rate of CCR5 internalization
following addition of ligands was calculated from plots of an index of
CCR5 expression versus time (minutes) after ligand addition (see the
legend to Fig. 1). The CCR5 expression index was calculated by
multiplying the geometric mean channel number of CCR5 staining by the
percentage of positive cells and dividing the resulting product by 100. The decline in CCR5 expression after ligand binding was exponential,
and a curve fitting program was used to calculate the power exponent of
the slope. The same program was used to calculate the exponential slope
of CCR5 reexpression after removal of ligands. Replicate experiments
(two to three) showed that the rates of CCR5 internalization and
reexpression were highly consistent for cells from a single donor.
AOP- and NNY-RANTES.
N-terminal modifications of RANTES were
prepared by total chemical synthesis as described previously (39,
65). The purity of each batch of compounds was tested by mass
spectrometry. Their ability to block HIV-1 infection was also confirmed
prior to the CCR5 modulation experiments.
Cell fusion assays.
CCR5-tropic viral envelope-mediated cell
fusion assays were carried out essentially as described elsewhere
(18), using the cell lines HeLa-P5L and HeLa-Env-ADA
(58), both of which were provided by the laboratory of M. Alizon (Paris, France). HeLa-P5L cells were seeded in 96-well plates
(104 cells per well in 100 µl). Twenty-four hours later,
medium was removed and medium containing 104 HeLa-Env-ADA
cells per well plus chemokines was added to a final volume of 200 µl.
After a further 24 h, cells were washed once in phosphate-buffered
saline and lysed in 50 µl of phosphate-buffered saline-0.5% NP-40
for 15 min at room temperature. Lysates were assayed for for
CCR5 internalization with different RANTES analogues.
Native
RANTES, AOP-RANTES, or NNY-RANTES was added to purified human
CD4+ T lymphocytes previously activated for 10 to 14 days
to optimize CCR5 baseline expression (66). Surface
expression of CCR5 was determined by staining with anti-CCR5 antibody
PA12 (42) followed by flow cytometric analysis at 3.25, 7.5, 15, and 30 min after addition of each ligand at 100 ng/ml (~12.7
nM). The methods for analyzing CCR5 expression are illustrated in Fig.
1, and the results of a representative
experiment are shown in Fig. 2A.
Addition of NNY-RANTES to
CD4+ T cells resulted in a decrease in both the percentage
of CCR5+ cells (Fig. 1A and E) and the mean intensity of
CCR5 staining (Fig. 1B and E). The genotype of the CD4+
T-cell donor (in this case, CCR5
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.2.661-671.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Donor- and Ligand-Dependent Differences in C-C
Chemokine Receptor 5 Reexpression
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
, MIP-1
, RANTES, MCP-2, MCP-3, MCP-4,
MCP-1, and eotaxin (5, 53) and also serves as the primary
coreceptor for human immunodeficiency virus type 1 (HIV-1), HIV-2, and
simian immunodeficiency virus entry into target cells (1, 3, 4,
10, 12, 16, 19). Although multiple other coreceptors are
permissive for fusion of virus and transfected target cells (11,
14, 21-23, 26, 30, 32, 44, 48, 49, 51, 52, 54, 56, 57), only CCR5 and CXCR4 seem to be important for virus infection in human lymphoid cells (9, 38, 59, 63, 67). RANTES is a weak inhibitor of HIV-1 infection of T cells (13), but
N-terminal modifications of RANTES such as aminooxypentane (AOP)- or
n-nonanoyl (NNY)-RANTES are more potent inhibitors of both
T-cell and macrophage infection (39, 50, 58). This
inhibition of virus infection could be explained by occupancy of CCR5
and blocking of interaction with the CD4-gp120 complex, but it is more
likely to be due to receptor sequestration following internalization
and diminished CCR5 recycling or transport to the cell surface
(33, 43, 64). In this study, we compared the rates of CCR5
internalization and reexpression triggered by exposure to AOP- or
NNY-RANTES in primary CD4+ T lymphocytes isolated from
donors who differed in CCR5 genotype. NNY-RANTES induced more rapid
internalization of CCR5 and slower reexpression than AOP-RANTES, a
finding that correlates with the more potent inhibition of virus
infection by NNY-RANTES (39). Two unlinked polymorphisms,
V64I in CCR2 (27, 29) and 
32 in exon 4 of CCR5
(25), were found to affect the rate of CCR5 receptor
reexpression. The rate of receptor reexpression was largely independent
of the baseline surface expression of CCR5, and the internalization
rate was not correlated with the reexpression rate. The impact of
polymorphisms at the CCR5 locus on receptor reexpression after
prolonged internalization and degradation may be an independent
predictor of disease progression following HIV-1 infection.
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
2459 (59029) by David McDermott
at the National Institutes of Health as previously described
(36).
-galactosidase activity by the addition of 50 µl 2× CPRG
(chlorophenol red--D-galactopyranoside) substrate (16 mM
CPRG 120 mM Na2HPO4, 80 mM
NaH2PO4, 20 mM KCl, 20 mM MgSO4, 10 mM -mercaptoethanol) followed by incubation for 1 to 2 h in the
dark at room temperature. The A575 was then read
on a Labsystems microplate reader. The reaction was stopped when the
A575 for the positive control wells (no
chemokine) reached 0.5 to 1, and results are expressed as 100 × (mean absorbance [treated] mean absorbance [no envelope
cells])/(mean absorbance [no chemokine] mean absorbance [no
envelope cells]). Experiments were performed in triplicate, and
dose-inhibition curves were fitted using Prism software (GraphPad).
RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
32/+ versus +/+) influenced both of
these parameters. The total expression of surface-exposed CCR5 was
calculated as the CCR5 index (see Materials and Methods), as
illustrated in Fig. 1C. The resulting data were then normalized by
expressing the CCR5 index as a percentage of the time zero value prior
to addition of CCR5 ligands (Fig. 1D). Subsequent figures use the data
presentation format shown in Fig. 1D to facilitate comparison between
different ligands and cell donors.
View larger version (57K):
[in a new window]
FIG. 1.
Down regulation of CCR5 expression by exposure to
NNY-RANTES. NNY-RANTES was added to purified human CD4+
lymphocytes from a 32 wild-type (WT; +/+) or heterozygous (Het;
32/+) donor at time zero, and CCR5 expression was determined by
staining with the anti-CCR5 antibody PA12 at the indicated time points.
Data are expressed as the percentage of CCR5-positive cells (A), the
geometric mean staining intensity (B), the CCR5 index (percent positive
cells × mean intensity/100) (C), and the percent control CCR5
index (D). (E) Representative flow cytometry data used for these
calculations. Cells were classified as CCR5 positive if the intensity
of staining was greater than channel 10, a cutoff established by
staining with an isotype control antibody. These results thus reflect
virtually complete internalization of CCR5 and do not reflect minor
decreases in CCR5 intensity. Antibody PA12 recognizes the N-terminal
extracellular domain of CCR5, and its binding site is not blocked by
chemokine binding (42).
View larger version (18K):
[in a new window]
FIG. 2.
Modulation of CCR5 following binding of AOP-RANTES,
NNY-RANTES, or native RANTES. Data are presented as in Fig. 1D. (A)
CCR5 internalization following exposure of CD4+ T cells to
native RANTES, NNY-RANTES, or AOP-RANTES. (B) CCR5 internalization and
reexpression following 1 h of exposure to either AOP- or
NNY-RANTES. WT or Het refers to the 32 genotype of the cell donor as
defined in the legend to Fig. 1. (C) Inhibition of SF162 R5 HIV-1
infection by addition of AOP- or NNY-RANTES to cultures of purified
human CD4+ T lymphocytes. (D) Inhibition of R5-tropic viral
envelope-mediated fusion between HeLa-P5L cells and HeLa-Env-ADA cells.
Fusion was measured in the presence of increasing concentrations of
AOP-RANTES and NNY-RANTES (mean, maxima, and minima), as described in
Material and Methods. In this representative experiment, the calculated
IC50s are 730 pM for AOP-RANTES and 82 pM for NNY-RANTES.
We have noted that the sensitivity of the assay, and hence the absolute
IC50 for a given inhibitor, is subject to systematic
variation, probably according to the passage number of both the
envelope cell line (HeLa-Env-ADA) and the target cell line (HeLa-P5L). Over a series of tens of experiments, for
example, the IC50s for AOP-RANTES lay in a range between
0.3 and 3 nM, and those of NNY-RANTES were between 40 and 300 pM. In a
given experiment, the activity of one inhibitor relative to another
varies to a much lesser extent, however, with NNY-RANTES consistently
more active than AOP-RANTES by approximately an order of magnitude.
NNY-RANTES exposure causes prolonged receptor internalization.
Exposure of lymphocytes to AOP-RANTES causes prolonged internalization
of CCR5 (33). The ability of NNY-RANTES to inhibit CCR5
receptor recycling was compared to that of AOP-RANTES. Purified CD4+ T lymphocytes were exposed to 100 ng of AOP- or
NNY-RANTES per ml for 1 h to allow receptor internalization, and
reexpression of CCR5 was measured as shown in Fig. 1 at 2, 4, 8, and
24 h. Representative results are plotted in Fig. 2B. Exposure to
NNY-RANTES resulted in more prolonged internalization of CCR5 than
exposure to AOP-RANTES, and this effect was more pronounced when the
CD4+ T cells were derived from a donor of the 32/+
genotype than when they were derived from a +/+ genotype. NNY-RANTES is
thus more potent than AOP-RANTES in accelerating CCR5 internalization and preventing CCR5 reexpression.
NNY-RANTES is more potent than AOP-RANTES in virus inhibition assays. To confirm a correlation between CCR5 internalization and potency of N-terminal modifications of RANTES in virus inhibition assays, AOP- or NNY-RANTES was added to purified CD4+ T cells 5 days after activation. The cells were infected with the R5 HIV-1 isolate SF162, which is highly susceptible to inhibition by AOP-RANTES (58). NNY-RANTES was more potent at inhibiting virus infection than AOP-RANTES (Fig. 2C) in this and subsequent experiments. The ability of AOP- and NNY-RANTES to inhibit envelope-mediated cell fusion was also assessed. As shown in Fig. 2D, NNY-RANTES was about 1 log more potent (calculated 50% inhibitory concentrations [IC50s] are 730 pM for AOP-RANTES and 82 pM for NNY-RANTES) than AOP-RANTES in inhibiting cell fusion. NNY-RANTES is thus more potent than AOP-RANTES in modulating CCR5 expression and in inhibiting virus interaction with target cells.
Impact of CCR5 genotype on receptor internalization and
reexpression.
A number of polymorphisms in the 5' untranslated
region of the CCR5 locus and a coding polymorphism in the closely
linked CCR2 gene have been described elsewhere (7, 28, 29, 35, 36, 40). The provisional nomenclature (alternative 2 7) for the most important of these polymorphisms as
well as previous designations are summarized in Fig.
3. The affects of these polymorphisms and
the 32-bp pair deletion in the CCR5 coding region (25) on disease progression or transmission are also summarized in Fig. 3. We
have used the designation of CCR5 alleles based on their evolutionary
history (40, 41) rather than the order of discovery (7) to simplify the data presentation and allow some
grouping of related alleles, although the significance of the grouping may be open to question.
|
2459 (59029). As reported by McDermott
et al. (36), typing categorized approximately half of the
donor pool as G/A heterozygotes, one quarter as G/G homozygotes (haplogroups A to D) and one quarter as A/A homozygotes (haplogroups E
to G) (Fig. 3). Donors were also typed for the 32 mutation as
previously described (47). We examined the internalization rate of CCR5 on purified CD4+ T cells from donors of each
genotype following exposure to 100 ng of AOP-RANTES per ml. CCR5
internalization was most rapid with cells from A/A, 32/+ donors and
slowest with cells from G/G, +/+ donors (data not shown). These initial
findings suggested a linkage between donor genotype and CCR5 receptor
modulation by N-terminal modifications of RANTES and prompted a more
detailed investigation of this relationship.
A more extensive genotyping involving most of the polymorphisms shown
in Fig. 3 was performed on a subset of the donor pool. In particular,
all 32/+ donors were genotyped since the impact of one wild-type
allele in the cis regulatory region could be measured with
the other allele held constant (haplogroup G*2 [Fig. 3]). Since the
protein product of the 32 locus is not expressed at the cell surface
(31), surface expression of CCR5 on CD4+ T
cells from 32/+ donors is derived solely from the other CCR5 allele
(i.e., they are functionally homozygous).
CCR5 internalization and reexpression rate.
The
internalization of CCR5 following receptor ligation and the rate of
CCR5 reexpression after removal of ligands was determined for
CD4+ T cells derived from 20 donors with the 32 genotype
(G*2 [Fig. 3]) at one allele (Fig. 4)
and 9 donors without the 32 mutation (Fig.
5). Fig. 4A to E presents histograms
showing the CCR5 staining index on CD4+ T lymphocytes
during 30 min of exposure to 100 ng of NNY-RANTES per ml, and Fig. 4F
to J presents data for CCR5 reexpression at 1 (just after removal of
ligand), 2, 4, 8, and 24 h. Results are grouped by genotype at the
expressed CCR5 allele. The intensity of CCR5 expression and the number
of positive cells are reduced by NNY-RANTES exposure, and both slowly
recover over the next 24 h. There was no consistent pattern of
CCR5 internalization or reexpression associated with a given haplotype,
although two of three donors with the F*2/G*2 (V64I) mutation showed
very limited reexpression of CCR5 (Fig. 4G). Individuals without the
32 mutation express the CCR5 protein product of both alleles. CCR5
internalization was similar in CD4+ T cells from these
wild-type donors regardless of CCR5 haplotype. CCR5 reexpression was
more rapid than in cells from 32/+ donors, and cells from one donor
with the F*2 (V64I) mutation had an unusual pattern of CCR5
reexpression (Fig. 5G). The mean rates of CCR5 internalization and
reexpression for cells from all 20 32/+ donors and 9 +/+ donors are
shown in Fig. 6. CCR5 internalization
following NNY-RANTES binding is marginally faster in cells from 32/+
donors, but CCR5 reexpression is substantially and significantly
(P = 0.004, two-tailed t test) slower in
32/+ cells (Fig. 6B).
|
|
|
Calculation of internalization and reexpression rates.
The
rates of CCR5 internalization and reexpression were both exponential
functions, with early rapid phases and later slower phases. The
exponential function describes the rate of internalization or the rate
of reexpression. The many observation points for each donor illustrated
in Fig. 4 and 5 were reduced to two numbers, the internalization rate
(a negative slope) and a reexpression rate (a positive slope for all
but five donors). The mean (± standard error) internalization slope of
CCR5 following ligation with NNY-RANTES for CD4+ T cells
from 9 +/+ donors and 20 32/+ donors grouped by CCR5 haplotype is
shown in Fig. 7A, and the mean
reexpression slope for the same groups is shown in Fig. 7B. The mean
CCR5 reexpression rate is more than twice as fast for cells from +/+
donors (Fig. 7B), also a highly significant difference (P = 0.005). Five 32/+ donors had negative slopes of CCR5
reexpression; i.e., the CCR5 index continued to decline even after
removal of NNY-RANTES. Two of these donors shared the F*2(V64I)/G*2
haplogroup. The mean CCR5 reexpression rate was slightly higher for
32/+ cells from CCR5 haplogroups A and C (Fig. 7B), but this
difference was not statistically significant.
|
32/+ donors, as previously
observed (46). The lowest expression was seen in cells
from donors who had the F*2/G*2 CCR5 haplotype. We analyzed the
correlation between baseline CCR5 intensity versus internalization or
reexpression rates for all 20 32/+ donors. Both rates showed a weak
correlation with baseline CCR5 expression (higher baseline CCR5 tended
to accelerate both internalization and reexpression), but neither correlation was statistically significant. Baseline CCR5 expression thus appears to be a poor predictor of either internalization or
reexpression rates.
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
These experiments demonstrate that modulation of CCR5 expression following binding of modified RANTES ligands is dependent on both the ligand and the CCR5 genotype of the lymphocyte donor. The NNY-RANTES modification induced more rapid internalization of CCR5 following its addition and slower reexpression of CCR5 following its removal than AOP-RANTES. The observed kinetics of CCR5 modulation correlate with the antiviral activity of NNY-RANTES versus AOP-RANTES (reference 39 and Fig. 2), which suggests but does not prove that coreceptor sequestration is responsible for preventing HIV-1 infection. The mechanisms by which AOP- and NNY-RANTES slow receptor reexpression remain to be determined, although slowing the normal process of receptor recycling and/or enhancing receptor degradation are obvious possibilities. Native RANTES causes extremely rapid CCR5 internalization, and reexpression occurs even in the presence of RANTES (Fig. 2), which may explain why RANTES is not very effective at inhibiting HIV-1 infection (13, 58). Prolonged receptor internalization following binding of modified RANTES compounds may lead to degradation and enhance the role of new protein synthesis in receptor reexpression.
The second finding presented here is that the CCR5 genotype of
lymphocyte donors affected the rate of CCR5 reexpression after binding
and removal of NNY-RANTES. CD4+ T cells from donors who
were heterozygous for the 32 deletion in exon 4 of CCR5 showed
slower reexpression of CCR5 than cells from donors with other
genotypes. As previously reported (66), cells from 32/+
donors had lower baseline expression of CCR5 than cells from +/+ donors
(Fig. 8). However, baseline CCR5 expression was a poor predictor of
either CCR5 internalization or reexpression rates.
A second polymorphism, V64I in CCR5 (haplogroup F*2 [Fig. 3]), may
affect CCR5 reexpression after ligand-induced internalization. Figure 4
shows slower CCR5 reexpression in CD4+ T cells from two of
three donors who shared the F*2/G*2 genotype. A third donor with this
genotype did not show slower CCR5 re-expression, however; thus, more
observations are necessary to confirm these preliminary results. As
noted above, cells from these donors express only the protein product
of the V64I allele on their surface, and so any biological deficits may
be attributed to this protein or its turnover rate. However, the
nonsecreted, truncated protein product of the 32 allele may have a
dominant negative effect by dimerization with full-length CCR5 protein
(2), and this effect might accentuate minor defects
associated with the V64I F*2 allele. In infected patients, the
protective effect of the V64I mutation is independent of the 32
allele (60).
We initially observed delayed CCR5 internalization in donors who were
G/G at position 2459 (59029, haplogroups A to D [Fig. 3]), but
examination of additional donors did not confirm a dominant effect of
this allele. A larger sample of donors will be necessary to confirm any
impact of the 2459 polymorphism on CCR5 receptor reexpression.
The observations presented here were made with nonnative ligands that cause rapid internalization and very slow reexpression of CCR5. CCR5 reexpression is much faster with native RANTES (Fig. 2), and it would be difficult to calculate rates of CCR5 receptor recycling if it were used as the CCR5 ligand. Slowing receptor recycling with NNY-RANTES may exaggerate subtle differences in receptor recycling linked to genetic polymorphisms either by extending the time frame of recycling or by altering the underlying mechanisms. CCR5 is internalized after association with arrestins and dynamin followed by endocytosis via clathrin-coated pits (64). Reexpression may be due to recycling from late endosomal compartments, transport from presynthesized protein stores, or new protein synthesis. Preliminary experiments indicate that receptor recycling or transport is more important than protein synthesis (C. Pastore et al., unpublished data).
Polymorphisms at the CCR5 locus have been noted to affect the rate of
disease progression or transmission (7, 8, 15, 20, 27, 28, 31,
35-37, 40, 55, 60, 62). These effects are summarized in Fig. 3,
as are the results obtained in this study for CCR5 internalization and
reexpression. Rare polymorphisms in the coding region of CCR5 affect
both chemokine responses and HIV-1 infection (7, 24), but
because of their rarity and the absence of homozygotes, no effect on
disease progression can be evaluated. Several reports suggest a
correlation between higher CCR5 expression (in terms of both positive
cells and intensity of CCR5 staining) and more rapid disease
progression (17, 45). These effects can be most easily
understood as increasing the available target cell pool for the
predominant R5 virus population and allowing more efficient spreading
of virus infection. CCR5 polymorphisms that increase total expression
should increase disease progression, and those that decrease CCR5
expression should be protective. It is clear that the 32 mutation
decreases surface expression of CCR5, an observation that is consistent
with this explanation. However, there is no evidence that the
protective CCR2 V64I (F*2) or 59029 G/G (A to D) alleles decrease CCR5
expression (34, 36), and the mechanism of their protective
effect is unclear.
The results presented here suggest a modification of the target cell hypothesis that adds a dynamic function. The available target cell pool for R5 virus spread may be a product of the number of CCR5 positive cells times the relative intensity of CCR5 expression times the duration of CCR5 surface expression. CCR5 receptor internalization could be triggered by any of the native chemokine ligands or by contact with CD4-bound or activated-gp120 on adjacent infected cells (61). Polymorphisms in the cis-regulatory region of CCR5 could affect protein synthesis rates, which in turn could affect rates of CCR5 recovery. However, steady-state levels of CCR5 expression may be largely independent of CCR5 reexpression rates. We therefore propose that CCR5 receptor reexpression rate may be an independent variable that affects the rate of HIV-1 disease progression.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by NIH grants AI43645 and M01-RR00833 (TSRI GCRC) and by the Swiss National Science Foundation AIDS Commission (project 3339-62032-00). C. Pastore was supported by a fellowship from the Italian Istituto Superiore di Sanita.
We thank David McDermott for genotyping donors, and we thank Michael Neal and Gabriel Kuenzi for technical assistance.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Immunology, IMM7, The Scripps Research Institute, 10550 N. Torrey Pines Rd., La Jolla, CA 92037. Phone: (858) 784-9121. Fax: (858) 784-9190. E-mail: dmosier{at}scripps.edu.
Publication 13345-IMM from The Scripps Research Institute.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. | Alkhatib, G., M. Locati, P. E. Kennedy, P. M. Murphy, and E. A. Berger. 1997. HIV-1 coreceptor activity of CCR5 and its inhibition by chemokines: independence from G protein signaling and importance of coreceptor downmodulation. Virology 234:340-348[CrossRef][Medline]. |
| 2. |
Benkirane, M.,
D. Y. Jin,
R. F. Chun,
R. A. Koup, and K. T. Jeang.
1997.
Mechanism of transdominant inhibition of CCR5-mediated HIV-1 infection by ccr5-32.
J. Biol. Chem.
272:30603-30606 |
| 3. | Berger, E. A., P. M. Murphy, and J. M. Farber. 1999. Chemokine receptors as HIV-1 coreceptors: roles in viral entry, tropism, and disease. Annu. Rev. Immunol. 17:657-700[CrossRef][Medline]. |
| 4. | Berson, J. F., D. Long, B. J. Doranz, J. Rucker, F. R. Jirik, and R. W. Doms. 1996. A seven-transmembrane domain receptor involved in fusion and entry of T-cell-tropic human immunodeficiency virus type 1 strains. J. Virol. 70:6288-6295[Abstract]. |
| 5. |
Blanpain, C.,
I. Migeotte,
B. Lee,
J. Vakili,
B. J. Doranz,
C. Govaerts,
G. Vassart,
R. W. Doms, and M. Parmentier.
1999.
CCR5 binds multiple CC-chemokines: MCP-3 acts as a natural antagonist.
Blood
94:1899-1905 |
| 6. |
Bleul, C. C.,
L. Wu,
J. A. Hoxie,
T. A. Springer, and C. R. Mackay.
1997.
The HIV coreceptors CXCR4 and CXCR5 are differentially expressed and regulated on human T lymphocytes.
Proc. Natl. Acad. Sci. USA
94:1925-1930 |
| 7. |
Carrington, M.,
M. Dean,
M. P. Martin, and S. J. O'Brien.
1999.
Genetics of HIV-1 infection: chemokine receptor CCR5 polymorphism and its consequences.
Hum. Mol. Genet.
8:1939-1945 |
| 8. | Carrington, M., T. Kissner, B. Gerrard, S. Ivanov, S. J. O'Brien, and M. Dean. 1997. Novel alleles of the chemokine-receptor gene CCR5. Am. J. Hum. Genet. 61:1261-1267[CrossRef][Medline]. |
| 9. |
Chan, S. Y.,
R. F. Speck,
C. Power,
S. L. Gaffen,
B. Chesebro, and M. A. Goldsmith.
1999.
V3 recombinants indicate a central role for CCR5 as a coreceptor in tissue infection by human immunodeficiency virus type 1.
J. Virol.
73:2350-2358 |
| 10. | Chen, Z., A. Gettie, D. D. Ho, and P. A. Marx. 1998. Primary SIVsm isolates use the CCR5 coreceptor from sooty mangabeys naturally infected in west Africa: a comparison of coreceptor usage of primary SIVsm, HIV-2, and SIVmac. Virology 246:113-124[CrossRef][Medline]. |
| 11. |
Choe, H.,
M. Farzan,
M. Konkel,
K. Martin,
Y. Sun,
L. Marcon,
M. Cayabyab,
M. Berman,
M. E. Dorf,
N. Gerard,
C. Gerard, and J. Sodroski.
1998.
The orphan seven-transmembrane receptor apj supports the entry of primary T-cell-line-tropic and dualtropic human immunodeficiency virus type 1.
J. Virol.
72:6113-6118 |
| 12. | Choe, H., M. Farzan, Y. Sun, N. Sullivan, B. Rollins, P. D. Ponath, L. Wu, C. R. Mackay, G. LaRosa, W. Newman, N. Gerard, C. Gerard, and J. Sodroski. 1996. The beta-chemokine receptors CCR3 and CCR5 facilitate infection by primary HIV-1 isolates. Cell 85:1135-1148[CrossRef][Medline]. |
| 13. |
Cocchi, F.,
A. L. DeVico,
A. Garzino-Demo,
S. K. Arya,
R. C. Gallo, and P. Lusso.
1995.
Identification of RANTES, MIP-1 alpha, and MIP-1 beta as the major HIV-suppressive factors produced by CD8+ T cells.
Science
270:1811-1815 |
| 14. |
Combadiere, C.,
K. Salzwedel,
E. D. Smith,
H. L. Tiffany,
E. A. Berger, and P. M. Murphy.
1998.
Identification of CX3CR1. A chemotactic receptor for the human CX3C chemokine fractalkine and a fusion coreceptor for HIV-1.
J. Biol. Chem.
273:23799-23804 |
| 15. |
Dean, M.,
M. Carrington,
C. Winkler,
G. A. Huttley,
M. W. Smith,
R. Allikmets,
J. J. Goedert,
S. P. Buchbinder,
E. Vittinghoff,
E. Gomperts,
S. Donfield,
D. Vlahov,
R. Kaslow,
A. Saah,
C. Rinaldo,
R. Detels, and S. J. O'Brien.
1996.
Genetic restriction of HIV-1 infection and progression to AIDS by a deletion allele of the CKR5 structural gene. Hemophilia Growth and Development Study, Multicenter AIDS Cohort Study, Multicenter Hemophilia Cohort Study, San Francisco City Cohort, ALIVE Study.
Science
273:1856-1862 |
| 16. | Deng, H., R. Liu, W. Ellmeier, S. Choe, D. Unutmaz, M. Burkhart, P. Di Marzio, S. Marmon, R. E. Sutton, C. M. Hill, C. B. Davis, S. C. Peiper, T. J. Schall, D. R. Littman, and N. R. Landau. 1996. Identification of a major co-receptor for primary isolates of HIV-1. Nature 381:661-666[CrossRef][Medline]. |
| 17. |
de Roda Husman, A. M.,
H. Blaak,
M. Brouwer, and H. Schuitemaker.
1999.
CC chemokine receptor 5 cell-surface expression in relation to CC chemokine receptor 5 genotype and the clinical course of HIV-1 infection.
J. Immunol.
163:4597-4603 |
| 18. | Dragic, T., U. Hazan, and M. Alizon. 1995. Methods in molecular genetics, p. 218-236. Academic Press, Inc., San Diego, Calif. |
| 19. | Dragic, T., V. Litwin, G. P. Allaway, S. R. Martin, Y. Huang, K. A. Nagashima, C. Cayanan, P. J. Maddon, R. A. Koup, J. P. Moore, and W. A. Paxton. 1996. HIV-1 entry into CD4+ cells is mediated by the chemokine receptor CC-CKR-5. Nature 381:667-673[CrossRef][Medline]. |
| 20. | Easterbrook, P. J., T. Rostron, N. Ives, M. Troop, B. G. Gazzard, and S. L. Rowland-Jones. 1999. Chemokine receptor polymorphisms and human immunodeficiency virus disease progression. J. Infect. Dis. 180:1096-1105[CrossRef][Medline]. |
| 21. |
Edinger, A. L.,
T. L. Hoffman,
M. Sharron,
B. Lee,
Y. Yi,
W. Choe,
D. L. Kolson,
B. Mitrovic,
Y. Zhou,
D. Faulds,
R. G. Collman,
J. Hesselgesser,
R. Horuk, and R. W. Doms.
1998.
An orphan seven-transmembrane domain receptor expressed widely in the brain functions as a coreceptor for human immunodeficiency virus type 1 and simian immunodeficiency virus.
J. Virol.
72:7934-7940 |
| 22. | Efremov, R., M. J. Truong, E. C. Darcissac, J. Zeng, O. Grau, G. Vergoten, C. Debard, A. Capron, and G. M. Bahr. 1999. Human chemokine receptors CCR5, CCR3 and CCR2B share common polarity motif in the first extracellular loop with other human G-protein coupled receptors implications for HIV-1 coreceptor function. Eur. J. Biochem. 263:746-756[Medline]. |
| 23. |
Farzan, M.,
H. Choe,
K. Martin,
L. Marcon,
W. Hofmann,
G. Karlsson,
Y. Sun,
P. Barrett,
N. Marchand,
N. Sullivan,
N. Gerard,
C. Gerard, and J. Sodroski.
1997.
Two orphan seven-transmembrane segment receptors which are expressed in CD4-positive cells support simian immunodeficiency virus infection.
J. Exp. Med.
186:405-411 |
| 24. |
Howard, O. M.,
A. K. Shirakawa,
J. A. Turpin,
A. Maynard,
G. J. Tobin,
M. Carrington,
J. J. Oppenheim, and M. Dean.
1999.
Naturally occurring CCR5 extracellular and transmembrane domain variants affect HIV-1 co-receptor and ligand binding function.
J. Biol. Chem.
274:16228-16234 |
| 25. | Huang, Y., W. A. Paxton, S. M. Wolinsky, A. U. Neumann, L. Zhang, T. He, S. Kang, D. Ceradini, Z. Jin, K. Yazdanbakhsh, K. Kunstman, D. Erickson, E. Dragon, N. R. Landau, J. Phair, D. D. Ho, and R. A. Koup. 1996. The role of a mutant CCR5 allele in HIV-1 transmission and disease progression. Nat. Med. 2:1240-1243[CrossRef][Medline]. |
| 26. | Jinno, A., N. Shimizu, Y. Soda, Y. Haraguchi, T. Kitamura, and H. Hoshino. 1998. Identification of the chemokine receptor TER1/CCR8 expressed in brain-derived cells and T cells as a new coreceptor for HIV-1 infection. Biochem. Biophys. Res. Commun. 243:497-502[CrossRef][Medline]. |
| 27. | Kostrikis, L. G., Y. Huang, J. P. Moore, S. M. Wolinsky, L. Zhang, Y. Guo, L. Deutsch, J. Phair, A. U. Neumann, and D. D. Ho. 1998. A chemokine receptor CCR2 allele delays HIV-1 disease progression and is associated with a CCR5 promoter mutation. Nat. Med. 4:350-353[CrossRef][Medline]. |
| 28. |
Kostrikis, L. G.,
A. U. Neumann,
B. Thomson,
B. T. Korber,
P. McHardy,
R. Karanicolas,
L. Deutsch,
Y. Huang,
J. F. Lew,
K. McIntosh,
H. Pollack,
W. Borkowsky,
H. M. Spiegel,
P. Palumbo,
J. Oleske,
A. Bardeguez,
K. Luzuriaga,
J. Sullivan,
S. M. Wolinsky,
R. A. Koup,
D. D. Ho, and J. P. Moore.
1999.
A polymorphism in the regulatory region of the CC-chemokine receptor 5 gene influences perinatal transmission of human immunodeficiency virus type 1 to African-American infants.
J. Virol.
73:10264-10271 |
| 29. |
Lee, B.,
B. J. Doranz,
S. Rana,
Y. Yi,
M. Mellado,
J. M. Frade,
A. C. Martinez,
S. J. O'Brien,
M. Dean,
R. G. Collman, and R. W. Doms.
1998.
Influence of the CCR2-V64I polymorphism on human immunodeficiency virus type 1 coreceptor activity and on chemokine receptor function of CCR2b, CCR3, CCR5, and CXCR4.
J. Virol.
72:7450-7458 |
| 30. |
Liao, F.,
G. Alkhatib,
K. W. Peden,
G. Sharma,
E. A. Berger, and J. M. Farber.
1997.
STRL33, a novel chemokine receptor-like protein, functions as a fusion cofactor for both macrophage-tropic and T cell line-tropic HIV-1.
J. Exp. Med.
185:2015-2023 |
| 31. | Liu, R., W. A. Paxton, S. Choe, D. Ceradini, S. R. Martin, R. Horuk, M. E. MacDonald, H. Stuhlmann, R. A. Koup, and N. R. Landau. 1996. Homozygous defect in HIV-1 coreceptor accounts for resistance of some multiply-exposed individuals to HIV-1 infection. Cell 86:367-377[CrossRef][Medline]. |
| 32. | Loetscher, M., A. Amara, E. Oberlin, N. Brass, D. Legler, P. Loetscher, M. D'Apuzzo, E. Meese, D. Rousset, J. L. Virelizier, M. Baggiolini, F. Arenzana-Seisdedos, and B. Moser. 1997. TYMSTR, a putative chemokine receptor selectively expressed in activated T cells, exhibits HIV-1 coreceptor function. Curr. Biol. 7:652-660[CrossRef][Medline]. |
| 33. |
Mack, M.,
B. Luckow,
P. J. Nelson,
J. Cihak,
G. Simmons,
P. R. Clapham,
N. Signoret,
M. Marsh,
M. Stangassinger,
F. Borlat,
T. N. Wells,
D. Schlondorff, and A. E. Proudfoot.
1998.
Aminooxypentane-RANTES induces CCR5 internalization but inhibits recycling: a novel inhibitory mechanism of HIV infectivity.
J. Exp. Med.
187:1215-1224 |
| 34. |
Mariani, R.,
S. Wong,
L. C. Mulder,
D. A. Wilkinson,
A. L. Reinhart,
G. LaRosa,
R. Nibbs,
T. R. O'Brien,
N. L. Michael,
R. I. Connor,
M. Macdonald,
M. Busch,
R. A. Koup, and N. R. Landau.
1999.
CCR2-64I polymorphism is not associated with altered CCR5 expression or coreceptor function.
J. Virol.
73:2450-2459 |
| 35. |
Martin, M. P.,
M. Dean,
M. W. Smith,
C. Winkler,
B. Gerrard,
N. L. Michael,
B. Lee,
R. W. Doms,
J. Margolick,
S. Buchbinder,
J. J. Goedert,
T. R. O'Brien,
M. W. Hilgartner,
D. Vlahov,
S. J. O'Brien, and M. Carrington.
1998.
Genetic acceleration of AIDS progression by a promoter variant of CCR5.
Science
282:1907-1911 |
| 36. | McDermott, D. H., P. A. Zimmerman, F. Guignard, C. A. Kleeberger, S. F. Leitman, and P. M. Murphy. 1998. CCR5 promoter polymorphism and HIV-1 disease progression. Multicenter AIDS Cohort Study (MACS). Lancet 352:866-870[CrossRef][Medline]. |
| 37. | Michael, N. L., L. G. Louie, A. L. Rohrbaugh, K. A. Schultz, D. E. Dayhoff, C. E. Wang, and H. W. Sheppard. 1997. The role of CCR5 and CCR2 polymorphisms in HIV-1 transmission and disease progression. Nat. Med. 3:1160-1162[CrossRef][Medline]. |
| 38. |
Michael, N. L.,
J. A. Nelson,
V. N. KewalRamani,
G. Chang,
S. J. O'Brien,
J. R. Mascola,
B. Volsky,
M. Louder,
G. C. White II,
D. R. Littman,
R. Swanstrom, and T. R. O'Brien.
1998.
Exclusive and persistent use of the entry coreceptor CXCR4 by human immunodeficiency virus type 1 from a subject homozygous for CCR5 32.
J. Virol.
72:6040-6047 |
| 39. |
Mosier, D. E.,
G. R. Picchio,
R. J. Gulizia,
R. Sabbe,
P. Poignard,
L. Picard,
R. E. Offord,
D. A. Thompson, and J. Wilken.
1999.
Highly Potent RANTES analogues either prevent CCR5-using human immunodeficiency virus type 1 infection in vivo or rapidly select for CXCR4-using variants.
J. Virol.
73:3544-3550 |
| 40. | Mummidi, S., S. S. Ahuja, E. Gonzalez, S. A. Anderson, E. N. Santiago, K. T. Stephan, F. E. Craig, P. O'Connell, V. Tryon, R. A. Clark, M. J. Dolan, and S. K. Ahuja. 1998. Genealogy of the CCR5 locus and chemokine system gene variants associated with altered rates of HIV-1 disease progression. Nat. Med. 4:786-793[CrossRef][Medline]. |
| 41. | Mummidi, S., M. Bamshad, S. S. Ahuja, E. Gonzalez, P. M. Feuillet, K. Begum, M. C. Galvis, V. Kostecki, A. J. Valente, K. K. Murthy, L. Haro, M. J. Dolan, J. S. Allan, and S. K. Ahuja. 2000. Evolution of human and non-human primate CC chemokine receptor 5 gene and mRNA. Potential roles for haplotype and mRNA diversity, differential haplotype-specific transcriptional activity, and altered transcription factor binding to polymorpic nucleotides in the pathogenesis of HIV-1 and simian immunodeficiency virus. J. Biol. Chem. 275:18949-18961. |
| 42. |
Olson, W. C.,
G. E. Rabut,
K. A. Nagashima,
D. N. Tran,
D. J. Anselma,
S. P. Monard,
J. P. Segal,
D. A. Thompson,
F. Kajumo,
Y. Guo,
J. P. Moore,
P. J. Maddon, and T. Dragic.
1999.
Differential inhibition of human immunodeficiency virus type 1 fusion, gp120 binding, and CC-chemokine activity by monoclonal antibodies to CCR5.
J. Virol.
73:4145-4155 |
| 43. |
Oppermann, M.,
M. Mack,
A. E. Proudfoot, and H. Olbrich.
1999.
Differential effects of CC chemokines on CC chemokine receptor 5 (CCR5) phosphorylation and identification of phosphorylation sites on the CCR5 carboxyl terminus.
J. Biol. Chem.
274:8875-8885 |
| 44. |
Owman, C.,
A. Garzino-Demo,
F. Cocchi,
M. Popovic,
A. Sabirsh, and R. C. Gallo.
1998.
The leukotriene B4 receptor functions as a novel type of coreceptor mediating entry of primary HIV-1 isolates into CD4-positive cells.
Proc. Natl. Acad. Sci. USA
95:9530-9534 |
| 45. | Paxton, W. A., S. Kang, and R. A. Koup. 1998. The HIV type 1 coreceptor CCR5 and its role in viral transmission and disease progression. AIDS Res. Hum. Retroviruses. 14(Suppl. 1):S89-S92. |
| 46. | Paxton, W. A., R. Liu, S. Kang, L. Wu, T. R. Gingeras, N. R. Landau, C. R. Mackay, and R. A. Koup. 1998. Reduced HIV-1 infectability of CD4+ lymphocytes from exposed-uninfected individuals: association with low expression of CCR5 and high production of beta-chemokines. Virology 244:66-73[CrossRef][Medline]. |
| 47. | Picchio, G. R., R. J. Gulizia, and D. E. Mosier. 1997. Chemokine receptor CCR5 genotype influences the kinetics of human immunodeficiency virus type 1 infection in human PBL-SCID mice. J. Virol. 71:7124-7127[Abstract]. |
| 48. |
Pleskoff, O.,
C. Treboute, and M. Alizon.
1998.
The cytomegalovirus-encoded chemokine receptor US28 can enhance cell-cell fusion mediated by different viral proteins.
J. Virol.
72:6389-6397 |
| 49. | Pohlmann, S., M. Krumbiegel, and F. Kirchhoff. 1999. Coreceptor usage of BOB/GPR15 and Bonzo/STRL33 by primary isolates of human immunodeficiency virus type 1. J. Gen. Virol. 80:1241-1251[Abstract]. |
| 50. |
Proudfoot, A. E.,
C. A. Power,
A. J. Hoogewerf,
M. O. Montjovent,
F. Borlat,
R. E. Offord, and T. N. Wells.
1996.
Extension of recombinant human RANTES by the retention of the initiating methionine produces a potent antagonist.
J. Biol. Chem.
271:2599-2603 |
| 51. |
Ross, T. M., and B. R. Cullen.
1998.
The ability of HIV type 1 to use CCR-3 as a coreceptor is controlled by envelope V1/V2 sequences acting in conjunction with a CCR-5 tropic V3 loop.
Proc. Natl. Acad. Sci. USA
95:7682-7686 |
| 52. |
Rubbert, A.,
C. Combadiere,
M. Ostrowski,
J. Arthos,
M. Dybul,
E. Machado,
M. A. Cohn,
J. A. Hoxie,
P. M. Murphy,
A. S. Fauci, and D. Weissman.
1998.
Dendritic cells express multiple chemokine receptors used as coreceptors for HIV entry.
J. Immunol.
160:3933-3941 |
| 53. | Ruffing, N., N. Sullivan, L. Sharmeen, J. Sodroski, and L. Wu. 1998. CCR5 has an expanded ligand-binding repertoire and is the primary receptor used by MCP-2 on activated T cells. Cell. Immunol. 189:160-168[CrossRef][Medline]. |
| 54. | Samson, M., A. L. Edinger, P. Stordeur, J. Rucker, V. Verhasselt, M. Sharron, C. Govaerts, C. Mollereau, G. Vassart, R. W. Doms, and M. Parmentier. 1998. ChemR23, a putative chemoattractant receptor, is expresed in monocyte-derived dendritic cells and macrophages and is a coreceptor for SIV and some primary HIV-1 strains. Eur. J. Immunol. 28:1689-1700[CrossRef][Medline]. |
| 55. | Samson, M., F. Libert, B. J. Doranz, J. Rucker, C. Liesnard, C. M. Farber, S. Saragosti, C. Lapoumeroulie, J. Cognaux, C. Forceille, G. Muyldermans, C. Verhofstede, G. Burtonboy, M. Georges, T. Imai, S. Rana, Y. Yi, R. J. Smyth, R. G. Collman, R. W. Doms, G. Vassart, and M. Parmentier. 1996. Resistance to HIV-1 infection in caucasian individuals bearing mutant alleles of the CCR-5 chemokine receptor gene. Nature 382:722-725[CrossRef][Medline]. |
| 56. |
Shimizu, N.,
Y. Soda,
K. Kanbe,
H. Y. Liu,
A. Jinno,
T. Kitamura, and H. Hoshino.
1999.
An orphan G protein-coupled receptor, GPR1, acts as a coreceptor to allow replication of human immunodeficiency virus types 1 and 2 in brain-derived cells.
J. Virol.
73:5231-5239 |
| 57. |
Shimizu, N.,
Y. Soda,
K. Kanbe,
H. Y. Liu,
R. Mukai,
T. Kitamura, and H. Hoshino.
2000.
A putative G protein-coupled receptor, RDC1, is a novel coreceptor for human and simian immunodeficiency viruses.
J. Virol.
74:619-626 |
| 58. |
Simmons, G.,
P. R. Clapham,
L. Picard,
R. E. Offord,
M. M. Rosenkilde,
T. W. Schwartz,
R. Buser,
T. N. C. Wells, and A. E. Proudfoot.
1997.
Potent inhibition of HIV-1 infectivity in macrophages and lymphocytes by a novel CCR5 antagonist.
Science
276:276-279 |
| 59. | Simmons, G., D. Wilkinson, J. D. Reeves, M. T. Dittmar, S. Beddows, J. Weber, G. Carnegie, U. Desselberger, P. W. Gray, R. A. Weiss, and P. R. Clapham. 1996. Primary, syncytium-inducing human immunodeficiency virus type 1 isolates are dual-tropic and most can use either Lestr or CCR5 as coreceptors for virus entry. J. Virol. 70:8355-8360[Abstract]. |
| 60. |
Smith, M. W.,
M. Dean,
M. Carrington,
C. Winkler,
G. A. Huttley,
D. A. Lomb,
J. J. Goedert,
T. R. O'Brien,
L. P. Jacobson,
R. Kaslow,
S. Buchbinder,
E. Vittinghoff,
D. Vlahov,
K. Hoots,
M. W. Hilgartner, and S. J. O'Brien.
1997.
Contrasting genetic influence of CCR2 and CCR5 variants on HIV-1 infection and disease progression. Hemophilia Growth and Development Study (HGDS), Multicenter AIDS Cohort Study (MACS), Multicenter Hemophilia Cohort Study (MHCS), San Francisco City Cohort (SFCC), ALIVE Study.
Science
277:959-965 |
| 61. | Speck, R. F., U. Esser, M. L. Penn, D. A. Eckstein, L. Pulliam, S. Y. Chan, and M. A. Goldsmith. 1999. A trans-receptor mechanism for infection of CD4-negative cells by human immunodeficiency virus type 1. Curr. Biol. 9:547-550[CrossRef][Medline]. |
| 62. | van Rij, R. P., A. M. de Roda Husman, M. Brouwer, J. Goudsmit, R. A. Coutinho, and H. Schuitemaker. 1998. Role of CCR2 genotype in the clinical course of syncytium-inducing (SI) or non-SI human immunodeficiency virus type 1 infection and in the time to conversion to SI virus variants. J. Infect. Dis. 178:1806-1811[CrossRef][Medline]. |
| 63. |
Verani, A.,
E. Pesenti,
S. Polo,
E. Tresoldi,
G. Scarlatti,
P. Lusso,
A. G. Siccardi, and D. Vercelli.
1998.
CXCR4 is a functional coreceptor for infection of human macrophages by CXCR4-dependent primary HIV-1 isolates.
J. Immunol.
161:2084-2088 |
| 64. |
Vila-Coro, A. J.,
M. Mellado,
A. Martin de Ana,
A. C. Martinez, and J. M. Rodriguez-Frade.
1999.
Characterization of RANTES- and aminooxypentane-RANTES-triggered desensitization signals reveals differences in recruitment of the G protein-coupled receptor complex.
J. Immunol.
163:3037-3044 |
| 65. | Wilken, J., D. Hoover, D. A. Thompson, P. N. Barlow, H. McSparron, L. Picard, A. Wlodawer, J. Lubkowski, and S. B. Kent. 1999. Total chemical synthesis and high-resolution crystal structure of the potent anti-HIV protein AOP-RANTES. Chem. Biol. 6:43-51[CrossRef][Medline]. |
| 66. |
Wu, L.,
W. A. Paxton,
N. Kassam,
N. Ruffing,
J. B. Rottman,
N. Sullivan,
H. Choe,
J. Sodroski,
W. Newman,
R. A. Koup, and C. R. Mackay.
1997.
CCR5 levels and expression pattern correlate with infectability by macrophage-tropic HIV-1, in vitro.
J. Exp. Med.
185:1681-1691 |
| 67. |
Zhang, L.,
T. He,
A. Talal,
G. Wang,
S. S. Frankel, and D. D. Ho.
1998.
In vivo distribution of the human immunodeficiency virus/simian immunodeficiency virus coreceptors: CXCR4, CCR3, and CCR5.
J. Virol.
72:5035-5045 |
Journal of Virology, January 2001, p. 661-671, Vol. 75, No. 2
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.2.661-671.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Gaertner, H., Cerini, F., Escola, J.-M., Kuenzi, G., Melotti, A., Offord, R., Rossitto-Borlat, I., Nedellec, R., Salkowitz, J., Gorochov, G., Mosier, D., Hartley, O.
(2008). Highly potent, fully recombinant anti-HIV chemokines: Reengineering a low-cost microbicide. Proc. Natl. Acad. Sci. USA
105: 17706-17711
[Abstract] [Full Text] -
Gupta, S., Fuchs, B., Schulz-Maronde, S., Heitland, A., Escher, S. E., Mack, M., Tillmann, H.-C., Braun, A., Forssmann, W.-G., Elsner, J., Forssmann, U.
(2008). Intravascular inactivation of CCR5 by n-Nonanoyl-CC chemokine ligand 14 and inhibition of allergic airway inflammation. J. Leukoc. Biol.
83: 765-773
[Abstract] [Full Text] -
Signoret, N., Hewlett, L., Wavre, S., Pelchen-Matthews, A., Oppermann, M., Marsh, M.
(2005). Agonist-induced Endocytosis of CC Chemokine Receptor 5 Is Clathrin Dependent. Mol. Biol. Cell
16: 902-917
[Abstract] [Full Text] -
Hartley, O., Gaertner, H., Wilken, J., Thompson, D., Fish, R., Ramos, A., Pastore, C., Dufour, B., Cerini, F., Melotti, A., Heveker, N., Picard, L., Alizon, M., Mosier, D., Kent, S., Offord, R.
(2004). Medicinal chemistry applied to a synthetic protein: Development of highly potent HIV entry inhibitors. Proc. Natl. Acad. Sci. USA
101: 16460-16465
[Abstract] [Full Text] -
Lederman, M. M., Veazey, R. S., Offord, R., Mosier, D. E., Dufour, J., Mefford, M., Piatak, M. Jr., Lifson, J. D., Salkowitz, J. R., Rodriguez, B., Blauvelt, A., Hartley, O.
(2004). Prevention of Vaginal SHIV Transmission in Rhesus Macaques Through Inhibition of CCR5. Science
306: 485-487
[Abstract] [Full Text] -
Forssmann, U., Hartung, I., Balder, R., Fuchs, B., Escher, S. E., Spodsberg, N., Dulkys, Y., Walden, M., Heitland, A., Braun, A., Forssmann, W.-G., Elsner, J.
(2004). n-Nonanoyl-CC Chemokine Ligand 14, a Potent CC Chemokine Ligand 14 Analogue That Prevents the Recruitment of Eosinophils in Allergic Airway Inflammation. J. Immunol.
173: 3456-3466
[Abstract] [Full Text] -
Kawamura, T., Bruce, S. E., Abraha, A., Sugaya, M., Hartley, O., Offord, R. E., Arts, E. J., Zimmerman, P. A., Blauvelt, A.
(2004). PSC-RANTES Blocks R5 Human Immunodeficiency Virus Infection of Langerhans Cells Isolated from Individuals with a Variety of CCR5 Diplotypes. J. Virol.
78: 7602-7609
[Abstract] [Full Text] -
Veazey, R. S., Klasse, P. J., Ketas, T. J., Reeves, J. D., Piatak, M. Jr., Kunstman, K., Kuhmann, S. E., Marx, P. A., Lifson, J. D., Dufour, J., Mefford, M., Pandrea, I., Wolinsky, S. M., Doms, R. W., DeMartino, J. A., Siciliano, S. J., Lyons, K., Springer, M. S., Moore, J. P.
(2003). Use of a Small Molecule CCR5 Inhibitor in Macaques to Treat Simian Immunodeficiency Virus Infection or Prevent Simian-Human Immunodeficiency Virus Infection. JEM
198: 1551-1562
[Abstract] [Full Text] -
Hartley, O., Dorgham, K., Perez-Bercoff, D., Cerini, F., Heimann, A., Gaertner, H., Offord, R. E., Pancino, G., Debre, P., Gorochov, G.
(2003). Human Immunodeficiency Virus Type 1 Entry Inhibitors Selected on Living Cells from a Library of Phage Chemokines. J. Virol.
77: 6637-6644
[Abstract] [Full Text] -
Pastore, C., Picchio, G. R., Galimi, F., Fish, R., Hartley, O., Offord, R. E., Mosier, D. E.
(2003). Two Mechanisms for Human Immunodeficiency Virus Type 1 Inhibition by N-Terminal Modifications of RANTES. Antimicrob. Agents Chemother.
47: 509-517
[Abstract] [Full Text] -
Brandt, S. M., Mariani, R., Holland, A. U., Hope, T. J., Landau, N. R.
(2002). Association of Chemokine-mediated Block to HIV Entry with Coreceptor Internalization. J. Biol. Chem.
277: 17291-17299
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»