We established a porcine lung epithelial cell line designated St.
Jude porcine lung cells (SJPL) and demonstrated that all tested
influenza A and B viruses replicated in this cell line. The infectivity
titers of most viruses in SJPL cells were comparable to or better than
those in MDCK cells. The propagation of influenza viruses from clinical
samples in SJPL cells did not lead to antigenic changes in the
hemagglutinin molecule. The numbers of both Sia2-3Gal and Sia2-6Gal
receptors on SJPL cells were greater than those on MDCK cells.
Influenza virus infection of SJPL cells did not lead to apoptosis, as
did infection of MDCK cells. No porcine endogenous retrovirus was
detected in SJPL cells, and in contrast to MDCK cells, SJPL cells did
not cause tumors in nude mice.
 |
TEXT |
The isolation and propagation of
influenza viruses from clinical samples are important in surveillance,
studies of host range and pathogenesis, and vaccine production.
However, the number of primary cell types and continuous cell lines
that support influenza virus replication is limited (8, 10, 20,
31). The primary epithelial cells of human adenoid and primary
rhesus monkey kidney tissue support replication of influenza viruses
(6, 21). Cell lines such as Vero, MRC-5, Madin-Darby
canine kidney (MDCK), and baby hamster kidney (BHK) also support the
growth of influenza viruses, but of these cell lines, MDCK is the best
for isolation and propagation of influenza viruses (8, 10, 11,
31).
One important issue regarding the pathogenesis of influenza viruses is
how influenza viruses that infect one species acquire the ability to
infect another. Pigs are regarded as possible "mixing vessels" in
which human-avian influenza A virus reassortants are generated
(36). Therefore, a porcine lung epithelial cell line would
be very useful in studying factors that influence interspecies transmission.
A porcine lung epithelial cell line could also be useful in producing
more effective influenza virus vaccines. Currently, available vaccine
is produced in embryonated eggs using egg-adapted variants of the
influenza virus. Adaptation of human influenza A and B viruses in eggs
can result in the selection of variants that contain hemagglutinin (HA)
molecules that are antigenically and structurally different from those
of the original influenza viruses in the clinical samples (16,
33, 35). Because of the antigenic changes in the HA molecule of
the vaccine virus, the vaccine may not offer complete protection
against infection by the circulating influenza virus. HA molecules of
influenza virus isolated and grown in mammalian cells have been shown
to be identical to those of the original influenza viruses in clinical samples (17, 32). Currently, no mammalian cell line is
licensed for use in the production of human influenza vaccine.
Therefore, an alternative mammalian cell line that supports the
replication of all subtypes of influenza viruses is needed for vaccine
production. A porcine lung epithelial cell line could fulfill this need.
There are two major morphologically and biochemically distinct modes of
cell death: apoptosis (programmed cell death) and necrosis (5,
42). Apoptotic cells retain membrane integrity even after
disintegration into apoptotic bodies (42). Apoptotic bodies and cells are phagocytosed by macrophages, which prevent an
inflammatory reaction (30), while cells dying by necrosis lose membrane integrity, which results in inflammation
(42). It was reported that infection of epithelial cells
such as MDCK and HeLa cells by influenza viruses leads to apoptosis
(38). However, it is not clear whether infection of
epithelial cells of respiratory tracts by influenza viruses results in
apoptosis or necrosis.
An epithelial cell line (St. Jude porcine lung [SJPL] cells) was
spontaneously established from the normal lungs of a normal 4-week-old
female Yorkshire pig as previously described (37) at St.
Jude Children's Research Hospital. This cell line was continuously cultured in Dulbecco's modified Eagle's medium (DMEM; Life
Technologies, Gaithersburg, Md.) supplemented with 10% fetal bovine
serum, 1% sodium pyruvate, 1% L-glutamine, 1.4%
MEM nonessential amino acids, and 1% antibiotic-antimycotic
solution (Sigma Chemical Co., St. Louis, Mo.). SJPL cells were
epithelial cell-like, and the morphology was not changed at passage 60. SJPL cells were positive for an epithelial cell marker, cytokeratin
(data not shown).
Expression of influenza virus proteins and influenza virus-induced
CPE in SJPL cells.
To determine the cytopathic effect (CPE) of
influenza virus in SJPL cells, confluent monolayers of SJPL cells in a
six-well plate (Becton Dickinson, Franklin Lakes, N.J.) were infected
with A/Sydney/5/97 (H3N2) (multiplicity of infection [MOI], 2), and DMEM containing 0.3% bovine serum albumin (Life Technologies) and 1 µg of TPCK (tosylsulfonyl phenylalanyl chloromethyl ketone)-treated trypsin per ml were added to each well. CPE was determined 48 h
after infection.
MDCK cells infected with influenza viruses show marked
cytopathogenicity. SJPL cells infected with A/Sydney/5/97 (H3N2)
(MOI, 2) showed a strong CPE (Fig. 1B),
but uninfected cells showed no sign of cell damage (Fig. 1A). The
indication of CPE in MDCK cells and SJPL cells infected with influenza
viruses was different. Approximately 16 h after infection, pores on the
monolayer of MDCK cells started to appear, and the size of pores
increased until the entire monolayer was destroyed and detached from
the surface of the flask. In contrast, the apical surfaces of SJPL cells started to be destroyed at 18 h after infection, and the area of the apical surface that was destroyed continued to increase, but some cells (20%) remained attached to the flask surface even after
72 h.
View larger version (103K):
[in this window]
[in a new window]
|
FIG. 1.
CPE and nucleoprotein expression of SJPL cells infected
with A/Sydney/5/97 (H3N2). (A and B) Confluent monolayers of SJPL cells
in six-well plates were infected with A/Sydney/5/97 (H3N2) (MOI, 2),
and 48 h later CPE was evaluated (B). Uninfected cells were used
as a control (A). Magnification, ×5 (A and B) and 232% further
(insets). (C and D) Confluent monolayers of SJPL cells in two-well
Lab-Tek chamber slides were infected with A/Sydney/5/97 (H3N2) (MOI,
5), and 16 h later the cells were incubated with a monoclonal
antibody to nucleoprotein and a secondary FITC-labeled goat anti-mouse
immunoglobulin antibody (D). Uninfected cells were used as a control
(C). Magnification, ×20.
|
|
To determine whether the newly established SJPL cell line could express
structural proteins of influenza virus, we used a monoclonal antibody
to nucleoprotein in an indirect immunofluorescent assay to detect the
viral protein in SJPL cells that had been infected with A/Sydney/5/97
(H3N2). SJPL cells infected with an H3N2 (A/Sydney/5/97) influenza
virus (MOI, 5) for 1 h were incubated overnight at 37°C before
they were fixed with 80% cold acetone in water. The fixed cells were
incubated on ice with a mouse monoclonal antibody to
nucleoprotein of influenza A virus for 30 min and then incubated on ice
with fluorescein isothiocyanate (FITC)-labeled goat anti-mouse
immunoglobulin G for 30 min before cells were evaluated by using a
fluorescence microscope. The results showed that the cytoplasms and
nuclei of infected cells contained nucleoprotein (Fig. 1D) but similar
regions of uninfected cells did not (Fig. 1C).
Replication efficiencies of mammalian, avian, and the highly
pathogenic H5N1 influenza viruses in SJPL cells.
We compared the
replication efficiencies of human, swine, equine, and highly pathogenic
H5N1 influenza viruses in SJPL cells with those in MDCK cells.
Confluent monolayers of SJPL and MDCK cells were infected with 10 50%
egg-infective doses (EID50) of each virus. Viral titration
was performed by using SJPL cells for viruses that had been grown in
SPJL cells and MDCK cells for viruses that had been grown in MDCK
cells. SJPL and MDCK cells (5 × 105 per well) were
seeded in six-well tissue culture plates and allowed to grow to
confluence. Cells were washed with phosphate-buffered saline (PBS, pH
7.2) twice and infected with 10 EID50 (i.e., 10 times the
virus dose that will infect 50% of the eggs in a population) for
1 h at 37°C in a humidified incubator containing 5%
CO2. Supernatants containing viruses were collected 50 h after infection for virus titration. Supernatants from virus-infected
cells were serially diluted 10-fold in medium (DMEM for SJPL-grown
virus and MEM for MDCK-grown virus) containing 0.3% bovine serum
albumin and 1 µg of TPCK-trypsin per ml, and 0.1 ml of the dilutions
was added to four replicate wells in a 96-well plate. Seventy-two hours after infection, the presence of virus was determined by HA with 0.5%
chicken red blood cells. The virus titers were expressed as the
log10 50% tissue culture infective dose
(TCID50) per milliliter.
Most of the human viruses grew to higher titers in SJPL cells than in
MDCK cells (Table 1). The titers of human
viruses grown in SJPL cells ranged from 2.00 to 6.50 log10 TCID50/ml, whereas the titers of the same
viruses grown in MDCK cells ranged from <0.1 to 4.25 log10
TCID50/ml. Although A/Bel/42 (H1N1) did not grow to
detectable levels in MDCK cells, it replicated in this cell line when
higher doses of virus were used for infection. Replication efficiency
of swine influenza viruses was also greater in SJPL cells than in MDCK
cells (Table 1). The virus titers in SJPL cells ranged from 3.75 to
6.50 log10 TCID50/ml, whereas the titers for
the same viruses in MDCK cells ranged from 1.75 to 5.50 log10 TCID50/ml. The replication efficiencies
of equine influenza viruses were lower than those of the swine viruses
in SJPL cells and in MDCK cells. The range of titers was 1.00 to 3.50 log10 TCID50/ml. We assessed the difference in
replication efficiencies of the mammalian viruses in the two cell lines
by performing analysis of variance for the two-way layout with
replicates. Sufficient evidence was found at the 0.05 level of
significance to conclude that the replication efficiencies of mammalian
influenza viruses are significantly higher in SJPL cells than in MDCK
cells (P < 0.0001).
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Comparison of replication efficiencies of mammalian
influenza A and B viruses in SJPL cells with those in MDCK cells
|
|
Avian species harbor all subtypes of influenza A viruses
(12). Because avian influenza viruses are potential
pandemic influenza viruses in humans, we determined the replication
efficiencies of avian viruses in SJPL cells and in MDCK cells. All
representative avian influenza viruses replicated in SJPL cells; the
range of titers was 1.50 to 5.25 log10
TCID50/ml. In MDCK cells, most representatives of the avian
virus subtypes replicated, but the avian influenza viruses
A/Mallard/Alberta/119/98 (H1N1), A/RuddyTurnstone/DE/259/98 (H9N9), A/Mallard/Alberta/223/98 (H10N8), and
A/Shorebird/DE/224/97 (H13N6) did not grow in MDCK cells when the cells
were inoculated with a dose of 10 EID50. Higher inoculating
doses of these viruses resulted in their replication in MDCK cells. The
virus titers in MDCK cells ranged from <0.1 to 5.25 log10
TCID50/ml (Table 2). The
replication efficiencies of avian influenza viruses in SJPL cells were
higher than in MDCK cells (P < 0.0001).
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Comparison of replication efficiencies of avian influenza
viruses in SJPL cells with those in MDCK cells
|
|
We compared the replication efficiencies of the highly
pathogenic H5N1 influenza viruses in SJPL cells with those of
the same viruses in MDCK cells. A/HK/156/97 (H5N1), which was
originally isolated from a 3-year-old boy, replicated well in MDCK
cells and in SJPL cells; the titers ranged from 5.0 to 5.25 log10 TCID50/ml (Table
3). The addition of 1 µg of
TPCK-treated trypsin per ml to the infection media did not make a
difference in viral yield in either cell line. The replication
efficiencies of the highly pathogenic H5N1 viruses were significantly
greater in SJPL cells than in MDCK cells (P = 0.0021).
Kinetics of influenza virus replication in SJPL cells.
To
determine the kinetics of virus replication in SJPL cells, we compared
the growth curve of representative virus in SJPL cells with that of the
same representative virus in MDCK cells. An influenza virus,
B/Memphis/1/84, was used. To minimize the effect that the species
difference in cell lines might have on virus replication, we used SJPL
cells to determine the titer of viruses that were initially grown in
SJPL cells and MDCK cells to determine the titer of viruses that were
initially grown in MDCK cells. We titrated B/Memphis/1/84 in eggs by
using serial 10-fold dilutions. Monolayers of SJPL and MDCK cells in a
six-well plate were infected with 10 EID50 of virus and
were incubated at 37°C in 5% CO2. At different times
after infection, 50 µl of supernatant was removed. The presence of
viruses in supernatant was determined by TCID50. The growth
pattern of B/Memphis/1/84 in SJPL cells was similar to that in MDCK
cells (Fig. 2). The time of peak viral
growth in both SJPL and MDCK cells was 50 h after infection, and
after that time, the viral titers started to decline. At 72 h
after infection, the infectious viral titers were approximately
102- to 103-fold less than those at 50 h
after infection.
View larger version (14K):
[in this window]
[in a new window]
|
FIG. 2.
Influenza virus growth in SJPL and MDCK cells.
Monolayers of SJPL ( ) and MDCK ( ) cells in a six-well plate were
infected with 10 EID50 of B/Memphis/1/84, and aliquots were
harvested on different days after infection. The results are from three
independent experiments.
|
|
Primary influenza virus isolation from human clinical samples and
antigenic stability of cultured viruses.
Because some strains of
human influenza viruses from clinical samples do not grow in eggs, MDCK
cells are often used for the growth and isolation of influenza viruses
from human clinical samples. Recently isolated human influenza viruses
require adaptation to eggs before their variants can grow in eggs. We
determined whether SJPL cells could be used to grow and isolate
influenza viruses from clinical gargle samples. MDCK cells were used
for comparison. Confluent monolayers of SJPL and MDCK cells in a
24-well tissue culture plate were infected with 0.1 ml of human
clinical sample collected in sterile PBS. Fourteen influenza viruses in 20 human clinical samples were grown and isolated in SJPL cells and in
MDCK cells. Results of hemagglutination inhibition assays indicated that all the isolates were influenza A viruses (H3N2). The
viral titers in both cell lines ranged from 2.0 to 4.5 log10 TCID50/ml, with means of 3.196 (MDCK
cells) and 3.300 (SJPL cells) log10
TCID50/ml.
The hallmark of influenza virus propagation in mammalian cells is that
the growth of human influenza viruses in this type of cell usually does
not lead to antigenic change; this result is in contrast to the
antigenic changes that occur in influenza viruses cultured in eggs
(34). To determine whether the growth of influenza A virus
from clinical samples can lead to changes in amino acids of HA1, SJPL
and MDCK cells were inoculated with clinical gargle samples from which
A/Memphis/4/99 (H3N2) had been isolated. As a control, the virus in the
clinical samples was adapted to eggs. After three passages, the viral
RNA was isolated with the RNeasy mini kit (Qiagen, Santa Clara,
Calif.), subjected to reverse transcription-PCR (RT-PCR; SuperScript
preamplification system; Life Technologies), and the gene segment
encoding the HA1 region was sequenced. Critical amino acids (Lys-154,
Gln-156, Lys-173, Ser-186, Leu-194, Ser-199, Arg-220, Asn-246, and
Thr-248) of the HA1 in the virus from the original clinical sample were identical to those of the HA1 in the viruses passaged three times in
MDCK cells and in SJPL cells (Table 4).
In addition, the rest of the predicted amino acid sequences within HA1
were identical in the original virus and those grown in SJPL cells and
in MDCK cells. Unlike the viruses grown in MDCK cells and in SJPL
cells, influenza virus passaged in eggs contained two amino acid
substitutions in the HA (194L
I and 220RS).
View this table:
[in this window]
[in a new window]
|
TABLE 4.
Comparison of critical amino acids in the HA1 region of
viruses grown in MDCK cells, in SJPL cells, and in
eggsa
|
|
Influenza virus receptors on SJPL cells.
Influenza viruses
enter cells by binding to sialylglycoconjugates on the surface
(3, 4, 9, 26, 29). We determined whether influenza virus
receptors were present on the newly established SJPL cell line.
Receptor specificity was evaluated by incubating the cells with
digoxigenin (DIG)-labeled lectins and FITC-labeled anti-DIG
antibody (DIG glycan differentiation kit; Roche Molecular Biochemicals, Indianapolis, Ind.) and then performing flow-cytometric analysis (Fig. 3). MDCK cells and Mv1Lu
cells were included as controls. SJPL, MDCK, and Mv1Lu cells expressed
Sia2-3Gal- and Sia2-6Gal-containing sialylglycoconjugates on their
surfaces, but the numbers of receptors on the cell surface differed
among the cell lines (Fig. 3). The peak log intensity of
Sia2-3Gal-containing receptors on the surfaces of Mv1Lu cells was 1.4, and that of Sia2-6Gal-containing receptors was 1.7; the peak log
intensity of Sia2-3Gal-containing receptors on the surfaces of MDCK
cells was 1.65, and that of Sia2-6Gal-containing receptors was 2.3; and
the peak log intensity of Sia2-3Gal-containing receptors on the
surfaces of SJPL cells was 2.3, and that of Sia2-6Gal-containing receptors was 2.75. Therefore, SJPL cells have more Sia2-3Gal- and Sia2-6Gal-containing receptors than the other two cell lines (Fig.
3E and F).
View larger version (27K):
[in this window]
[in a new window]
|
FIG. 3.
Influenza virus receptors on SJPL and MDCK cells. SJPL
cells, MDCK cells, and Mv1Lu cells (3 × 106 of each)
were incubated with the DIG-labeled lectins Maackia
amurensis agglutinin (MAA), which binds specifically to Sia2-3Gal,
and Sambucus nigra agglutinin (SNA), which binds
specifically to Sia2-6Gal. The cells were incubated with a FITC-labeled
anti-DIG antibody and then subjected to flow-cytometric analysis. (A)
Mv1Lu cells after MAA binding; (B) Mv1Lu cells after SNA binding; (C)
MDCK cells after MAA binding; (D) MDCK cells after SNA binding; (E)
SJPL cells after MAA binding; (F) SJPL cells after SNA binding. The
controls for SJPL, MvILu, and MDCK were populations of cells that were
stained only with FITC-labeled anti-DIG antibody (unshaded profiles).
|
|
Influenza virus-induced damage in SJPL cells and in
MDCK cells.
It has been reported that influenza infection of
epithelial cells leads to apoptosis (13, 38). Using an
annexin V binding assay, a propidium iodide staining assay
(Annexin-V-Fluos staining kit; Roche Molecular Biochemicals), and
a DNA fragmentation assay, we determined whether influenza virus
infection of the newly established porcine lung epithelial cell
line also causes apoptosis. Annexin V is a
Ca2+-dependent phospholipid-binding protein with a
high affinity for phosphatidylserine that translocates from the inner
side of the plasma membrane to the outer side during an early stage of
apoptosis but not during necrosis (7, 25). Propidium
iodide binds to DNA of necrotic cells, which have damaged membranes,
but does not bind to DNA of apoptotic cells with intact membranes. Ten hours after infection, 43% of SJPL cells infected with A/Sydney/5/97 (H3N2) influenza virus were stained with propidium iodide, but less
than 1% of the population was detected with the Fluos-conjugated annexin V (Fig. 4B). Approximately 60%
of MDCK cells infected with A/Sydney/5/97 (H3N2) bound to annexin V,
and less than 1% were weakly stained with propidium iodide (Fig.
4D). Uninfected SJPL cells and MDCK cells did not either bind to
annexin V or stain with propidium iodide (Fig. 4A and C).
View larger version (37K):
[in this window]
[in a new window]
|
FIG. 4.
Annexin V-Fluos assays and propidium iodide staining of
SJPL and MDCK cells infected with A/Sydney/5/97 (H3N2). Ten hours after
the cells were infected with A/Sydney/5/97 (H3N2) (MOI, 5), they were
incubated with annexin V-Fluos and propidium iodide. (A) Uninfected
SJPL cells; (B) infected SJPL cells; (C) uninfected MDCK cells; (D)
infected MDCK cells.
|
|
We also determined DNA fragmentation of SJPL cells infected with
influenza viruses. The fragmentation of cellular DNA was determined as
described previously (13, 14) but with slight modifications. Approximately 5 × 106 MDCK cells and
5 × 106 SJPL cells were infected with influenza
viruses (MOI, 5), and cells were harvested 18 h after infection.
The harvested cells were washed in PBS and resuspended in 500 µl of
ice-cold lysis buffer (10 mM Tris [pH 7.5], 0.5% Triton X-100
[Sigma]) before they were incubated on ice for 30 min. The lysates
were centrifuged for 10 min at 12,000 × g at room
temperature to remove cellular debris and high-molecular-weight DNA,
and the supernatants were extracted once with buffered phenol and once
with buffered phenol-chloroform. DNA in the supernatants was collected
by ethanol precipitation with 3 M sodium acetate (pH 5.2). DNA was
dissolved in 20 µl of sterile water, treated with RNase A
(Sigma), and subjected to electrophoresis through 2% agarose (GTG
SeaKem agarose; FMC BioProducts, Rockland, Maine). SJPL cells
infected with A/Sydney/5/97 (H3N2), A/Chicken/NY/13307-3/95
(H7N2), and A/Swine/IA/17672/88 (H1N1) did not show signs of DNA
fragmentation (Fig. 5), whereas
MDCK cells infected with A/Sydney/5/97 (H3N2),
A/Chicken/NY/13307-3/95 (H7N2), and A/Swine/IA/17672/88 (H1N1)
exhibited DNA fragmentation. Uninfected SJPL cells and MDCK cells did
not show signs of DNA fragmentation.
View larger version (41K):
[in this window]
[in a new window]
|
FIG. 5.
DNA fragmentation in SJPL and MDCK cells. SJPL cells and
MDCK cells were infected with A/Sydney/5/97 (H3N2),
A/Chicken/NY/13307-3/95 (H7N2), or A/Swine/IA/17672/88 (H1N1) (MOI, 5),
and 18 h later DNA was collected for analysis. The collected DNA
was subjected to electrophoresis through a 2% agarose gel. The
lanes contained DNA from the following sources: M, molecular marker;
a, uninfected SJPL cells; b, SJPL cells infected with
A/Sydney/5/97 (H3N2); c, SJPL cells infected with
A/Chicken/NY/13307-3/95 (H7N2); d, SJPL cells infected with
A/Swine/IA/17672/88 (H1N1); e, uninfected MDCK cells; f, MDCK
cells infected with A/Sydney/5/97 (H3N2); g, MDCK cells infected
with A/Chicken/NY/13307-3/95 (H7N2); h, MDCK cells infected
with A/Swine/IA/17672/88 (H1N1).
|
|
Reverse transcriptase assay, RT-PCR analysis to detect
PERV, and tumorigenicity.
Recent progress in the field of
xenotransplantation has raised concerns about the possible transmission
of porcine endogenous retrovirus (PERV) to humans. Results of previous
studies showed that PERV from a porcine kidney cell line (PK15) can
infect many types of human cell lines (kidney, lung, muscle, and
lymphoid) in vitro (22, 28, 41). If PERV from the SJPL
cell line is present in the growth medium, then the SJPL cell line
would not be a suitable candidate for use in influenza virus vaccine
production. Because of this possibility of PERV contamination, we
assayed the level of reverse transcriptase activity in tissue culture supernatant of SJPL cells using a nonradioactive reverse transcriptase assay kit (Roche Molecular Biochemicals); with this assay, we could
detect any type of retrovirus that was present. Reverse transcriptase
activity was not detected in supernatants of SJPL cells, i.e., the
levels of activity were similar to background levels (optical density
at 450 nm of 0.05). In contrast, high levels of reverse transcriptase
activity (optical density at 450 nm of 1.5) were detected in medium
containing the positive control HIV-1 reverse transcriptase (Fig.
6A).
View larger version (69K):
[in this window]
[in a new window]
|
FIG. 6.
Reverse transcriptase assay and RT-PCR analysis. (A)
Reverse transcriptase activity in the supernatant of SJPL cells was
evaluated by using a nonradioactive reverse transcriptase assay. HIV-1
reverse transcriptase (0.125 ng/well in a 96-well plate) was used
as a positive control, and ABTS
[2',2-azino-di(3-ethyl-benzthiazoline-6-sulfonic acid)]
solution alone was used as a negative control. The sample was tested by
the assay four times. (B) Tissue culture supernatants and
cellular RNAs were collected from SJPL cells and PK-15 cells. RT-PCR
was performed as described in the text. Lanes: M, 100-bp DNA
marker; 1, tissue culture supernatant of SJPL cells; 2, cellular
RNAs of SJPL cells; 3, cellular RNAs of SJPL cells without reverse
transcriptase; 4, cellular RNAs of SJPL cells with  -actin primers;
5, tissue culture supernatant of PK-15 cells; 6, cellular RNAs of PK-15
cells; 7, cellular RNAs of PK-15 cells without reverse transcriptase;
8, cellular RNAs of PK-15 cells with -actin primers.
|
|
We also tested the presence of PERV in SJPL cells using PERV-specific
polymerase primers (41). As a positive control, the porcine kidney cell line PK-15 was used. RNA was extracted from cell
culture supernatant using the RNeasy mini kit, and total cellular RNA
was collected from cells using TRIzol reagent (Life Technologies). RNA
was reverse transcribed with a SuperScript first-strand synthesis
system for RT-PCR (Life Technologies) using random hexamers (50 ng).
The cDNA was amplified with the PERV-specific primers PB905
(5'CCGCAGGGATGGGTTTGGCAAAGCA3') and PB906
(5'ACGTACTGGAGGAGGGTCACCTGA') for 30 cycles at 94°C for
30 s, 60°C for 30 s, and 72°C for 1 min (41). The
PCR products were electrophoresed on a 1.5% agarose gel. A DNA ladder
(100 bp) was used as a marker. PERV was detected in both tissue culture
supernatants and cellular RNAs of PK-15 cells (Fig. 6B, lanes 5 and 6)
but was not detected in either tissue culture supernatants or cellular
RNAs of SJPL cells (Fig. 6B, lanes 1 and 2). PCR products were
sequenced to identify PERV-specific sequences (data not shown). To
confirm that PERV was from cellular RNAs rather than genomic DNAs,
reverse transcriptase was omitted during cDNA synthesis (Fig. 6B, lanes
3 and 7). As an internal control, -actin primers were used (Fig. 6B,
lanes 4 and 8). PERV-specific protease primers were also used as
described previously (28). We could amplify PERV in tissue
culture supernatants and cellular RNAs of PK-15 cells but not in SJPL
cells (data not shown).
It is known that MDCK cells cause tumors in nude mice
(10). We decided to test whether SJPL cells could cause
tumors in nude mice. SJPL or MDCK cells (3 × 106/mouse)
were inoculated into the dorsal necks of six nude mice, and tumor
development was monitored daily. The nude mice inoculated with MDCK
cells developed tumors around the neck and shoulders 3 weeks
postinfection, and all six nude mice developed tumors by 5 weeks
postinfection. In contrast, the six nude mice inoculated with SJPL
cells did not develop tumors (data not shown).
Efforts have been made to find cell lines that support the productive
replication of influenza virus and allow the virus to maintain its
original antigenicity. African green monkey kidney (Vero) cells fully
support replication of influenza A and B viruses (10), but influenza viruses have to be
extensively adapted before they can be grown in this cell
line. Repeated addition of trypsin to the culture medium is also needed
for multicycle growth of the influenza viruses (18). BHK
cells also support replication of influenza viruses, but growth in BHK
cells, like that in eggs, results in the selection of receptor-binding
variants of human influenza viruses (11). MDCK cells are
considered to be the best cell line for supporting the growth of
influenza viruses, but this cell line causes cancer in nude mice (10;
this study); MDCK cells have not been licensed for use in the
production of vaccine. Cold-adapted influenza virus vaccine can be
produced in specific-pathogen-free eggs, but in a pandemic, the supply of this type of egg would not be sufficient to meet demand.
An important advantage of SJPL cells for use in influenza vaccine
production is that propagation of human influenza A viruses in these
cells did not lead to antigenic changes in the HA molecule. Current
vaccines prepared from human influenza viruses adapted for growth in
eggs contain variants whose HA molecules differ from that of the
original human virus by at least one or two amino acids (16,
33). This variation may result in the immune escape of influenza
viruses in immunized humans. In a mouse model of influenza virus
infection, a single amino acid substitution in the HA molecule rendered
a candidate vaccine for an influenza A virus (H3) ineffective
(19). In that study, the virus with a substitution at
Lys-156 in the HA molecule was poorly immunogenic and did not prevent
infection by viruses that had been grown in MDCK cells. SJPL cells may
be a good candidate for use in producing a better human vaccine that
maintains the antigenicity of the original virus.
SJPL cells express Sia2-3Gal- and Sia2-6Gal-containing
sialylglycoconjugates, which serve as receptors for influenza virus. Ito et al. reported that receptors for human and avian influenza viruses are present on the surfaces of pig tracheal cells and suggested
that this finding may explain how pigs serve as mixing vessels in which
influenza viruses that can cause pandemics are created
(15). However, Mv1Lu and MDCK cells also express both receptors on their cell surface. It is possible that unknown cellular factors in addition to receptors on the cell surface are responsible for creating an environment within the pig for the generation of
human-avian virus reassortants.
Replication of influenza viruses, even those of the same subtype,
appeared to differ in SJPL and MDCK cells. Most subtypes of avian H5N1
influenza viruses isolated during an outbreak in the Hong Kong poultry
markets in 1997 grew well in SJPL cells and in MDCK cells, but the
titers of A/Chicken/HK/728/97 in SJPL cells and in MDCK cells and those
of the A/Goose/HK/437-4/97 in MDCK cells were 10- to
106.5-fold less than those of other viruses (Table 3).
Matrosovich et al. (27) reported that the receptor binding
properties of H5N1 viruses isolated from humans and birds in the Hong
Kong markets in 1997 are typical of avian but not human viruses. These
H5N1 viruses predominantly bind to Sia2-3Gal-containing
sialylglycoconjugates. H5N1 viruses with a carbohydrate at position 158 of HA bind more weakly to ovomucoid containing Sia2-3Gal
determinants than do H5N1 viruses without a carbohydrate at the same
residue. Because A/Chicken/HK/728/97 (H5N1) does not contain a
carbohydrate at position 158 of its HA molecule, the low titer of this
virus in the SJPL and MDCK cells is probably not due to weak binding to the surface receptors. In both cell lines, the titers of
A/Chicken/HK/258/97 (H5N1) with a carbohydrate at position 158 of HA
were higher than those of other H5N1 viruses. In addition to receptor
binding, other factors, including the set of genes within the virus,
also appear to be important in supporting replication in cell culture and, possibly, in vivo.
Our findings indicate that influenza virus-induced damage of SJPL cells
is due to necrosis rather than apoptosis; however, previous studies
showed that influenza virus infection of MDCK and HeLa cells results in
apoptosis (13, 38). The possible mechanisms of apoptosis
in HeLa and MDCK cells were reported. Influenza virus infection of HeLa
cells triggered the expression of Fas and Fas ligand on the cell
surface. Fas (CD95) is a cell surface receptor that transduces
apoptotic signal (2, 40). Apoptosis occurred in infected
MDCK cells with low levels of Bcl-2, but apoptosis was inhibited when
MDCK cells were stably transfected with a Bcl-2 expression plasmid
(13). Bcl-2 is known to regulate the mitochondrial
permeability transition pore (23, 24, 43). The difference
in influenza virus-induced damage among cell lines may be due to the
origins of the cells. However, at this time, we do not know why SJPL
cells do not undergo apoptosis like MDCK or HeLa cells.
Our study indicates that SJPL cells do not express PERVs. It was
reported that the established porcine cell lines express PERVs.
(1, 39). The reason why SJPL cells do not express PERVs
may be differences in the source of the original tissues.
This work was supported by Public Health Service grants AI29680 and
A795357 and Cancer Center Support (CORE) grant CA-21765 from the
National Institutes of Health and by the American Lebanese Syrian
Associated Charities (ALSAC).
We thank Scott Krauss and David Walker for excellent technical support,
Nadine Finley and Alice Herren for manuscript preparation, and Julia
Cay Jones for editorial assistance.
| 1.
|
Armstrong, J. A.,
J. S. Porterfield, and A. T. D. Madrid.
1971.
C-type virus particles in pig kidney cell lines.
J. Gen. Virol.
10:195-198[Abstract/Free Full Text]
|
| 2.
|
Ashkenazi, A., and V. M. Dixit.
1998.
Death receptors: signaling and modulation.
Science
281:1305-1308[Abstract/Free Full Text].
|
| 3.
|
Carroll, S. M., and J. C. Paulson.
1985.
Differential infection of receptor-modified host cells by receptor-specific influenza viruses.
Virus Res.
3:165-179[CrossRef][Medline].
|
| 4.
|
Connor, R. J.,
Y. Kawaoka,
R. G. Webster, and J. C. Paulson.
1994.
Receptor specificity in human, avian, and equine H2 and H3 influenza virus isolates.
Virology
205:17-23[CrossRef][Medline].
|
| 5.
|
Duvall, E., and A. H. Wyllie.
1986.
Death and the cell.
Immunol. Today
7:115-119[CrossRef]
|
| 6.
|
Endo, Y.,
K. N. Carroll,
M. R. Ikizler, and P. F. Wright.
1996.
Growth of influenza A virus in primary, differentiated epithelial cells derived from adenoids.
J. Virol.
70:2055-2058[Abstract].
|
| 7.
|
Fadok, V. A.,
D. R. Voelker,
P. A. Campbell,
J. J. Cohen,
G. L. Bratton, and P. M. Henson.
1992.
Exposure of phosphatidylserine on the surface of apoptotic lymphocytes triggers specific recognition and removal by macrophages.
J. Immunol.
148:2207-2216[Abstract].
|
| 8.
|
Frank, A. L.,
R. B. Couch,
C. A. Griffis, and B. D. Baxter.
1979.
Comparison of different tissue cultures for isolation and quantitation of influenza and parainfluenza viruses.
J. Clin. Microbiol.
10:32-36[Abstract/Free Full Text].
|
| 9.
|
Gambryan, A. S.,
A. B. Tuzikov,
V. E. Piskarev,
S. S. Yamnikova,
D. K. Lvov,
J. S. Robertson,
N. V. Bovin, and M. N. Matrosovich.
1997.
Specification of receptor-binding phenotypes of influenza virus isolates from different hosts using synthetic sialylglycopolymers: non-egg-adapted human H1 and H3 influenza A and influenza B viruses share a common high binding affinity for 6'-sialyl(N-acetyllactosamine).
Virology
232:345-350[CrossRef][Medline].
|
| 10.
|
Govorkova, E. A.,
G. Murti,
B. Meignier,
D. E. C. de Taisne, and R. G. Webster.
1996.
African green monkey kidney (Vero) cells provide an alternative host cell system for influenza A and B viruses.
J. Virol.
70:5519-5524[Abstract/Free Full Text].
|
| 11.
|
Govorkova, E. A.,
M. N. Matrosovich,
A. B. Tuzikov,
N. V. Bovin,
C. Gerdil,
B. Fanget, and R. G. Webster.
1999.
Selection of receptor-binding variants of human influenza A and B viruses in baby hamster kidney cells.
Virology
262:31-38[CrossRef][Medline].
|
| 12.
|
Hinshaw, V. S., and R. G. Webster.
1982.
The natural history of influenza A viruses, p. 79-104.
In
A. S. Beard (ed.), Basic and applied influenza research. CRC Press, Boca Raton, Fla.
|
| 13.
|
Hinshaw, V. S.,
C. W. Olsen,
N. Dybdahl-Sissoko, and D. Evans.
1994.
Apoptosis: a mechanism of cell killing by influenza A and B viruses.
J. Virol.
68:3667-3673[Abstract/Free Full Text].
|
| 14.
|
Ishida, Y.,
Y. Agata,
K. Shibahara, and T. Honjo.
1992.
Induced expression of PD-1, a novel member of the immunoglobulin gene superfamily, upon programmed cell death.
EMBO J.
11:3887-3895[Medline].
|
| 15.
|
Ito, T.,
J. N. Couceiro,
S. Kelm,
L. G. Baum,
S. Krauss,
M. R. Castrucci,
L. Donatelli,
H. Kida,
J. C. Paulson,
R. G. Webster, and Y. Kawaoka.
1998.
Molecular basis for the generation in pigs of influenza A viruses with pandemic potential.
J. Virol.
72:7367-7373[Abstract/Free Full Text].
|
| 16.
|
Katz, J. M.,
C. W. Naeve, and R. G. Webster.
1987.
Host cell-mediated variation in H3N2 influenza viruses.
Virology
156:386-395[CrossRef][Medline].
|
| 17.
|
Katz, J. M.,
M. Wang, and R. G. Webster.
1990.
Direct sequencing of the HA gene of influenza (H3N2) virus in original clinical samples reveals sequence identity with mammalian cell-grown virus.
J. Virol.
64:1808-1811[Abstract/Free Full Text].
|
| 18.
|
Kaverin, N. V., and R. G. Webster.
1995.
Impairment of multicycle influenza virus growth in Vero (WHO) cells by loss of trypsin activity.
J. Virol.
69:2700-2703[Abstract].
|
| 19.
|
Kodihalli, S.,
D. M. Justewicz,
L. V. Gubareva, and R. C. Webster.
1995.
Selection of a single amino acid substitution in the hemagglutinin molecule by chicken eggs can render influenza A virus (H3) candidate vaccine ineffective.
J. Virol.
69:4888-4897[Abstract].
|
| 20.
|
Lau, S. C., and C. Scholtissek.
1995.
Abortive infection of Vero cells by an influenza A virus (FPV).
Virology
212:225-231[CrossRef][Medline].
|
| 21.
|
Lennette, E. H., and N. J. Schmidt (ed.).
1969.
Diagnostic procedures for viral and rickettsial infections, 4th ed.
American Public Health Association, Inc., New York, N.Y.
|
| 22.
|
Le Tissier, P.,
J. P. Stoye,
Y. Takeuchi,
C. Patience, and R. A. Weiss.
1997.
Two sets of human-tropic pig retrovirus.
Nature
389:681-682[CrossRef][Medline].
|
| 23.
|
Liu, X.,
C. N. Kim,
J. Yang,
R. Jemmerson, and X. Wang.
1996.
Induction of apoptotic program in cell-free extracts: requirement for dATP and cytochrome c.
Cell
86:147-157[CrossRef][Medline].
|
| 24.
|
Mancini, M.,
D. W. Nicholson,
S. Roy,
N. A. Thornberry,
E. P. Peterson,
L. A. Casciola-Rosen, and A. Rosen.
1998.
The caspase-3 precursor has a cytosolic and mitochondrial distribution: implications for apoptotic signaling.
J. Cell Biol.
140:1485-1495[Abstract/Free Full Text].
|
| 25.
|
Martin, S. J.,
C. P. Reutelingsperger,
A. J. McGahon,
J. A. Rader,
R. C. van Schie,
D. M. LaFace, and D. R. Green.
1995.
Early redistribution of plasma membrane phosphatidylserine is a general feature of apoptosis regardless of the initiating stimulus: inhibition by overexpression of Bcl-2 and Abl.
J. Exp. Med.
182:1545-1556[Abstract/Free Full Text].
|
| 26.
|
Matrosovich, M. N.,
A. S. Gambaryan,
S. Teneberg,
V. E. Piskarev,
S. S. Yamnikova,
D. K. Lvov,
J. S. Robertson, and K. A. Karlsson.
1997.
Avian influenza A viruses differ from human viruses by recognition of sialyloligosaccharides and gangliosides and by a higher conservation of the HA receptor-binding site.
Virology
233:224-234[CrossRef][Medline].
|
| 27.
|
Matrosovich, M.,
N. Zhou,
Y. Kawaoka, and R. Webster.
1999.
The surface glycoproteins of H5 influenza viruses isolated from humans, chickens, and wild aquatic birds have distinguishable properties.
J. Virol.
73:1146-1155[Abstract/Free Full Text].
|
| 28.
|
Patience, C.,
Y. Takeuchi, and R. A. Weiss.
1997.
Infection of human cells by an endogenous retrovirus of pigs.
Nat. Med.
3:282-286[CrossRef][Medline].
|
| 29.
|
Paulson, J. C.
1985.
Interactions of animal viruses with cell surface receptors, p. 131-219.
In
M. Conn (ed.), The receptors, vol. 2. Academic Press, Orlando, Fla.
|
| 30.
|
Platt, N.,
R. P. da Silva, and S. Gordon.
1998.
Recognizing death: the phagocytosis of apoptotic cells.
Trends Cell Biol.
8:365-372[CrossRef][Medline].
|
| 31.
|
Reina, J.,
V. Fernadez-Baca,
I. Blanco, and M. Munar.
1997.
Comparison of Madin-Darby canine kidney cells (MDCK) with a green monkey continuous cell line (Vero) and human lung embryonated cells (MRC-5) in the isolation of influenza A virus from nasopharyngeal aspirates by shell vial culture.
J. Clin. Microbiol.
35:1900-1901[Abstract].
|
| 32.
|
Robertson, J. S.,
J. S. Bootman,
C. Nicolson,
D. Major,
E. W. Robertson, and J. M. Wood.
1990.
The hemagglutinin of influenza B virus present in clinical material is a single species identical to that of mammalian cell-grown virus.
Virology
179:35-40[CrossRef][Medline].
|
| 33.
|
Robertson, J. S.,
C. W. Naeve,
R. G. Webster,
J. S. Bootman,
R. Newman, and G. C. Schild.
1985.
Alterations in the hemagglutinin associated with adaptation of influenza B virus to growth in eggs.
Virology
143:166-174[CrossRef][Medline].
|
| 34.
|
Robertson, J. S.,
P. Cook,
A. M. Attwell, and S. P. Williams.
1995.
Replicative advantage in tissue culture of egg-adapted influenza virus over tissue-culture derived virus: implications for vaccine manufacture.
Vaccine
13:1583-1588[CrossRef][Medline].
|
| 35.
|
Schild, G. C.,
J. S. Oxford,
J. C. de Jong, and R. G. Webster.
1983.
Evidence for host-cell selection of influenza virus antigenic variants.
Nature
303:706-709[CrossRef][Medline].
|
| 36.
|
Scholtissek, C.,
H. Burger,
O. Kistner, and K. F. Shortridge.
1985.
The nucleoprotein as a possible major factor in determining host specificity of influenza H3N2 viruses.
Virology
147:287-294[CrossRef][Medline].
|
| 37.
|
Seo, S. H., and E. W. Collisson.
1997.
Specific cytotoxic T lymphocytes are involved in in vivo clearance of infectious bronchitis virus.
J. Virol.
71:5173-5177[Abstract].
|
| 38.
|
Takizawa, T.,
S. Matsukawa,
Y. Higuchi,
S. Nakamura,
Y. Nakanishi, and R. Fukuda.
1993.
Induction of programmed cell death (apoptosis) by influenza virus infection in tissue culture cells.
J. Gen. Virol.
74:2347-2355[Abstract/Free Full Text].
|
| 39.
|
Tumilowicz, J. J.,
C.-L. Hung, and B. Kramarsky.
1979.
Concurrent replication of a papovavirus and a C-type virus in the CCL 33 porcine cell line.
In Vitro
15:922-928[Medline].
|
| 40.
|
Wallach, D.,
E. E. Varfolomeev,
N. L. Malinin,
Y. V. Goltsev,
A. V. Kovalenko, and M. P. Boldin.
1999.
Tumor necrosis factor receptor and Fas signaling mechanisms.
Annu. Rev. Immunol.
17:331-367[CrossRef][Medline].
|
| 41.
|
Wilson, C. A.,
S. Wong,
J. Muller,
C. E. Davidson,
T. M. Rose, and P. Burd.
1998.
Type C retrovirus released from porcine primary peripheral blood mononuclear cells infects human cells.
J. Virol.
72:3082-3087[Abstract/Free Full Text].
|
| 42.
|
Wyllie, A. H.,
J. F. R. Kerr, and A. R. Currie.
1980.
Cell death: the significance of apoptosis.
Int. Rev. Cytol.
68:251-306[Medline].
|
| 43.
|
Zamzami, N.,
S. A. Susin,
P. Marchetti,
T. Hirsch,
I. Gomez-Monterrey,
M. Castedo, and G. Kroemer.
1996.
Mitochondrial control of nuclear apoptosis.
J. Exp. Med.
183:1533-1544[Abstract/Free Full Text].
|
![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Top
Abstract
Text
