Previous Article | Next Article 
Journal of Virology, January 2001, p. 638-644, Vol. 75, No. 2
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.2.638-644.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Ty1 Proteolytic Cleavage Sites Are Required for
Transposition: All Sites Are Not Created Equal
Gennady V.
Merkulov,
Joseph
F.
Lawler Jr.,
Yolanda
Eby, and
Jef D.
Boeke*
Department of Molecular Biology and Genetics,
The Johns Hopkins University School of Medicine, Baltimore,
Maryland 21205
Received 7 June 2000/Accepted 28 September 2000
 |
ABSTRACT |
The retroviral protease is a key enzyme in a viral multienzyme
complex that initiates an ordered sequence of events leading to virus
assembly and propagation. Viral peptides are initially synthesized as
polyprotein precursors; these precursors undergo a number of
proteolytic cleavages executed by the protease in a specific and
presumably ordered manner. To determine the role of individual protease
cleavage sites in Ty1, a retrotransposon from Saccharomyces
cerevisiae, the cleavage sites were systematically mutagenized.
Altering the cleavage sites of the yeast Ty1 retrotransposon produces
mutants with distinct retrotransposition phenotypes. Blocking the
Gag/PR site also blocks cleavage at the other two cleavage sites, PR/IN
and IN/RT. In contrast, mutational block of the PR/IN or IN/RT sites
does not prevent cleavage at the other two sites. Retrotransposons with
mutations in each of these sites have transposition defects. Mutations
in the PR/IN and IN/RT sites, but not in the Gag/PR site, can be
complemented in trans by endogenous Ty1 copies. Hence, the
digestion of the Gag/PR site and release of the protease N terminus is
a prerequisite for processing at the remaining sites; cleavage of PR/IN
is not required for the cleavage of IN/RT, and vice versa. Of the three
cleavage sites in the Gag-Pol precursor, the Gag/PR site is processed
first. Thus, Ty1 Gag-Pol processing proceeds by an ordered pathway.
 |
INTRODUCTION |
The transposition process of the Ty1
retrotransposon from the yeast Saccharomyces cerevisiae
shares numerous similarities with typical retroviral life cycles
(1, 2, 29). Ty1 in its DNA form is integrated in the host
genome (8), and the transcription of Ty1 yields an
approximately 5.5-kb-long mRNA which contains a +1 frameshift
signal (9, 14, 19); translation of this Ty1 mRNA
yields two polyprotein precursors, a Gag precursor of 49 kDa and a
199-kDa Gag-Pol precursor.
We and others have previously named Ty1 proteins based on their
apparent molecular weight as judged from sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Several
Ty1-encoded proteins do not migrate on gels according to their
predicted molecular weight. As the masses of all Ty1 peptides is now
known, we are revising our Ty1 protein nomenclature to reflect this and
also to conform with retroviral standards (Table
1).
The primary translation product Gag-p49 is cleaved into two products,
the 45-kDa CA protein, which assembles into virus-like particles (VLPs)
(16) and is required for transposition (5), and a 4-kDa C-terminal peptide, Gag-p4, which is not required for
transposition and whose existence is inferred from mutational analyses
(30). Gag-p4 has not yet been directly detected in VLPs or
cell extracts. The Gag-Pol-p199 protein also undergoes proteolytic
processing and is cleaved into four proteins, CA, PR, IN, and RT
(17, 28). The cleavage site in the Gag precursor has been
precisely mapped by systematic mutagenesis and by C-terminal sequencing
of mature Gag (30) and has been confirmed by mass spectroscopic analysis of VLP proteins (J. F. Lawler, Jr., Rick Newitt, Rudi Aebersold, and J. D. Boeke, unpublished data). The inferred Gag/p4 cleavage site is at the same position as the Gag/PR site in the Gag-Pol precursor determined by the N-terminal sequencing of mature PR produced by autoprocessing in Escherichia coli
(Fig. 1) (J. F. Lawler, G. V. Merkulov, and J. D. Boeke, submitted for publication). For
simplicity, we will refer to the Gag/p4 and Gag/PR cleavage site(s)
collectively as the Gag/PR site. The PR/IN and IN/RT cleavage sites
were previously determined by N-terminal sequencing of IN and RT,
correspondingly (6, 32; G. Sharon and David Garfinkel,
personal communication). Although Ty1 PR cleavage sites reveal little
sequence similarity, their hydrophobicity profiles are similar
(30), suggesting that hydrophobicity patterns (perhaps in
combination with accessibility in the folded structure) rather than the
primary sequences of the cleavage sites are recognized by the enzyme.
This hypothesis is consistent with theories explaining the specificity
of retroviral proteases (21, 34). Mutations near the Ty1
PR active site block processing and transposition as well, confirming
the key role played by Ty1 PR (31, 39). A mutant in which
the Gag/PR cleavage is blocked exhibits the same phenotypes as a PR
active site mutant, suggesting that the cleavage of this site and
release of the protease N terminus are required for the processing of
the other two sites and for retrotransposition (30).

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 1.
Plasmids and mutants. (A) Genetic map of the parental
plasmid, pJEF1105 (4). Hatched box, GAL1
promoter; boxed triangles, LTR sequences; Gag and Pol, Ty1 primary
translation products; neo, Ty1 marker gene; URA3,
vector selectable marker; 2 micron ori, yeast 2 µm plasmid origin of
replication; PR, IN, and RT/RH, regions of sequence similarity to
retroviral proteins; arrowheads, PR cleavage sites. Plasmid backbones
are not drawn to scale. (B) mutants and plasmids. wt, wild type.
|
|
In this study, the other two Ty1 cleavage sites were mutated both to
confirm the locations of the cleavage sites inferred from protein
sequencing (although certain mutations distant from cleavage sites can
affect processing) and to study their roles in transposition.
Substitutions or deletions in the PR/IN or IN/RT cleavage site or both
sites inhibit Ty1 transposition but block proteolysis only at the
affected site, suggesting that these two sites are functionally
distinct from the critical Gag/PR site. Surprisingly, transposition of
PR/IN and IN/RT cleavage site mutants is fully blocked only in host
strains that fail to express endogenous Ty1 transposons
(spt3 strains), not in strains that do
(SPT3+ strains). The PR/IN and IN/RT site
mutants therefore behave differently from the Gag/PR site mutant. While
the processing of the Gag/PR cleavage site is a prerequisite for the
processing of the other two, cleavage of PR/IN or IN/RT is not required
for the processing to be completed. Systematic mutagenesis of the PR/IN
and IN/RT cleavage sites reveals their essential role in the Ty1 life
cycle and provides evidence for an ordered pathway of proteolytic
cleavage in Ty1. Analysis of the biochemical defects in Ty1
transposition in the PR/IN, IN/RT, and PR/IN/RT cleavage site mutants
showed that they are capable of forming VLPs and have RT activity;
moreover, they make normal or near-normal levels of Ty1 cDNA. This
suggests a late defect in transposition in these mutants, affecting
either the integration reaction itself or transport or behavior of the preintegration complex.
The unique role of the Gag/PR cleavage site is specified by its
position and not by its sequence. Relocation of the native Gag-PR
cleavage site upstream or downstream of its native position rendered it
inactive for cleavage and retrotransposition. However, replacement of
the Gag/PR cleavage site with the PR/IN cleavage site resulted in a
retrotransposon with normal proteolytic cleavage and retrotransposition phenotypes.
 |
MATERIALS AND METHODS |
Yeast strains.
The transposition assays were done using
congenic yeast strains YH10 (MATa ura3-52 his4-539
lys2-801 GAL+) (38) and YH51
(MATa ura3-52 his4-539 lys2-801 spt3 GAL+). Cell extracts were prepared from YH51 strains
carrying plasmids with mutant Gal-Ty1-neo constructs.
Vectors and plasmids.
All mutants were derived from on the
pJEF1105 (pGAL-Ty1-neo) expression vector (Fig. 1)
(4). The PR
mutant, pGM17, as well as the
Gag*PR mutant (previously referred to as amino acid substitution mutant
s3 at the Gag/PR cleavage site) were made as described earlier
(30, 31). The PR cleavage site mutations were six-codon
(AAGSAA) block substitutions as described previously (30).
To alter the PR/IN site, the Ty1 fragment extending from the 5' long
terminal repeat (LTR)
XhoI site to the
SalI site
was
subcloned into the pBluescript KS(+) vector (Stratagene); to change
the IN/RT site, we inserted the Ty1 fragment between the
SalI
and
BamHI sites into the same vector and
performed site-directed
mutagenesis on these plasmids as described by
Kunkel (
23). Oligonucleotide
JB1204 (5'
TCAAATATCTCCGTACCC
GCTGCTGGATCCGCTGCTACAAGTGAAAGTACACGC
3') was used to change 18 nucleotides (bold; PR*IN mutant), and
JB1205 (5'
TCGAAGAAACGAATTCAC
GCTGCTGGATCCGCTGCTGCAGTAAAATCAATCAA
3') was used to make the IN*RT mutant. After mutants were
identified
by digestion with
BamHI (site underlined), the
Ty1 fragments between
BstEII and
KpnI (PR*IN
mutant) or between
KpnI and
AflII (IN*RT
mutant)
sites were subcloned into pJEF1105. The PR*IN*RT mutant
was constructed
by subcloning a
KpnI-
AflII fragment of
pJEF1105IN*RT
into pJEF1105PR*IN. The PR cleavage site (PCS) swap
mutant was
constructed using the same strategy; oligonucleotide JB1201
(5'
AATTCGAAATCGAAAACA
GGTACCATCAATAATGTACACACATCTAATAACTCTCCC
3') was used to change 21 nucleotides (bold) in the PCS swap
mutant;
mutants were identified by digestion with
KpnI (site
underlined).
This mutation results in a RAH/NVS

TIN/NVH
change.
Immunoblotting.
Cultures were grown at 22°C in SC-Ura
galactose medium. The starting cell density was 0.5 A600, and the cells were collected when the
density reached 2 A600 (about 30 h at
22°C). Whole-cell extract samples were prepared for immunoblotting as
described elsewhere (20) except that 2.5-ml samples of
cells were used. Cell debris was pelleted by centrifugation for 3 min
at 14,000 rpm, the supernatant was transferred to a fresh tube, and 10 µl of the supernatant, containing approximately 5 µg of protein, was mixed with an equal volume of 2× SDS-PAGE sample buffer, boiled, and loaded onto the gel.
Proteins were transferred onto Protran membranes (Schleicher & Schuell)
in Tris-glycine buffer containing 20% methanol at
200 mA for 30 min.
Membranes were blocked in 20 ml of phosphate-buffered
saline (PBS)
containing 5% milk, washed three times in PBS, and
incubated with the
indicated antibodies in PBS. After three subsequent
washes in PBS,
filters were incubated with the appropriate secondary
antibodies, then
incubated with ECL fluorescent reagent (Amersham),
and exposed to X-ray
film. Anti-Gag (anti-VLP; R2-F) and anti-IN
(8B11) antibodies are
described elsewhere (
12,
31). For all
procedures using the
R2-F antibody, PBS containing 0.1% Tween-20
was substituted for
PBS.
Transposition assay.
Yeast strain YH10 and YH51 cells were
transformed to Ura+ (prototrophy) with plasmids carrying
wild-type and mutant Gal-Ty1-neo retroelements.
Transformants were patched onto SC-Ura glucose plates, grown at 30°C
for 24 h, then replica plated onto SC-Ura galactose plates, and
incubated at 22°C for 48 h to induce transposition. The patches
were then replica plated onto YPD nonselective medium at 30°C
overnight to allow loss of the donor plasmid. Cells that lost donor
plasmid were selected by replica plating to SC-5-fluoro-orotic acid
glucose medium and finally replica plated onto YPD medium containing
G418 (75 µg/ml) to select for the cells that acquired genomic copies
of Ty1-neo.
VLP isolation and cDNA analysis.
For VLP analysis, cell
pellets from 500-ml cultures grown at 22°C were resuspended in 5 ml
of buffer B-EDTA (12) and lysed with glass beads at 4°C.
The extract was clarified by centrifugation at 17,000 rpm in a Sorvall
SS-34 rotor for 10 min. Supernatant (5 ml) was loaded on a preformed
linear 20 to 70% sucrose gradient in buffer B/EDTA and centrifuged for
18 h at 25,000 rpm at 4°C in a Beckman SW28 rotor. Gradients
were fractionated, and RT activity associated with VLPs was determined
as described elsewhere (12). For cDNA analysis, samples
were processed as described elsewhere (Lawler et al., submitted).
 |
RESULTS AND DISCUSSION |
Mutagenesis of Ty1 PR cleavage sites in a GAL-Ty1-neo
element.
The parental plasmid pJEF1105 was used to generate mutant
Ty1-neo elements with block substitution mutations in PR
cleavage sites (Fig. 1). pJEF1105 is a shuttle vector that contains
both bacterial and yeast origins of replication and can be propagated in high copy number in bacteria and yeast. In these plasmids, a portion
of the 5' LTR of Ty1, containing the native Ty1 promoter, is replaced
by the GAL1 promoter, so that the Ty1-neo element is driven by the GAL1 promoter and therefore transcribed at
high levels upon induction with galactose. VLPs are then assembled within which Ty1-neo cDNA is synthesized; the cDNA is
subsequently integrated into the genome by Ty1 IN. Cells containing the
newly transposed Ty1-neo elements are easily identified by
replica plating (Materials and Methods).
Primary Ty1 translation products and their subsequent proteolytic
products are readily detected in extracts from cells carrying
these
plasmids (Fig.
2 and
3); defects in Ty1 processing are also
easily detected using this expression system. The Gag/PR cleavage
site
was determined previously (
30; Lawler et al., submitted);
it was also shown that substitution of this site by the amino
acid
residues AAGSAA centered about the Gag/PR cleavage site blocked
cleavage. The same approach was used to block the other two cleavage
sites in Ty1 (Fig.
2). Similar results were obtained with 12-amino-acid
(aa) deletion mutations centered about the three PR cleavage sites
in
our laboratory (data not shown) and with 2-aa deletion mutants
studied
by G. Sharon and D. J. Garfinkel (personal communication).

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 2.
Mutations analyzed and summary of cleavage and
transposition data. Shaded oblongs, Ty1 proteins; arrows, cleavage site
locations. Mutant sequences are outlined. Transposition frequencies are
indicated as percentage of wild type; raw data are in parentheses.
|
|

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 3.
Immunoblots of Gag and Gag-Pol processing products.
Cultures containing plasmids with mutations in the Ty1 PR cleavage
sites were grown in liquid SC-Ura galactose medium at 22°C. Cells
were pelleted, lysed, subjected to SDS-PAGE, transferred onto an
Immobilon membrane, and incubated with anti-Gag (A and C) or anti-IN
(B) antiserum. WT, wild type. Sizes are indicated in kilodaltons.
|
|
Mutations in Ty1 PR cleavage sites affect proteolytic cleavage
differentially.
Ty1 Gag was not cleaved in cells expressing the
mutant Ty1 with a substitution in the Gag/PR cleavage site (Gag*PR
[Fig. 3A]). The Gag-Pol precursor is also largely uncut in the Gag*PR
mutant. While most of the Gag-Pol-derived material observed in this
mutant comigrates with the Gag-Pol-199 protein produced by the
PR
(active site region) mutant, two additional,
faster-moving bands are sometimes observed. We suspect that these
smaller band result from proteolytic degradation during sample
preparation because the amount of this material is very variable. The
data suggest that cleavage between Gag and p4 in the 58-kDa Gag
precursor and/or the cleavage site between Gag and PR in the 199-kDa
Gag-Pol precursor is required for cleavage at the other sites. In other
studies, we found that the N terminus of Ty1 PR produced by
autoproteolysis of Gag-PR expressed in E. coli is NVSTS,
indicating that this cleavage site defines the Ty1 PR N terminus
(Lawler et al., submitted). The failure to observe proteolysis at any
of the cleavage sites in the Gag*PR mutant could in principle be
explained by one of two hypotheses: (i) cleavage of the N terminus is
required for activity at the other sites, or (ii) the N-terminal
residues which are altered in the Gag*PR mutant might be required for
catalysis. The first possibility can be further split into two possible
mechanisms: the N terminus may need to be liberated from CA to gain
activity in trans, or a change in PR structure accompanies
CA cleavage and activates it for cleavage at other sites. Possibility
ii seems unlikely based on results from an earlier study
(30), in which we constructed single amino acid
substitution mutations altering residues 1 and 3 of Ty1 PR (mutants
s3.4 and s3.6); these amino acid substitutions did not prevent
catalysis. However, mutant s3.3, which blocked Gag/PR cleavage by
mutating a residue in Gag, has the same phenotype as the Gag*PR block
substitution mutant: failure to process Gag-Pol as well as Gag. Taken
together, these results suggest that release of the protease N terminus
is an essential step for its maturation and is required for subsequent processing of the other two sites.
In contrast, Ty1 Gag precursor was processed normally in cells
expressing the PR*IN mutant, in which the cleavage site between
PR and
IN was altered by substitution. However, no mature IN was
detected in
these cells with anti-IN antibodies. Instead, a species
with an
apparent molecular mass of approximately 105 kDa was detected,
as
expected for cleavage at all sites except the PR/IN site (Fig.
3B).
Hence, in the PR*IN mutant, the PR/IN site is effectively
blocked by
substitution, resulting in expression of a PR-IN fusion
protein. We
conclude that cleavage at the PR/IN site and subsequent
release of the
protease C terminus are not required for cleavage
at the other sites.
Thus, the cleavages at the protease N and
C termini have different
functional consequences. In a similar
fashion, the human
immunodeficiency virus type 1 (HIV-1) PR is
activated by
(auto)proteolytic cleavage at its N terminus (
26).
Similarly, altering the cleavage site in the Ty1 IN*RT mutant did not
hamper cleavage of the Gag precursor, as the mature
Gag-p45 species was
detected by immunoblot analysis (Fig.
3A).
Anti-IN antiserum was used
to detect a protein with an apparent
molecular mass of approximately
145 kDa in this mutant, corresponding
to the expected size of an IN-RT
fusion protein (Fig.
3B). The
Gag/PR and PR/IN sites were processed in
the IN*RT mutant; thus,
we conclude that blocking the IN/RT cleavage
site did not affect
cleavage at the other sites. Blocking both PR/IN
and IN/RT sites
in the PR*IN*RT double mutant allowed detection of a
PR-IN-RT
fusion protein with an apparent molecular mass of
approximately
165 kDa with anti-IN antibodies; Gag was also processed
normally
in this
mutant.
Systematic mutagenesis of PR cleavage sites performed on a number of
retroviruses demonstrated that blocking the processing
at some sites
may inhibit cleavage at the others. Mutation of
the NC/PR cleavage site
of an avian retrovirus blocked cleavage
at the other Gag sites
(
7). Mutations in the PR/RT cleavage
site of HIV-1 inhibit
processing at the downstream cleavage sites
(
25). Blocking
the amino-terminal site of the HIV-1 PR did not
block PR activity in
vitro but significantly reduced infectivity
of the virus
(
40).
Apart from evaluating the roles of cleavage sites in transposition,
systematic mutagenesis of the Ty1 cleavage sites also
complements
protein sequence data. Based on these results on Ty1
cleavage sites,
the cleavage sites in Ty2, a related retroelement
of
S. cerevisiae, may be predicted. Although the Ty2 amino acid
sequence
diverges significantly from the Ty1 sequence in many
places
(
36), sequences similar to the Ty1 cleavage sites can
be readily identified (Table
2). The
sequences of the six residues
flanking the cleavage site differ by one
to three residues. Most
important, the hydrophobicity profiles of the
matching cleavage
sites in Ty1 and Ty2 are essentially the same, with
P1 and P1'
amino acid residues being more hydrophilic than the
surrounding
P2 and P2', consistent with the theory that hydrophobicity
profiles
and sequence accessibility in an unstructured region are the
major
determinants of cleavability (
21,
30,
34).
PCS mutation phenotypes and trans complementation.
Transposition capabilities of the cleavage site mutants were evaluated
in two congenic strains, YH10 and YH51 (Fig. 2 and 4). YH51 is an spt3
strain lacking a transcription factor required for expression of
genomic Ty1 elements. Genomic Ty1 transposition is reduced 20-fold
(37), and no Ty1-VLPs are made in spt3 strains unless a GAL-Ty1 plasmid is introduced (3). Unlike the
native Ty1 promoter, the GAL promoter is SPT
independent. Previous studies have shown that GAL-Ty1 elements with
mutations in IN and RT are complemented at low levels by genomic Ty1
elements in SPT3+ strains (10). In
contrast, PR active site mutants are not complemented in
SPT3+ strains. These studies suggest that IN and
RT mutants can be complemented in trans at a low level,
whereas PR mutants cannot. We tested how our mutants behaved in these
assays. For all cleavage site mutants, the transposition frequencies
were at least 100 times lower than those of the wild-type
Ty1-neo in the spt3 strain YH51.
However, in the SPT3+ strain YH10, transposition
was inhibited about 100-fold in cells expressing the Gag*PR
mutant but only 3- to 4-fold in cells with PR*IN, IN*RT, or PR*IN*RT
mutants. A simple explanation of these results is that genomic Ty1
elements can complement some but not all cleavage site mutations,
presumably by providing correctly processed IN and or RT in
trans. Alternatively, these mutations might produce proteins
with dominant negative effects. Furthermore, as both the
PR
and Gag*PR mutants fail to be complemented by the wild
type, this result provides corroborating evidence that the primary
transposition defect in the Gag*PR mutant is a protease defect.

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 4.
Transposition assays. Yeast strain YH10 or YH51 cells
were transformed to Ura+ with plasmids carrying wild-type
(WT) and mutant Ty1 retroelements. Transformants were patched on SC-Ura
glucose plates, then replica plated onto SC-Ura galactose plates, and
incubated at 22°C for 48 h to induce transposition. The patches
were then replica plated onto YPD nonselective medium to allow loss of
the donor plasmid. Cells that lost the donor plasmid were selected by
replica plating to SC-5-fluoro-orotic acid glucose medium and finally
replica plated onto YPD medium containing 75 µg of G418 per ml to
select for the cells whose genomes had acquired Ty1-neo.
(Left) Growth on YPD medium containing G418; (right) diagram showing
positions of mutant strains on the plate.
|
|
The PR/IN cleavage site functions normally in the place of the
Gag/PR cleavage site.
To evaluate the potential significance of
the primary sequence as opposed to the genomic position for the
differential recognition and processing of the Ty1 PR cleavage sites,
the six residues comprising the critical Gag/PR cleavage site were
replaced by the equivalent residues of the PR/IN cleavage site,
producing the PCS swap mutant (Fig. 2). Unlike the native Ty1 element,
in which all three cleavage sites have different sequences, in the swap
mutant the Gag/PR cleavage site is replaced by the PR/IN cleavage site.
Ty1 protein processing was indistinguishable from the wild type in the
swap mutant (Fig. 3C), as were the transposition frequencies (Fig. 2).
Hence, at least the Gag/PR cleavage site can be substituted by another
Ty1 cleavage site with little effect on processing or transposition.
Most likely, the Gag/PR site is cleaved first not because of specific
primary sequence of this site but because of its location at the N
terminus of the protease.
In contrast, we also relocated the mature Gag/PR cleavage sites to
positions 20 aa N terminally and 15 aa C terminally in
constructs pM98
and pM100, respectively. In these constructs,
no Gag processing was
observed (Fig.
3), suggesting that position
and hence three-dimensional
structural context plays an important
role in cleavage site selection,
and that appropriate primary
peptide sequence is necessary but not
sufficient for cleavage
in
vivo.
Biochemical defects of the cleavage site mutants.
The
biochemical basis for the mutant phenotypes of the PCS mutants has
several potential explanations. It is possible that IN, when fused to
PR or RT, does not translocate into the nucleus properly. The nuclear
localization signal (NLS) has been mapped to the C-terminal part of Ty1
IN. The IN C terminus might need to be freed proteolytically from RT
for efficient translocation to take place (20, 33).
Alternatively, IN may be unable to integrate Ty1 DNA into genomic DNA
in the nucleus as a result of its fusion to either PR or RT. Although
it is possible that the RT is damaged in some way in the IN*RT mutant,
Ty1 RT was previously shown to be active in in vitro homopolymer assays
in the form of the Gag-Pol precursor found in the PR
mutant (39). However, more stringent tests of RT function
are needed to ensure that RT does not have some more subtle
polymerization defect.
We investigated the ability of these mutants to make VLPs and also to
synthesize Ty1 cDNA in vivo. The PCS mutants were capable
of making
VLPs in normal amounts, with readily detectable RT activity
on
exogenous primer templates. The PR

mutant and the Gag*PR
mutant both failed to make Ty1 cDNA, whereas
the PR*IN, IN*RT, and
PR*IN*RT mutants all made amounts of Ty1
cDNA similar to wild-type
levels (Fig.
5). These results support
and extend earlier studies that showed that PR mutants fail to
reverse
transcribe endogenous Ty1 RNA effectively, presumably
because they fail
to access the endogenous primer or template
but not because of an
inactivity of the RT itself (
39). In contrast,
the PR*IN,
IN*RT, and PR*IN*RT mutants appear to have a post-reverse
transcription
defect. Since integrase is affected by all three
of these mutations, we
expect that either transport of the preintegration
complex to the
nucleus, proper multimerization of IN, access to
its preferred sites,
or efficient concerted integration of the
two ends of the Ty1 cDNA is
blocked by these mutations.

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 5.
Analysis of cDNA produced by the mutant elements. Total
yeast nucleic acids prepared from galactose-induced cells were digested
with EcoRI, RNase A treated, and electrophoretically
separated on a 1% agarose gel. The positions of relevant molecular
weight standards are indicated. The larger, 9.0-kbp band corresponds to
the Ty1 donor plasmid; the smaller, 3.5-kbp band is derived from
full-length Ty1-neo cDNA. Lane 1 shows donor plasmid
(pJEF1105) alone. The blot was probed with a 32P-labeled
neo cDNA probe. WT, wild type.
|
|
Evidence for a semiordered pathway of proteolytic cleavage in
Ty1.
A polyprotein with more than one cleavage site may be
processed into smaller products via a random process or via an ordered pathway in which the cleavage sites are cleaved sequentially. Ordered
(or semiordered) processing had been well documented and is considered
to be a common feature among retroviruses (11, 35). There
is no simple universal pattern of ordered processing in retroviruses;
rather, each virus has its own idiosyncratic pattern of cleavage. In
general, however, cleavage of certain sites closer to the N terminus of
the polyprotein precedes processing at more distal sites, as shown for
avian sarcoma-leukemia virus (7, 13), murine leukemia
virus (27), and HIV-1 (15, 18, 22). For
instance, the N terminus of the retroviral CA is released before the C
terminus (35). The order of Ty1 processing is consistent with this general retroviral trend, even though Ty1 biology is quite different.
Cleavage sites of retrotransposons are not as well studied as their
viral counterparts. The PR cleavage sites of Ty1, a
copia-like
element of yeast and of Ty3, a
gypsy-like element, were previously
determined by N- or
C-terminal sequencing of mature proteins found
in VLPs (
6,
21,
30,
32). No cleavage sites have been
mapped in other known
retrotransposons. Systematic mutagenesis
of Ty1 cleavage sites
underscores the differences in proteolysis
at these three sites and
their unique roles in Ty1 processing
and propagation. Moreover, the
phenotypes of these mutations provide
evidence for a semiordered
processing pathway of Ty1 polypeptides.
The Gag/PR cleavage site is
cleaved first, and its cleavage is
required for subsequent processing
at the PR/IN and IN/RT sites
(Fig.
6).
This is consistent with results of pulse-chase experiments
on Ty1
processing done in vivo (
17). Our data do not indicate
an
obligatory order of processing at the other two sites; rather,
it is
clear that cleavage of PR/IN is not required for the cleavage
of IN/RT,
and vice versa. Elucidation of the processing sites
in other
retrotransposons and their mutagenesis may provide valuable
insights
into the mechanisms and regulation of proteolytic processing
and
retrotransposition.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 6.
Model for ordered processing pathway in Ty1 VLP
assembly. Sections of a Ty1 VLP are shown. Shaded boxes, Ty1 proteins.
Top, Ty1 proteins before cleavage; middle, the first step of
processing, autocatalytic cleavage of the Gag/PR site; bottom,
processing of PR/IN and IN/RT sites.
|
|
 |
ACKNOWLEDGMENTS |
We thank G. Sharon and David Garfinkel for sharing unpublished
observations on Ty1 PR cleavage site mutants, and we thank Jeff Smith
for helpful suggestions.
This work was supported in part by NIH grant GM36481 to J.D.B. and
Medical Scientist training grant GM-07309 to J.F.L.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Biology and Genetics, The Johns Hopkins University School of Medicine, 617 Hunterian Bldg./725 N. Wolfe St., Baltimore, MD 21205. Phone: (410) 955-0398. Fax: (410) 614-2987. E-mail:
jboeke{at}jhmi.edu.
Present address: Celera, Rockville, MD 20850.
 |
REFERENCES |
| 1.
|
Boeke, J. D.,
D. J. Garfinkel,
C. A. Styles, and G. R. Fink.
1985.
Ty elements transpose through an RNA intermediate.
Cell
40:491-500[CrossRef][Medline].
|
| 2.
|
Boeke, J. D., and J. P. Stoye.
1997.
Retrotransposons, endogenous retroviruses, and the evolution of retroelements, p. 343-435.
In
H. Varmus, S. Hughes, and J. Coffin (ed.), Retroviruses. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 3.
|
Boeke, J. D.,
C. A. Styles, and G. R. Fink.
1986.
Saccharomyces cerevisiae SPT3 gene is required for transposition and transpositional recombination of chromosomal Ty elements.
Mol. Cell. Biol.
6:3575-3581[Abstract/Free Full Text].
|
| 4.
|
Boeke, J. D.,
H. Xu, and G. R. Fink.
1988.
A general method for the chromosomal amplification of genes in yeast.
Science
239:280-282[Abstract/Free Full Text].
|
| 5.
|
Braiterman, L. T.,
G. M. Monokian,
D. J. Eichinger,
S. L. Merbs,
A. Gabriel, and J. D. Boeke.
1994.
In-frame linker insertion mutagenesis of yeast transposon Ty1: phenotypic analysis.
Gene
139:19-26[CrossRef][Medline].
|
| 6.
|
Braiterman, T. L.
1993.
Ph.D. thesis.
The Johns Hopkins University, Baltimore, Md.
|
| 7.
|
Burstein, H.,
D. Bizub,
M. Kotler,
G. Schatz,
V. M. Vogt, and A. M. Skalka.
1992.
Processing of an avian retroviral Gag polyprotein precursors is blocked by a mutation at the NC-PR cleavage site.
J. Virol.
66:1781-1785[Abstract/Free Full Text].
|
| 8.
|
Cameron, J. R.,
E. Y. Loh, and R. W. Davis.
1979.
Evidence for transposition of dispersed repetitive DNA families in yeast.
Cell
16:739-751[CrossRef][Medline].
|
| 9.
|
Clare, J.,
M. Belcourt, and P. J. Farabaugh.
1988.
Efficient translational frameshifting occurs within a conserved sequence of the overlap between the two genes of a yeast Ty1 transposon.
Proc. Natl. Acad. Sci. USA
85:6816-6820[Abstract/Free Full Text].
|
| 10.
|
Curcio, M. J., and D. J. Garfinkel.
1992.
Posttranslational control of Ty1 retrotransposition occurs at the level of protein processing.
Mol. Cell. Biol.
12:2813-2825[Abstract/Free Full Text].
|
| 11.
|
Dickson, C.,
R. Eisenman,
H. Fan,
E. Hunter, and N. Teich.
1984.
Protein biosynthesis and assembly, p. 513-648.
In
R. Weiss (ed.), Molecular biology of tumor viruses: RNA tumor viruses. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 12.
|
Eichinger, D. J., and J. D. Boeke.
1988.
The DNA intermediate in yeast Ty1 element transposition copurifies with virus-like particles: cell-free Ty1 transposition.
Cell
54:955-966[CrossRef][Medline].
|
| 13.
|
Eisenman, R.,
W. S. Mason, and M. Linial.
1980.
Synthesis and processing of polymerase proteins of wild-type and mutant avian retroviruses.
J. Virol.
36:62-78[Abstract/Free Full Text].
|
| 14.
|
Elder, R. T.,
T. P. St. John,
D. T. Stinchcomb, and R. W. Davis.
1981.
Studies on the transposable element Ty1 of yeast I. RNA homologous to Ty1.
Cold Spring Harbor Symp. Quant. Biol.
45:581-584.
|
| 15.
|
Erickson-Viitenan, S.,
J. Manfredi,
P. Viitanen,
D. E. Tribe,
R. Tritch,
C. A. Hutchison III,
D. D. Loeb, and R. Swanstrom.
1989.
Cleavage of HIV-1 Gag polyprotein synthesized in vitro: sequential cleavage by the viral protease.
AIDS Res. Hum. Retroviruses
5:577-591[Medline].
|
| 16.
|
Garfinkel, D. J.,
J. D. Boeke, and G. R. Fink.
1985.
Ty element transposition: reverse transcriptase and virus-like particles.
Cell
42:507-517[CrossRef][Medline].
|
| 17.
|
Garfinkel, D. J.,
A.-M. Hedge,
S. D. Youngren, and T. D. Copeland.
1991.
Proteolytic processing of pol-TYB proteins from the yeast retrotransposon Ty1.
J. Virol.
65:4573-4581[Abstract/Free Full Text].
|
| 18.
|
Gowda, S. D.,
B. S. Stein, and E. G. Engleman.
1989.
Identification of protein intermediates in the processing of the p55 HIV-1 Gag precursor in cells infected with recombinant vaccinia virus.
J. Biol. Chem.
264:8459-8462[Abstract/Free Full Text].
|
| 19.
|
Kawakami, K.,
S. Pande,
B. Faiola,
D. P. Moore,
J. D. Boeke,
P. J. Farabaugh,
J. N. Strathern,
Y. Nakamura, and D. J. Garfinkel.
1993.
A rare tRNA-Arg(CCU) that regulates Ty1 element ribosomal frameshifting is essential for Ty1 retrotransposition in Saccharomyces cerevisiae.
Genetics
135:309-320[Abstract].
|
| 20.
|
Kenna, M. A.,
C. B. Brachmann,
S. E. Devine, and J. D. Boeke.
1998.
Invading the yeast nucleus: a nuclear localization signal at the C terminus of Ty1 integrase is required for transposition in vivo.
Mol. Cell. Biol.
18:1115-1124[Abstract/Free Full Text].
|
| 21.
|
Kirchner, J., and S. Sandmeyer.
1993.
Proteolytic processing of Ty3 proteins is required for transposition.
J. Virol.
67:19-28[Abstract/Free Full Text].
|
| 22.
|
Krausslich, H. G.,
H. Schneider,
G. Zybarth,
C. A. Carter, and E. Wimmer.
1988.
Processing of in vitro synthesized Gag precursor proteins of human immunodeficiency virus (HIV) type 1 by HIV proteinase generated in Escherichia coli.
J. Virol.
62:4393-4397[Abstract/Free Full Text].
|
| 23.
|
Kunkel, T. A.
1985.
Rapid and efficient site-specific mutagenesis without phenotypic selection.
Proc. Natl. Acad. Sci. USA
82:488-492[Abstract/Free Full Text].
|
| 24.
|
Leis, J.,
D. Baltimore,
J. M. Bishop,
J. Coffin,
E. Fleissner,
S. P. Goff,
S. Oroszlan,
H. Robinson,
A. M. Skalka,
H. M. Temin, and V. Vogt.
1988.
Standardized and simplified nomenclature for proteins common to all retroviruses.
J. Virol.
62:1808-1809[Abstract/Free Full Text].
|
| 25.
|
Loeb, D. D.,
C. A. Huchinson III,
M. H. Edgell,
W. G. Farmerie, and R. Swanstrom.
1989.
Mutational analysis of human immunodeficiency virus type 1 protease suggests functional homology with aspartic proteinases.
J. Virol.
63:111-121[Abstract/Free Full Text].
|
| 26.
|
Louis, J. M.,
N. T. Nashed,
K. D. Parris,
A. R. Kimmel, and D. M. Jerina.
1994.
Kinetics and mechanism of autoprocessing of human immunodeficiency virus type 1 protease rom an analog of the Gag-Pol polyprotein.
Proc. Natl. Acad. Sci. USA
91:7970-7974[Abstract/Free Full Text].
|
| 27.
|
Maxwell, S., and R. B. Arlinghaus.
1981.
In vitro proteolytic cleavage of Gazdar murine sarcoma virus p65gag.
J. Virol.
39:963-967[Abstract/Free Full Text].
|
| 28.
|
Mellor, J.,
A. M. Fulton,
M. J. Dobson,
N. A. Roberts,
W. Wilson,
A. J. Kingsman, and S. M. Kingsman.
1985.
The Ty transposon of Saccharomyces cerevisiae determines the synthesis of at least three proteins.
Nucleic Acids Res.
13:6249-6263[Abstract/Free Full Text].
|
| 29.
|
Mellor, J.,
M. H. Malim,
K. Gull,
M. F. Tuite,
S. McCready,
T. Dibbayawan,
S. M. Kingsman, and A. J. Kingsman.
1985.
Reverse transcriptase activity and Ty RNA are associated with virus-like particles in yeast.
Nature
318:583-586[CrossRef][Medline].
|
| 30.
|
Merkulov, G. V.,
K. M. Swiderek,
B. C. B., and J. D. Boeke.
1996.
A critical proteolytic cleavage site near the C terminus of the yeast retrotransposon Ty1 Gag protein.
J. Virol.
70:5548-5556[Abstract/Free Full Text].
|
| 31.
|
Monokian, G. M.,
L. T. Braiterman, and J. D. Boeke.
1994.
In-frame linker insertion mutagenesis of yeast transposon Ty1: mutations, transposition and dominance.
Gene
139:9-18[CrossRef][Medline].
|
| 32.
|
Moore, S. P., and D. J. Garfinkel.
1994.
Expression and partial purification of enzymatically active recombinant Ty1 integrase in Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
91:1843-1847[Abstract/Free Full Text].
|
| 33.
|
Moore, S. P.,
L. A. Rinckel, and D. J. Garfinkel.
1998.
A Ty1 integrase nuclear localization signal required for retrotransposition.
Mol. Cell. Biol.
18:1105-1114[Abstract/Free Full Text].
|
| 34.
|
Pettit, S. C.,
J. Simsic,
D. D. Loeb,
L. Everitt,
C. A. Hutchison, and R. Swanstrom.
1991.
Analysis of retroviral protease cleavage sites reveals two types of cleavage sites and the structural requirements of the P1 amino acid.
J. Biol. Chem.
266:14539-14547[Abstract/Free Full Text].
|
| 35.
|
Swanstrom, R., and J. W. Wills.
1997.
Synthesis, assembly, and processing of viral proteins, p. 263-334.
In
J. M. Coffin, S. H. Hughes, and H. E. Varmus (ed.), Retroviruses. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 36.
|
Warmington, J. R.,
R. B. Waring,
C. S. Newlon,
K. J. Indge, and S. G. Oliver.
1985.
Nucleotide sequence characterization of Ty 1-17, a class II transposon from yeast.
Nucleic Acids Res.
13:6679-6693[Abstract/Free Full Text].
|
| 37.
|
Winston, F.,
K. J. Durbin, and G. R. Fink.
1984.
The SPT3 gene is required for normal transcription of Ty elements in S. cerevisiae.
Cell
39:675-682[CrossRef][Medline].
|
| 38.
|
Xu, H., and J. D. Boeke.
1991.
Inhibition of Ty1 transposition by mating pheromones in Saccharomyces cerevisiae.
Mol. Cell. Biol.
11:2736-2743[Abstract/Free Full Text].
|
| 39.
|
Youngren, S. D.,
J. D. Boeke,
N. J. Sanders, and D. J. Garfinkel.
1988.
Functional organization of the retrotransposon Ty from Saccharomyces cerevisiae: Ty protease is required for transposition.
Mol. Cell. Biol.
8:1421-1431[Abstract/Free Full Text].
|
| 40.
|
Zybarth, G.,
H. G. Krausslich,
K. Partin, and C. Carter.
1994.
Proteolytic activity of novel human immunodeficiency virus type 1 proteinase proteins from a precursor with a blocking mutation at the N terminus of the PR domain.
J. Virol.
68:240-250[Abstract/Free Full Text].
|
Journal of Virology, January 2001, p. 638-644, Vol. 75, No. 2
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.2.638-644.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
McLane, L. M., Pulliam, K. F., Devine, S. E., Corbett, A. H.
(2008). The Ty1 integrase protein can exploit the classical nuclear protein import machinery for entry into the nucleus. Nucleic Acids Res
36: 4317-4326
[Abstract]
[Full Text]
-
Wilhelm, M., Wilhelm, F.-X.
(2006). Cooperation between Reverse Transcriptase and Integrase during Reverse Transcription and Formation of the Preintegrative Complex of Ty1.. Eukaryot Cell
5: 1760-1769
[Abstract]
[Full Text]
-
Wilhelm, M., Wilhelm, F.-X.
(2005). Role of Integrase in Reverse Transcription of the Saccharomyces cerevisiae Retrotransposon Ty1. Eukaryot Cell
4: 1057-1065
[Abstract]
[Full Text]
-
Radford, S. J., Boyle, M. L., Sheely, C. J., Graham, J., Haeusser, D. P., Zimmerman, L., Keeney, J. B.
(2004). Increase in Ty1 cDNA Recombination in Yeast sir4 Mutant Strains at High Temperature. Genetics
168: 89-101
[Abstract]
[Full Text]
-
Lawler, J. F. Jr., Haeusser, D. P., Dull, A., Boeke, J. D., Keeney, J. B.
(2002). Ty1 Defect in Proteolysis at High Temperature. J. Virol.
76: 4233-4240
[Abstract]
[Full Text]
-
Jiang, Y. W.
(2002). Transcriptional cosuppression of yeast Ty1 retrotransposons. Genes Dev.
16: 467-478
[Abstract]
[Full Text]
-
Lawler, J. F. Jr., Merkulov, G. V., Boeke, J. D.
(2002). A Nucleocapsid Functionality Contained within the Amino Terminus of the Ty1 Protease That Is Distinct and Separable from Proteolytic Activity. J. Virol.
76: 346-354
[Abstract]
[Full Text]
-
Lawler, J. F. Jr., Merkulov, G. V., Boeke, J. D.
(2001). Frameshift Signal Transplantation and the Unambiguous Analysis of Mutations in the Yeast Retrotransposon Ty1 Gag-Pol Overlap Region. J. Virol.
75: 6769-6775
[Abstract]
[Full Text]