Previous Article | Next Article 
Journal of Virology, October 2001, p. 9415-9426, Vol. 75, No. 19
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.19.9415-9426.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
RING Finger Z Protein of Lymphocytic
Choriomeningitis Virus (LCMV) Inhibits Transcription and RNA
Replication of an LCMV S-Segment Minigenome
Tatjana I.
Cornu and
Juan Carlos
de la
Torre*
Division of Virology, Department of
Neuropharmacology, The Scripps Research Institute, La Jolla, California
92037
Received 26 January 2001/Accepted 22 June 2001
 |
ABSTRACT |
Arenaviruses have a bisegmented negative-strand RNA genome whose
proteomic capability is limited to only four polypeptides, namely,
nucleoprotein (NP), surface glycoprotein (GP) that is proteolytically
processed into GP1+GP2, polymerase (L), and a small (11-kDa) RING
finger protein (Z). The role of Z during the Lymphocytic
choriomeningitis virus (LCMV) life cycle is poorly understood.
We investigated the function of Z in virus transcription and
replication by using a reverse genetic system for the prototypic arenavirus LCMV. This system involves an LCMV minigenome and the minimal viral trans-acting factors (NP and L), expressed
from separated cotransfected plasmids. Cotransfection of the Z cDNA strongly inhibited LCMV minigenome expression. The effect required synthesis of Z protein; its magnitude was dose dependent and occurred with levels of Z protein substantially lower than those observed in
LCMV-infected cells. Coexpression of Z did not prevent the encapsidation of plasmid supplied minigenome, but it affected both
transcription and RNA replication similarly. Mutations in Z that
unfolded its RING finger domain eliminated its inhibitory activity, but
RING proteins not related to Z did not affect LCMV minigenome
expression. Consistent with the minigenome results, cells transiently
expressing Z exhibited decreased susceptibility to infection with LCMV.
 |
INTRODUCTION |
Lymphocytic choriomeningitis
virus (LCMV) is the prototypic member of the family
Arenaviridae, which includes important human pathogens such
as Lassa fever and Junin viruses (11, 41, 43, 53,
55). In addition, LCMV provides one of the most widely used model systems to study viral persistence and pathogenesis (7, 10, 37, 38, 39, 40, 45).
The LCMV genome consists of two negative-sense single-stranded RNA
segments, L and S, with approximate sizes of 7.2 and 3.4 kb,
respectively (44, 48, 52, 53). Each RNA segment has an
ambisense coding strategy, encoding two proteins in opposite orientations, separated by an intergenic region (IGR) (48,
53). The S RNA directs synthesis of the three major structural
proteins: the nucleoprotein, NP (ca. 63 kDa) (44, 48, 53),
and the two virion glycoproteins, GP-1 (40 to 46 kDa) and GP-2 (35 kDa), which are derived by posttranslational cleavage of a precursor polypeptide, GP-C (75 kDa) (48, 53, 54, 60). Tetramers of
GP-1 and GP-2 make up the spikes on the virion envelope and mediate
virus interaction with host cell surface receptor (6, 13).
The L RNA segment encodes a high-molecular-mass protein (L, ca. 200 kDa) (52), which has the characteristic motifs conserved in all of the viral RNA-dependent RNA polymerases (46),
and a small (11-kDa) RING finger protein (Z) (50). The NP,
the most abundant viral protein in virus-infected cells, is associated with the viral RNA to form the nucleocapsid (NC), which is the template
for the viral RNA polymerase (23, 24). The L protein is
thought to be the main viral component of the arenavirus polymerase (23, 48, 53). The NC associated with the viral polymerase constitutes the viral ribonucleoprotein (RNP), which is active in virus
transcription and replication (23, 48, 53). As with other
negative-strand RNA viruses, this RNP is the minimum unit of LCMV infectivity.
The investigation of the molecular mechanisms underlying LCMV
persistence and its associated disorders has been hampered by the lack
of a genetic system to analyze the structure and function of the LCMV
genome and its gene products. We recently described a system in which
RNA synthesis, both transcription and replication, mediated by LCMV
polymerase is reconstituted by intracellular coexpression of an LCMV
minigenome and viral proteins from transfected plasmids
(33). This allowed us to initiate the analysis of
cis- and trans-acting elements required for
replication and transcription of the LCMV genome. Using this system we
showed that the 5' and 3' untranslated regions (UTRs), together with
the IGR of the S RNA, are sufficient cis-acting signals to
allow RNA synthesis mediated by LCMV RNA polymerase (33),
although it remains to be determined which of these elements is
strictly required for virus replication and transcription. We also
demonstrated that NP and L are the minimal trans-acting
viral factors required for replication and transcription of LCMV genome
analogues (33).
The Z proteins are highly conserved among the arenaviruses
(27). Results from in vitro transcription and
immunodepletion studies have implicated Z in both genome replication
and mRNA synthesis in Tacaribe virus (25). However, Z was
not required for intracellular transcription and replication of the
LCMV minigenome (33). Biochemical and immunological
studies have suggested that Z might be the arenavirus counterpart of
the matrix (M) protein found in other negative-strand RNA viruses
(48, 49). Moreover, Z has been shown to interact with
several host cell proteins. The association of Z with the eukaryotic
initiation factor 4E (eIF-4E) has been implicated in repression of
protein synthesis in an eIF-4E-dependent manner (12). Z
interacts also with the promyelocytic leukemia (PML) protein, leading
to the relocation of PML nuclear bodies to the cytoplasm, a process
which has been proposed to be responsible for the noncytolytic nature
of LCMV (3, 5). Together, these observations raise
intriguing questions about a spectrum of potential functions played by
the Z protein in the biology of arenavirus. Here, we present evidence
that the Z protein, in a dose-dependent manner, is a potent inhibitor
of intracellular transcription and replication of the LCMV minigenome. We also show that the structural integrity of the RING finger domain is
required for this inhibitory activity, whereas other RING proteins, not
related to Z, do not cause inhibition of RNA synthesis mediated by LCMV
polymerase in the minigenome assay. Moreover, transiently transfected
cells expressing Z at levels similar to those seen at 24 h
postinfection (p.i.) during the natural course of LCMV infection
exhibited decreased susceptibility to infection with LCMV.
 |
MATERIALS AND METHODS |
Cells and viruses.
Baby hamster kidney cells (BHK-21) were
grown in Dulbecco modified minimal essential medium supplemented with
heat-inactivated (55°C for 30 min) 10% fetal calf serum, 2 mM
L-glutamine, 1× tryptose phosphate broth, 1 mM sodium
pyruvate, and 0.5% glucose. BSRT7 cells (9) were grown in
minimal essential medium supplemented with 10% fetal calf serum, 2 mM
L-glutamine, 1× tryptose phosphate broth, 1× minimal
essential medium amino acids. Selection of BSRT7 cells was performed
using G418 (1 mg/ml). Infections with LCMV strain Armstrong (Arm) were
done using a plaque isolated clonal virus population (47).
Plasmids and DNA transfection.
Plasmids pLCMVSCAT2,
pCITE-NP, pGEM-L, and pUCIRES-Z have been described (33),
as well as plasmids pT7110 (20) and RMX-PML (31). Plasmid pTMI-GFP was generated by cloning the open
reading frame (ORF) of the green fluorescent protein (GFP) into the
NcoI site of pTMI (34). Plasmid pCITE-rho was
generated by inserting a XbaI/BamHI DNA fragment
containing the chicken rhomboid full-length cDNA (courtesy
of A. Bang) into XbaI/BamHI-digested
pCITE2a(+) vector (Novagen). To generate plasmid pGEM-IE86, the IE84
ORF of human cytomegalovirus (huCMVIE84), present in plasmid
RSV-IE86 (26), was amplified by PCR using specific primers
FIE86#1 (5'-CGGGATCCATGGAGTCCTCTGCCAAGAGAAAG) and
BIE86#2 (5'-GCTCTAGAAGTTTTTCACTTACTGAGACTTGTTC)
and the following PCR conditions: 5 min at 94°C; 25 cycles of 1 min at 94°C, 1 min at 58°C, and 3 min at 72°C; and finally 10 min
at 72°C with Pfu polymerase (Roche). PCR product
was purified with the PCR purification kit Concert rapid PCR
purification system (Life Technologies). Purified PCR product was
digested with XbaI and BamHI, purified, and
cloned into XbaI/BamHI sites of pGEM-3Z
(Promega). Restriction sites XbaI and BamHI at
the 5' end of the primers are underlined.
To generate plasmid pUCIRESZ-stop, two stop codons and a frameshift
insertion were introduced immediately after the start codon of the Z
ORF by site-directed mutagenesis. For this, the Z gene was amplified by
PCR from pUCIRES-Z with two specific primers: FLCMVZ#1
(5'-CATGCCATGGGTTAATAAACAAGGCAAGTCCAGAGGAGAAAG),
carrying the mutations, and the reverse primer BLCMVZ#2 (5'-
AAAAGGCCTCCCGGGTTACTCTTCGTAGGGAGGTGGAG). Restriction sites NcoI and StuI at the 5' end of
the primers are underlined. PCR conditions were as follows: 5 min at
94°C; 25 cycles of 1 min at 94°C, 1 min at 58°C, and 1 min at
72°C; and finally 10 min at 72°C, using Taq polymerase
(Roche). PCR product was purified on a column with the PCR
purification kit (Life Technologies), digested with NcoI and
StuI and cloned in the backbone fragment of pUCIRES-Z, which
also was digested with NcoI and StuI.
Plasmid pUCIRESZ-F32G35 was generated by overlap extension PCR in two
steps. In the first step, plasmid pUCIRES-Z (10 ng)
was used as a
template for PCR fragment 1 using primers FLCZtag1
(5'-CATG
CCATGGGTCAAGGCAAGTCC) and BLCZF32-G35
(5'-TCTGCCAGCCAGATTTGAAGCTTAAAGGGCCAAGATAGG)
carrying the
point mutations. In a parallel step, plasmid pUCIRES-Z
(10 ng) was used
as a template for PCR fragment 2 with primers
FLCZF32-G35
(5'-CTTCAAATCTGGCTGGCAGAAATTTGACAG), carrying the
point
mutations, and BLCMVZ#2 (previously described). The two
PCR fragments
(i.e., from independent PCRs 1 and 2) were generated
with
Pfu polymerase (Roche) by using the same cycling parameters:
5 min at 94°C; 25 cycles of 1 min at 94°C, 1 min at 58°C, and
1 min at 72°C; and finally 10 min at 72°C. Fragments were gel
purified with the QIAquick gel extraction kit (Qiagen). In a second
step, PCR fragments 1 and 2 were combined and fused by overlap
extension PCR using primers FLCZtag1 and BLCMVZ#2 and the following
cycling conditions: 5 min at 94°C; 25 cycles of 1 min at 94°C,
1 min 30 s at 58°C, and 1 min at 72°C; and finally 10 min at
72°C.
The final 300-bp product was gel purified, digested with
NcoI
and
StuI, and then ligated into an
NcoI/
StuI backbone fragment
of pUCIRES-Z. The
restriction site
NcoI in primer FLCZtag1 is
underlined.
Transfection of BHK-21 cells was performed with 10 µl of
Lipofectamine (Life Technologies) per 35-mm well and the indicated
amount of plasmid DNA. BSRT7/5 cells stably expressing T7 polymerase
were transfected with 2 µl of SuperFect (Qiagen) and 1 µg of DNA
Analysis of minigenome expression.
The analysis of LCMV
minigenome expression was done essentially as described previously
(33). Briefly, BHK-21 cells were infected with vTF7.3 at a
multiplicity of infection (MOI) of 3 and transfected with pLCMVSCAT2,
pCITE-NP, pGEM-L, pTMI-GFP, and different amounts of plasmid DNA
encoding Z-wt, Z-mutant, and other RING finger proteins as indicated in
the corresponding figure legends. Plasmid pLCMVSCAT2 directs
intracellular T7-mediated synthesis of the LCMVSCAT2 minigenome in
which the viral NP and GP ORF encoded by the S RNA have been replaced
by an antisense (AS) copy of the chloramphenicol acetyltransferase
(CAT) ORF. The CAT AS ORF is flanked by the 5' UTR-IGR and 3' UTR of
the LCMV S RNA. Plasmid pTMI-GFP was included to assess the efficiency of transfection based on GFP expression. In all cases, the amount of
DNA used in the transfections was normalized to 2.7 µg/M6 well by
using pTMI plasmid. Transfections were performed by using
Lipofectamine. We included 1-
-D-arabinofuranosylcytosine
(50 µg/ml) to inhibit the late phase of vaccinia virus expression.
Cells were resuspended in 2 ml of phosphate-buffered saline (PBS) and
split into two aliquots. After the cells were spun, one aliquot was
resuspended in 50 µl of 0.25 M Tris-HCl (pH 7.5), and cell lysates
were prepared and assayed for CAT activity. The second aliquot was
resuspended in lysis buffer (50 mM Tris-HCl, pH 8; 62.5 mM EDTA; 1%
NP-40; 0.4% deoxycholate) and used for analysis of protein expression.
Western blot assay.
Protein expression from pT7-110
(20), RMX-PML (31), pUCIRESZ-stop, and
pUCIRESZ-F32G35, as well as pCITE-NP and pGEM-L, was analyzed by
Western blot. For this, BHK-21 cells were infected with vTF7.3 at an
MOI of 3, followed by transfection using Lipofectamine with the
above-mentioned plasmids. Cells were harvested in lysis buffer and
subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE), followed by blotting on a polyvinyidene difluoride
Immobilon-P membrane (Millipore). Expression of Vmw110 was detected
using a mouse monoclonal antibody to VmW110 (ascites 1106 [20]). PML expression was detected by using a rabbit
anti-PML antibody. The LCMV Z wild-type and mutant proteins were
detected with a rabbit anti-Z antiserum. Rabbit antisera to PML and
LCMV Z were obtained from R. Evans (31) and M. Salvato
(49), respectively. Appropriate secondary antibodies
(anti-mouse and anti-rabbit) conjugated to peroxidase were used at
dilutions recommended by the supplier (Roche). Expression of LCMV NP
and L proteins was detected using a guinea pig and a rabbit polyclonal
serum to LCMV (54) and to L (33),
respectively. Proteins were visualized by enhanced chemiluminescence
(ECL; Roche). The amount of protein in the lysates was quantified with
a Bio-Rad protein assay kit. The mouse monoclonal antibody to huCMVIE84
did not work in a Western blot. Hence, detection of this protein
was done by immunofluorescence.
CAT assays.
Whole-cell extracts were prepared by three
freeze-thawing cycles in a dry ice-ethanol bath and at 37°C in a
water bath. Cell extracts were clarified by centrifugation: 12,000 × g for 5 min at 4°C. Equal amounts (5 µl) of each
sample were incubated 30 min at 37°C in the presence of 0.25 M Tris
(pH 7.8), 0.6 mg of acetyl coenzyme A (Roche)/ml, and 0.05 µCi of
14C-labeled chloramphenicol (ICN). The reaction
was stopped by adding 1 ml of ethyl acetate, and chloramphenicol was
extracted by separating the phases by centrifugation. Then, 900 µl of
supernatant was dried, resuspended in 25 µl of ethyl acetate, and
analyzed by thin-layer chromatography (TLC). Samples were run for 30 min in CHCl3-methanol (95:5). The TLC plate was
dried and exposed to an X-ray film.
Immunofluorescence.
Cells grown onto coverslips and placed
on the bottom of the wells of an M24 plate were washed once with PBS
and fixed in 100% methanol for 5 min at
20°C. After several washes
with PBS and a blocking step with 10% normal goat serum in PBS for 15 min at room temperature, cells were incubated for 1 h at room
temperature with the appropriate primary antibodies, i.e., mouse
monoclonal antibodies to huCMVIE86, c-myc, or vesicular stomatitis
virus (VSV) M; a guinea pig polyclonal antibody to LCMV; and a rabbit polyclonal antibody to Z or to the cytoplasmic tail of VSV G. After
several washes with PBS-0.1% Triton X-100, samples were incubated for
45 min at room temperature with appropriate secondary fluorescent
antibodies: fluorescein isothiocyanate (FITC)-labeled goat anti-mouse
immunoglobulin G (IgG), Texas red (TXR)-labeled goat anti-mouse IgG,
FITC-labeled goat anti-guinea pig IgG, and TXR-labeled goat anti-rabbit
IgG. After extensive washes with PBS-0.1% Triton X-100, coverslips
were mounted using mowiol and analyzed by fluorescence
microscopy. Slides were digitized by using Adobe Photoshop and Canvas software.
Analysis of RNA by Northern blot hybridization.
BHK-21 cells
infected with LCMV Arm5 at an MOI of 3 or else transfected with
plasmids LCMV Z-wt and Z-stop were harvested at the time points
indicated and homogenized in TRIreagent (Molecular Research Center,
Inc.). RNA was extracted according to the supplier's protocol and
resuspended in Formazol (Nuclear Research Center, Inc.). RNA (5 µg) was fractionated by 2.2 M formaldehyde agarose (1.2%) gel
electrophoresis. The gel was washed first in warm diethyl pyrocarbonate-H2O and then in warm 10 mM
NaPO4. Transfer was performed overnight in 20×
SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate) with a Nytran
0.22-µm (pore-size) membrane (Schleicher & Schuell). RNA was
cross-linked by exposure to UV and, after a brief wash with
H2O, the membrane was prehybridized in QuickHyb (Stratagene) for 30 min at 65°C. Hybridization was done at 65°C for
2 h with an NP
Z-DNA [
-32P]dCTP
probe, using 5 ng of probe (specific activity,
>109 cpm/µg)/ml and 100 µg of denatured
salmon sperm DNA. For detection of CAT mRNA and the antiminigenome RNA,
the membrane was hybridized with a
[32P]UTP-labeled AS CAT riboprobe. Riboprobe
was prepared according to the supplier's protocol (Ambion). Briefly,
linearized DNA was incubated for 1 h at 37°C with T7 polymerase,
[32P]rUTP, rATP, rCTP, rGTP, and RNase
inhibitor; subsequently, the DNA template was digested for 15 min at 37°C with DNase RNase Free (Boehringer Mannheim), and finally
the RNA probe was precipitated and resuspended in 0.5 mM EDTA. The
membrane was prehybridized for 1 h at 65°C in Ambion Zip
hybridization solution (Ambion) and hybridized overnight with the
riboprobe (3 × 106 cpm/ml). After
hybridization (in both cases), the membranes were washed twice with
warm 2× SSC-0.2% SDS, washed twice with warm 0.2× SSC-0.2% SDS,
and then exposed to an X-ray film.
Analysis of encapsidated RNA.
Cytosolic extracts were
prepared from transfected and LCMV-infected cells by incubating them on
ice for 15 min in hypotonic buffer (10 mM Tris, pH 7.5; 10 mM KCl; 1.5 mM MgCl2; 5 mM dithiothreitol [DTT]; 0.5%
NP-40). Clarified lysates were incubated 5 min with NaCl to a final
concentration of 0.5 M and then loaded onto the top of a discontinuous
5 and 0.5 M CsCl2 gradient in TNE buffer (10 mM
Tris, pH 7.8; 150 mM NaCl; 5 mM EDTA). After 3 h of
centrifugation, the interphase between the 5 and 0.5 M
CsCl2 containing the RNP was removed, diluted 1:1
with TNE buffer, and recentrifuged for 1 h to pellet the RNP.
RNP-containing pellets were resuspended in 500 µl of TRIreagent, and
encapsidated RNA was isolated and analyzed by reverse transcription-PCR
(RT-PCR). RNA isolated from S-segment minigenome RNP was reverse
transcribed with Superscript (Life Technologies) and the CAT sense
primer BSM1CAT (5'- GATGAATGCTCATCCGGAATTCCG). The resulting
cDNA was amplified by PCR using primer BSM1CAT and the CAT AS primer
PFLM1CAT (5'-CCCAGGGATTGGCTGAGACAAAAAACATATTC). RNA isolated
from bona fide LCMV RNP was reverse transcribed using the NP sense
primer NP2750F (5'-GTCTGTGACTGTTTGGCCATAC), and the resulting cDNA was amplified by PCR with primers NP2750F and NP3103R (5'-CCAGACTGTACATTCTCTTGTGG), which produced an NP fragment
of 350 bp. PCR conditions were as follows: 5 min at 94°C; 35 cycles of 1 min at 94°C, 1 min at 55°C, and 1 min at 72°C; and finally 10 min at 72°C. PCR was performed using Taq polymerase
(Roche). PCR products were resolved by agarose (2%) gel
electrophoresis and visualized by ethidium bromide staining.
Preparation of LCMV RNP and transfection of cells with RNP. (i)
RNP preparation.
Cells were washed once with ice-cold PBS,
collected (5 min, 800 × g, 4°C), and resuspended
(107 cells/ml) in ice-cold hypotonic HB buffer
(10 mM Tris-HCl, pH 7.5; 10 mM KCl; 1.5 mM MgCl2;
5 mM DTT) containing 0.5% of the nonionic detergent NP-40. After a
15-min incubation in ice, samples were centrifuged (5 min, 1,000 × g, 4°C). The supernatant (cytosolic fraction) was saved
on ice, and the nuclear pellet washed with 0.5 volume of HB
buffer-0.5% NP-40. Both supernatants were combined (cytosolic
fraction) and clarified by centrifugation (10 min, 15,000 × g, 4°C). Clarified cytosolic fraction was adjusted to 1%
NP-40, and RNP was collected by ultracentrifugation (60 min, 100,000 × g, 4°C) through a discontinuous 50 to 25%
glycerol gradient in buffer I (75 mM NaCl; 10 mM Tris-HCl, pH 7.5; 2 mM
DTT; 1% NP-40). The microsome pellet containing RNP was resupended in HB buffer containing 40% glycerol. Samples were stored at
80°C.
(ii) RNP transfection.
Procedures for RNP transfection were
essentially as described previously (16). Briefly, cell
monolayers were washed with Opti-MEM containing 100 µg of autoclaved
gelatin (OpM-G)/ml. After treatment for 30 min at room temperature with
OpM-G containing DEAE-dextran (5 × 105 Da;
300 µg/ml) and dimethyl sulfoxide (0.5%), cells were washed once
with OpM-G. RNP, diluted in OpM-G, and adsorbed (300 µl/35-mm well) for 60 min at 37°C; cells were then washed twice with
OpM-G and 2.5 ml of medium containing 1% fetal bovine serum was added per M6 well.
 |
RESULTS |
Effect of LCMV Z on the expression of an LCMV S-segment
minigenome.
To investigate the role played by Z in the control of
LCMV RNA synthesis, we used a reverse genetic system that enabled us to
rescue the expression of a plasmid-derived LCMV minigenome. In this
system the Z protein is not necessary for minigenome RNA synthesis
mediated by the LCMV polymerase (33). Moreover, Z appeared
to have a negative impact on the minigenome expression (33). To better understand the mechanism underlying this
effect, we evaluated the consequences of incrementally increasing
amounts of the Z expression plasmid in the minigenome rescue assay. Z caused inhibition of CAT enzymatic activity in a dose-dependent manner
(Fig. 1A). Transfection of 20 ng of Z
plasmid was sufficient to significantly decrease CAT activity (Fig. 1A,
lane 4), whereas 100 ng of the Z plasmid was able to completely abolish
CAT activity specifically mediated by the LCMV polymerase (compare
lanes 6 and 8 in Fig. 1A).

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 1.
LCMV Z inhibits CAT expression by the LCMVSCAT2
minigenome in a dose-dependent manner. BHK-21 cells were infected with
vTF7.3 (MOI = 3) and subsequently cotransfected with 0.5 µg of
pLCMVSCAT2, 1.5 µg of pCITE-NP, 0.1 µg of pGEM-L, 0.1 µg of
pTMI-GFP, and increasing amounts of pUCIRES-Z as indicated. Plasmid
pGEM-L was not added in lane 8. In all of the samples the total amount
of DNA was kept constant (2.7 µg) by adding the appropriate amount of
plasmid pTMI. The use of pTMI-GFP allowed us to determine the
efficiency of transfection, based on number of GFP-positive cells,
prior harvesting of the cells for CAT assays, and protein expression
analysis. (A) LCMVSCAT2 minigenome expression. At 24 h after
transfection, cell lysates were prepared for measuring CAT activity as
described in Material and Methods. (B) Z protein expression. Cell
lysates were subjected to SDS-PAGE, and the levels of Z protein
expression were determined by Western blot using a rabbit antibody to
Z. Lysate applied in lane 1 was prepared from cells infected with LCMV
(MOI = 3) at 24 h p.i. The position of the Z protein is
indicated on the right, and the molecular size markers are indicated on
the left. O, origin; Cm, chloramphenicol; MAc, monoacetylated
chloramphenicol; DAc, diacetylated chloramphenicol.
|
|
Coexpression of increasing amounts of Z plasmid resulted in concomitant
increase in the expression of Z protein (Fig
1B).
The amount of Z
protein required to completely inhibit minigenome
derived CAT activity
was slightly lower than that found in LCMV
infected cells (MOI = 3) at 24 h p.i. (compare lanes 1, 6, and
7 in Fig.
1B). We next
examined whether the inhibitory effect
associated with the Z plasmid
depended upon its ability to express
Z protein or whether this was a
consequence of the synthesis of
its mRNA. For this, we generated the
construct Z-stop by insertion
of two stop codons and a frameshift
mutation right after the AUG
translational start site of Z (Fig.
2A). These mutations would
enable
transcription of the Z gene but should abolish translation
of the
protein. As predicted, cells transfected with Z and Z-stop
expressed
similar levels of Z RNA (data not shown), but Z protein
was not
detected in cells transfected with Z-stop (Fig.
2B). We
then evaluated
the effect of Z-stop mutant on the expression of
CAT enzyme by the
LCMVSCAT2 minigenome complemented by NP and
L plasmids. The Z-wt
plasmid caused the expected strong inhibition
of CAT expression,
whereas the Z-stop plasmid had no effect on
CAT expression (Fig.
2C).

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 2.
Inhibitory effect of the Z plasmid requires synthesis of
the Z protein. (A) Nucleotide sequence differences between Z-wt and the
Z-stop mutant. The Z-stop mutant contains two stop codons (underlined)
inserted downstream of the ATG start codon. The insertion of an
additional A ( ) into the Z-stop construct created a frameshift of
the downstream reading frame. (B) The Z-stop mutant is unable to
produce the Z protein. BHK-21 cells were infected with vTF7.3 (MOI = 3) and transfected with 0.5 µg of pUCIRES-Z or 0.5 µg of
pUCIRESZ-stop. Lysates were prepared 24 h after transfection and
subjected to SDS-PAGE. Z protein expression was detected by Western
blotting with a rabbit antiserum to Z. The position of the Z protein is
indicated on the right, and the molecular size markers are indicated on
the left. (C) The Z-stop mutant does not inhibit CAT activity by the
LCMVSCAT2 minigenome. BHK-21 cells were infected with vTF7.3 (MOI = 3) and cotransfected with 0.5 µg of pLCMVSCAT2, 1.5 µg of
pCITE-NP, 0.1 µg of pGEM-L, 0.1 µg of pTMI-GFP, and increasing
amount of pUCIRES-Z or pUCIRESZ-stop as indicated. Plasmid pGEM-L was
not added in lane 12. In all of the samples the amount of DNA was kept
constant by adding plasmid pTMI to 2.7 µg. At 24 h after
transfection, the samples were assayed for CAT activity as described in
Materials and Methods. O, origin; Cm, chloramphenicol; MAc,
monoacetylated chloramphenicol; DAc, diacetylated chloramphenicol.
|
|
Since the LCMV NP and the L proteins are required to rescue LCMV
minigenome expression (
33), we assessed whether in our
transfection assay coexpression of Z protein could interfere with
NP
and/or L expression. For this purpose, cells were cotransfected
with
plasmids expressing NP and L, together with increasing amounts
of Z,
and cell lysates were analyzed for NP, L, and Z expression
by Western
blot. Expression levels of NP and L proteins were not
affected by
coexpression of Z (Fig.
3).

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 3.
Expression of Z protein does not affect plasmid-derived
expression of NP or L. Equal amounts of cell lysates were separated
either on an SDS-10% PAGE gel for the detection of NP and L protein
expression or on an SDS-16% PAGE gel to detect Z protein expression.
Lysates in lanes 2 to 5 and lanes 8 to 11 were prepared from cells
infected with vTF7.3 (MOI = 3) and transfected with 1 µg of
pCITE-NP and 1 µg of pGEM-L. The amount of cotransfected pUCIRES-Z is
indicated at the top. Lysate prepared from mock-infected cells was
loaded in lanes 6 and 12, whereas lysate from LCMV-infected cells was
loaded in lanes 1 and 7. The positions of the L, NP, and Z protein are
indicated on the right, and the molecular size markers are indicated on
the left. Consistent with previous findings, L protein was not detected
by Western blotting in the cell lysates from LCMV-infected cells
(33).
|
|
Levels of Z associated with infectious LCMV RNP.
Z was not
required for RNA synthesis mediated by the LCMV polymerase in the
minigenome assay. This finding led us to examine whether Z was also
dispensable for the biosynthetic processes involved in the initiation
of LCMV productive infection. For this, we prepared intracellular LCMV
RNPs and characterized them both biochemically and biologically. LCMV
RNPs prepared following the procedures here described have been shown
to be transcriptionally active in vitro (23). These RNPs
did not contain detectable levels of Z protein (Fig.
4A). However, they were infectious on the
basis of their ability to direct synthesis of LCMV macromolecules and
production of infectious virions upon transfection of BHK-1 cells (Fig.
4B). Infectivity associated with LCMV RNP depended on transfection
conditions and was resistant to treatment with the nonionic detergent
NP-40 but was sensitive to RNase treatment (Fig. 4C).

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 4.
Biochemical and biological characterization of LCMV RNP.
(A) Levels of Z associated with LCMV RNP. Whole-cell extracts (lanes 1 and 3) and RNP (lanes 2 and 4) were prepared from mock (lanes 1 and 2)
and LCMV-infected (lanes 3 and 4) cells and analyzed by Western
blotting using a guinea pig antiserum to LCMV and a rabbit antiserum to
Z. The amount of RNP loaded in lane 4 corresponded to a sixfold-higher
amount (cell equivalent) of that loaded in lane 3. (B) Infectivity of
LCMV RNP. Cells were transfected with RNP prepared from mock- and
LCMV-infected cells. As controls, cells were also either LCMV or mock
infected. At 48 h p.i. or posttransfection, cells were fixed and
analyzed by immunofluorescence by using a guinea pig polyclonal
antiserum to LCMV. Levels of infectious LCMV in the corresponding
supernatants (48 h p.i.) were determined by plaque assay
(18). (C) Characterization of infectivity associated with
LCMV RNP. LCMV RNP (lanes 1 to 4) or virions (lanes 5 to 10) were
treated with NP-40 (0.05% for 15 min on ice) or pancreatic RNase (25 µg for 30 min at 20°C) or were left untreated. Infectivity
associated with treated and untreated virions and RNP was assayed by
direct plaque assay (P) or by transfection (T). RNP-associated
infectivity was normalized to that obtained by transfection with
untreated RNP. Virion-associated infectivity was normalized to that
obtained by direct plaque assay with untreated virions. Three
independent assays were done. Average values and standard deviations
are shown.
|
|
Kinetics of Z expression during the natural course of LCMV
infection.
The inhibitory effect of Z on LCMV minigenome
expression would seem to be counterproductive for virus replication,
especially if Z reaches high levels of expression at early stages
during the natural life cycle of LCMV. Therefore, we examined the
expression levels of Z, both mRNA and protein, during LCMV infection.
BHK-21 cells were infected with LCMV Arm5 at an MOI of 3 and harvested
at the indicated time points (Fig.
5).
Total cellular
RNA was isolated and analyzed by Northern blot
hybridization by
using specific probes to detect Z and NP
mRNAs, as well as the
L and S RNA segments (Fig.
5A). We used
Z and NP cDNA probes of
similar size and specific activity.
S-segment-derived RNA species
(NP mRNA and genomic plus antigenomic S
RNAs) were readily detected
at 8 h p.i., whereas at this time
p.i., the levels of L-segment-derived
RNA species (Z mRNA and genomic
plus antigenomic L RNAs) were
barely detectable. Steady-state levels of
NP mRNA and S RNA, as
well as those of Z mRNA and L RNA, peaked at ca.
18 h p.i. This
was followed by a decrease at 24 h p.i. in the
steady-state levels
of all four RNA species. The levels of NP mRNA and
S and L RNA
species, but not of Z mRNA, exhibited a slow steady
decrease between
24 and 72 h p.i. During the first 12 h of
infection, the levels
of Z mRNA were significantly lower than those of
NP mRNA (Fig.
5A). Consistent with previous findings (
24),
we also observed
a preferential accumulation of genomic S RNA over
genomic L for
all time points analyzed (Fig.
5A).

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 5.
Kinetic of Z expression during the natural course of
LCMV infection. (A) Kinetic of Z mRNA synthesis. BHK-21 cells were
infected with LCMV (MOI = 3), and total cell RNA isolated at the
indicated time points was analyzed by Northern blot hybridization. For
each time point, equal amounts of RNA were loaded in two different
gels. Lane 7, in both gels, corresponds to RNA from mock-infected
cells. Both gels were identically processed for Northern blot analysis.
One membrane was used to detect Z mRNA and L segment by using a
[32P]dCTP labeled Z-DNA probe (panel i). The other
membrane was used to detect NP mRNA and the S segment using a
[32P]dCTP labeled NP DNA probe (panel iii). Molecular
markers are indicated on the right. Prior to hybridization, each
membrane was stained with methylene blue to assess the total amount of
RNA in each sample based on levels of 28S and 18S RNA (panels ii and
iv). (B) Kinetics of Z protein expression. BHK-21 cells were infected
with LCMV (MOI = 3) and harvested at the indicated time points.
Cell lysates were subjected to SDS-PAGE and analyzed for the expression
of Z protein by Western blotting with a rabbit antibody to Z. Lane 1 corresponds to mock-infected cells.
|
|
Equal amounts of whole lysates for each time point indicated were
subjected to Western blot analysis using a specific anti-Z
rabbit serum
(Fig.
5B). Expression of Z protein was first detected
at 24 h p.i.
and peaked by 24 to 36 h p.i., followed by a slight
decrease of
its expression at later times (Fig.
5B).
Effect of Z on the encapsidation of the minigenome RNA.
We
expected that, as with other negative-strand RNA viruses (35,
36), viral encapsidated RNA would be the template for RNA
synthesis mediated by the LCMV polymerase. In this case, encapsidation of plasmid-supplied minigenome RNA would be a first and required step
for the synthesis of subgenomic mRNA and full-length antiminigenome RNA
mediated by the LCMV polymerase. Therefore, we investigated whether Z
could exert its inhibitory activity by preventing encapsidation of the
minigenome RNA. For this analysis, we transfected BHK-21 cells with
plasmids carrying the LCMVSCAT2 minigenome and the L and NP proteins,
together with 100 ng of either a plasmid encoding Z or an empty plasmid
vector as a negative control. Cytosolic cell extracts were prepared
24 h after transfection and loaded on a discontinuous
CsCl2 gradient to separate the RNPs from the free
RNA. In the case of LCMV, the susceptibility of encapsidated RNA to
nucleases prevented us from using micrococcal nuclease treatment to
assess levels of encapsidated minigenomes. Encapsidated RNA was
isolated from purified S-segment minigenome RNPs and subjected to
semiquantitative RT-PCR using specific primers to amplify an internal
fragment of the minigenome, corresponding to sequences within the CAT
ORF. The predicted 250-bp PCR product was obtained by using
encapsidated RNA from cells that were transfected only with the NP and
L supporting plasmids. The amount of PCR product generated decreased
concomitantly with the decrease in the amount of input RNA used for the
RT-PCR (Fig. 6A, panel i, lanes 4 to 6).
Cotransfection with 100 ng of Z expression plasmid (lanes 1 to 3) did
not prevent amplification of the same PCR fragment (Fig. 6A, panel i,
lanes 1 to 3). As expected, no minigenome sequence was amplified in the
absence of NP (Fig. 6A, panel i, lane 8). The absence of L decreased
but did not prevent, the amplification of PCR product (Fig. 6A, panel
i, lane 7). Omission of the RT step prevented amplification of
minigenome sequences (Fig. 6A, panel i, lane 9). As a control, we used
the same procedures to isolate bona fide LCMV RNPs from an amount of
infected cells similar to that of transfected cells used to prepare the
S-segment minigenome RNPs. RNA present in LCMV RNPs was isolated and
characterized by RT-PCR as described in Materials and Methods (Fig. 6A,
panel ii).

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 6.
Effect of Z on encapsidation and RNA synthesis of LCMV
S-segment minigenome. (A) Z does not inhibit encapsidation of plasmid
supplied LCMVSCAT2 minigenome. (i) BHK-21 cells (106
cells/well, six-well plate) were infected with vTF7.3 (MOI = 3)
and cotransfected with 0.5 µg of pLCMVSCAT2, 1.5 µg of pCITE-NP,
0.1 µg of pGEM-L, and 0.1 µg of pTMI-GFP. Plasmids expressing L and
NP were omitted in lanes 7 and 8, respectively. Samples from lanes 1 to
3 were also transfected with 100 ng of pUCIRES-Z. In all of the samples
the amount of DNA was kept constant (2.7 µg) by adding plasmid pTMI.
At 24 h after transfection, cells (three wells/sample) were
harvested and RNP was obtained as described in Materials and Methods.
Encapsidated RNA was isolated and subjected to semiquantitative RT-PCR
by using decreasing amounts of input RNA: 1/4, 1/8, and 1/16 of the
total RNA were used in lanes 1 to 3 and lanes 4 to 6. In lanes 7 and 8, 1/8 of the total RNA was amplified. In lane 9, 1/4 of total RNA was
analyzed, omitting the RT step as a control for plasmid DNA
contamination in the RNP preparation. Molecular size markers are
indicated on the left. MG refers to minigenome LCMVSCAT2. (ii) Bona
fide LCMV RNPs were prepared from LCMV-infected BHK-21 cells (3 × 106 cells) at 48 h p.i. (MOI = 3). Encapsidated
RNA was isolated and analyzed by semiquantitative RT-PCR as described
in Materials and Methods. In this case, primers used for PCR amplified
a segment (ca. 350 bp) of the S segment corresponding to NP sequences.
(B) Effect of Z protein on RNA synthesis mediated by the LCMV
polymerase. BHK-21 cells were infected with vTF7.3 (MOI = 3) and
cotransfected with 0.5 µg of pLCMVSCAT2, 1.5 µg of pCITE-NP, 0.1 µg of pGEM-L, 0.1 µg of pTMI-GFP, and increasing amounts of
pUCIRES-Z as indicated. Plasmid pGEM-L was not added in lane 7. Total
cellular RNA was isolated, and equal amounts (5 µg) were analyzed by
Northern blot hybridization. (i) Subgenomic CAT mRNA and full-length
antigenomic RNA species were detected with a [32P]UTP AS
CAT riboprobe. Molecular size markers are indicated on the left. (ii)
Methylene blue staining of the membrane was done to determine the
positions and levels of the 28S and 18S RNA.
|
|
Effect of Z protein on RNA synthesis.
The next event to follow
encapsidation of the minigenome RNA is its transcription and
replication. Decreased levels of transcription and/or replication can
negatively affect minigenome-mediated CAT expression. Hence, we
evaluated the effect of Z on these biosynthetic processes. After
transfection of BHK-21 cells with increasing amounts of Z, together
with plasmids encoding the LCMVSCAT2 minigenome, as well as NP and L
proteins, RNA was isolated and analyzed by Northern blot using an AS
CAT riboprobe. This probe hybridizes to both CAT mRNA (ca. 700 nucleotides) and the miniantigenomic (1,100 nucleotides) RNA species.
The agarose gel electrophoresis conditions used did not separate well
the two RNA species, resulting in the appearance of a broad band in the
Northern blot (Fig. 6B). LCMV mRNAs are not polyadenylated. Hence, it
was not possible to use oligo(dT) chromatography to distinguish between
CAT mRNA and antigenomic RNA species.
Coexpression of the LCMV Z protein affected similarly both the
synthesis of subgenomic CAT mRNA and the positive-sense antigenome
RNA
from the LCMVSCAT2 minigenome template RNA (Fig.
6B, lane
4). As
predicted above, in the absence of L no synthesis of RNA
mediated by the LCMV polymerase was detected (Fig.
6B, lane 7).
The CAT
AS probe also detected an additional broad-appearing band
of ca. 1.5 to
1.7 kb. Synthesis of this RNA species also required
L and was prevented
by Z in a dose-dependent manner; therefore,
it appears to be
specifically produced by the virus polymerase.
However, the precise
nature of this RNA is currently unknown.
It is worth noting that a
similar finding was observed when RNA
from LCMV-infected cells were
analyzed by Northern blot using
an NP probe. In addition to the
expected subgenomic NP mRNA (1.5
kb) and S segment (3.5 kb) RNA
species, an RNA of ca. 5 kb also
hybridizes specifically to the NP
probe (see Fig.
5A). It has
been proposed that terminal complementarity
may be responsible
for the generation of unresolved dimeric RNA species
that will
migrate with an apparent molecular mass higher than that of
the
genomic S RNA. This situation could also apply to the S-segment
minigenome RNA, which also has terminal
complementarity.
The RING finger domain of the LCMV Z protein is required for the Z
inhibitory activity.
All arenavirus Z proteins thus far
characterized contain a RING finger domain of Z (17, 27, 28, 48,
50). The RING finger domain has been identified in a large
number of both cellular and viral proteins (51). We sought
to determine whether the RING domain was required for the inhibition of
RNA synthesis mediated by the LCMV polymerase. For this, we constructed
the mutant Z-F32G35, in which C at positions 32 and 35 was changed to F
and G, respectively (Fig. 7A). These
mutations have been shown to disrupt the Z RING domain (2,
3). We first verified that Z-F32G35 could be expressed to levels
similar to those of the parental Z-wt protein, as determined by Western
blotting. Subsequently, we tested the mutant Z protein for its ability
to inhibit CAT expression by the LCMV minigenome. Transfection with up
to 500 ng of plasmid expressing Z-F32G35 did not interfere with CAT
expression (Fig. 7C). However, 500 ng of plasmid Z-F32G35 resulted in
levels of expression of the mutated Z protein significantly higher than those of Z-wt protein required to cause a strong inhibition of the
minigenome expression (compare lanes 2 and 6 in Fig. 7 B).

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 7.
Disruption of the RING finger motif annuls the
inhibitory effect of the Z protein. (A) Amino acid changes introduced
in the RING domain of mutant Z-F32G35. The RING finger mutant F32G35
contains two nucleotide changes at codon positions 32 and 35 that
disrupt the RING finger motif by changing amino acid residues from C to
F and from C to G, respectively. (B) The RING finger mutant Z F32G35 is
stably expressed. BHK-21 cells were infected with vTF7.3 (MOI = 3)
and transfected with the indicated amounts of pUCIRES-Z or
pUCIRESZ-F32G35 plasmid DNA. Lane 7 shows results for mock-transfected
cells. Lysates were subjected to SDS-PAGE, and immunodetection of Z
proteins was performed with a rabbit anti-Z antibody. The position of Z
is indicated on the right, and the molecular size markers are indicated
on the left. (C) Mutant Z-F32G35 does not inhibit CAT activity mediated
by the LCMVSCAT2 minigenome. Monolayers of BHK-21 cells were infected
with vTF7.3 (MOI = 3) and cotransfected with 0.5 µg of
pLCMVSCAT2, 1.5 µg of pCITE-NP, 0.1 µg of pGEM-L, 0.1 µg of
pTMI-GFP, and increasing amounts of pUCIRES-Z and pUCIRESZ-F32G35, as
indicated at the bottom. Plasmid pGEM-L was not added in lane 8. In all
of the samples, the amount of DNA was kept constant by adding plasmid
pTMI to 2.7 µg. Samples were assayed for CAT activity as described in
Materials and Methods. O, origin; Cm, chloramphenicol; MAc,
monoacetylated chloramphenicol; DAc, diacetylated chloramphenicol.
|
|
This finding raised the question whether the inhibitory effect could be
observed with other RING motif containing proteins
not related to Z. To
investigate this question, we determined
the effect of three other RING
finger proteins, unrelated to LCMV
Z, on LCMV minigenome expression.
These were PML (
31), a cellular
RING finger protein which
has been shown to interact with the
LCMV Z protein (
3,
4);
protein Vmw110 of herpes simplex
virus type 1 (HSV 1)
(
20); and the human cytomegalovirus protein
IE86
(
26). We first determined that we could express at high
levels these three RING proteins (Fig.
8A). Expression of PML
and Vmw110 was
detected by Western blotting (Fig.
8A, panel i).
However, the mouse
antibody to IE86 did not work in Western blots;
hence, the expression
of this RING protein was verified by immunofluorescence
(Fig.
8A, panel
ii). Different amounts of PML, Vmw110, and IE86
plasmids were
transfected in the context of a rescue experiment
with the LCMVSCAT2
minigenome. The LCMV Z plasmid exhibited the
expected dose response
inhibition of CAT activity mediated by
the LCMV minigenome. In
contrast, PML, Vmw110 and IE86 all failed
to inhibit CAT expression
even at the highest (500 ng) amount
of DNA plasmid tried (Fig.
8B).

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 8.
LCMVSCAT2 minigenome expression is not inhibited by RING
finger proteins unrelated to Z. (A) Expression of viral (Vmw110 and
IE86) and cellular (PML) RING finger proteins in BHK cells. BHK-21
cells were infected with vTF7.3 (MOI = 3) and transfected with 0.5 µg of RMX-PML (panel i, lane 3), 0.5 µg of pT7-110 (panel ii, lane
4), or 0.5 µg of pGEM-IE86 (panel ii). Protein expression was assayed
by Western blotting with either a rabbit anti-PML antibody (panel i,
lanes 1 to 3) or a mouse anti-Vmw110 antibody (panel i, lanes 4 to 6)
or by immunofluorescence with a mouse anti-IE86 antibody (panel ii).
The positions of PML and Vmw110 are indicated on the right, and the
molecular size markers are indicated on the left. (B) Inhibition of CAT
expression by the LCMVSCAT2 minigenome is not observed with RING finger
proteins unrelated to Z. BHK-21 cells were cotransfected with 0.5 µg
of pLCMVSCAT2, 1.5 µg of pCITE-NP, 0.1 µg of pGEM-L, 0.1 µg
of pTMI-GFP, and increasing amount of pUCIRES-Z, pGEM-IE86,
pT7-110, or RMX-PML as indicated at the bottom of the figure. Plasmid
pGEM-L was omitted in lane 14. In all of the samples the amount of DNA
was kept constant by adding vector pTMI to 2.7 µg. Samples were
assayed for CAT activity as described in Materials and Methods. O,
origin; Cm, chloramphenicol; MAc, monoacetylated chloramphenicol; DAc,
diacetylated chloramphenicol.
|
|
Effect of early expression of Z on LCMV multiplication in
vivo.
The strong inhibitory effect of Z on the expression of the
LCMV minigenome led us to test whether virus multiplication could be
also affected by increased expression of Z at early times during the
natural course of LCMV infection. For this, we used vTF7.3 to mediate
expression of plasmid-derived Z in the context of a LCMV infection. We
first examined whether vTF7.3 infection had a significant negative
impact on LCMV replication that would preclude the use of this
approach. Cells infected with LCMV alone and with LCMV plus vTF7.3
exhibited similar levels of LCMV S RNA and NP mRNA (Fig.
9C). In addition, vTF7.3 infection did
not affect significantly the number of LCMV NP-positive cells detected
by immunofluorescence at 24 h p.i. (Fig. 9D). As controls,
vTF7.3-infected cells were transfected also with ZF32G35 and with a
plasmid encoding chicken rhomboid (ChRb), a nonviral protein unrelated
to Z. To facilitate its detection, ChRb was tagged at its C terminus
with a c-myc epitope. Five hours after transfection, cells
were infected either with LCMV or with VSV, both at an MOI of 3. At 12 and 24 h after infection with VSV and LCMV, respectively, cells
were fixed and analyzed by immunofluorescence with the following
antibodies: (i) a guinea pig polyclonal antibody to LCMV that
recognizes the NP and GP, but not Z, viral proteins; (ii) a rabbit
serum to Z; (iii) a mouse monoclonal antibody to the c-myc
epitope; and (iv) a rabbit polyclonal antibody to the cytoplasmic tail
of VSV G. It should be mentioned that levels of Z protein present in
LCMV infected cells at early times (<24 h p.i.) could not be detected by immunofluorescence with the rabbit antibody to Z used in these studies. This allowed identification of cells expressing plasmid derived Z protein and virus NP antigen. Cells expressing ChRb were
readily infectible by LCMV and VSV, as determined by the colocalization
of transfected ChRb and viral antigens (Fig. 9A, panels a, f, d, and i,
and B). Most cells expressing the transfected Z did not express levels
of LCMV NP antigen that could be detected by IF (Fig. 9A, panels b and
g, and B). In contrast, Z-transfected cells exhibited a susceptibility
to VSV similar to that observed in ChRb-transfected cells (Fig. 9A,
panels d, i, e, and j, and B). This Z-mediated decreased susceptibility
to LCMV was statistically significant (chi-squared test,
P < 0.0001). Consistent with the CAT results, cells
expressing the mutant ZF32G35 did not exhibit decreased susceptibility
to LCMV infection (Fig. 9A, panels c and h, and B).

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 9.
Effect of vTF7.3-mediated expression of Z on LCMV
infection. (A) Effect of vTF7.3-mediated Z and ChRb expression on LCMV
and VSV infections. BHK-21 cells were infected with vTF7.3 (MOI = 3) and subsequently transfected with ChRb (a, f, d, and i), Zwt (b, g,
e, and j), or ZF32G35 (c and h) and infected with either LCMV (MOI = 3) (a to c and f to h) or VSV (MOI = 3) (d, e, i, and j). Cells
were fixed at 12 and 24 h p.i. with VSV and LCMV, respectively,
and analyzed by immunofluorescence by using the indicated primary
antibodies, together with the appropriate secondary antibodies coupled
to either FITC or TXR. (B) Quantitation of immunofluorescence results
shown in panel A. In each case a minimum of 100 positive
transfected cells were counted, and the percentage of cells also
expressing the corresponding viral antigen was determined. (C) Effect
of vTF7.3 infection on LCMV RNA synthesis. Cells were infected with
LCMV alone (lanes 2 and 3) or with both LCMV and vTF7.3 (lanes 4 and
5). At the indicated times p.i., RNA was prepared and analyzed by
Northern blotting using an LCMV NP probe. (D) Effect of vTF7.3
infection on LCMV antigen expression. Cells were infected with LCMV or
coinfected with LCMV plus vTF7.3. After 24 h the cells were fixed
and examined by immunofluorescence using a guinea pig polyclonal
antiserum to LCMV.
|
|
 |
DISCUSSION |
In this study, we present evidence that LCMV Z has a strong
inhibitory effect on the expression of an LCMV S-segment minigenome. Moreover, cells expressing Z via plasmid transfection appeared to have
decreased susceptibility to LCMV infection but not to VSV infection.
The inhibitory effect requires an intact Z ORF, and the magnitude of
inhibition correlates directly with the amount of Z protein produced
(Fig. 2). In addition, plasmid-mediated expression of LCMV
trans-acting factors NP and L was unaffected by the
coexpression of Z (Fig. 3). Together, these results support the
conclusion that the inhibitory effect observed is mediated by the Z
protein rather than the consequence of an artifact of transfection of
the Z plasmid or intracellular synthesis of Z mRNA. Moreover, 20 ng of
input Z plasmid caused an approximately 50% decrease in CAT activity
by the LCMV minigenome (Fig. 1A), with the corresponding levels of
plasmid supplied Z protein being below those naturally occurring in
LCMV-infected cells (Fig. 1B). This suggests that the Z inhibitory
effect could very well operate during the natural course of LCMV
infection. Because our studies were only done with an S-segment
minigenome, we cannot rule out that the observed effects of Z are
unique to the LCMV S segment. However, it seems reasonable to assume,
though it is as yet unproved, that similar mechanisms would be
responsible for transcription and RNA replication of both S and L
segments. If we assume that this hypothesis as correct, then Z would be
expected to exert a similar inhibitory effect on the transcription and
RNA replication of both S and L segments.
Early studies using in vitro transcription combined with
immunodepletion experiments of the Z protein from Tacaribe virus (TACV)
indicated that Z is required for both genome replication and mRNA
synthesis (25). The apparent discrepancies between those
published findings and our results may be related to differences between TACV and LCMV with respect to Z functions. It is also possible
that the antibody to TACV Z protein used in the immunodepletion studies
may have also affected cellular factors required for virus RNA
synthesis. It is well documented that cellular components, especially
proteins associated with the cytoskeleton, can frequently play
important roles in virus replication and transcription (14, 32). This interpretation, however, cannot explain how in vitro synthesis of TACV RNA could be restored by adding an extract of cells
infected with vTF7-3 and transfected with a T7-Z plasmid but not by one
of cells infected with vTF7-3 alone. However, LCMV RNP preparations
with activity in in vitro synthesis of RNA (23) and the
ability to resume infection after transfection into cells (Fig. 4B and
C) were devoid of detectable levels of Z protein (Fig. 4A).
Recent evidence has shown that the bunyamwera virus nonstructural (NS)
proteins also inhibit viral RNA synthesis in a minireplicon system
(59). Interestingly, the NS proteins of RVFV, another
bunyavirus, did not exhibit such inhibitory effect on minigenome RNA
synthesis. This suggests that NS proteins of viruses in different
Bunyaviridae genera may share only limited functional
similarities with respect to the viral replication cycle. Likewise, the
apparent discrepancies between previously published findings with TACV
and our results with LCMV may be related to differences between these
two arenaviruses with respect to their Z functions. In this regard, it
is worth noting that TACV and LCMV belong to the two different
arenavirus groups or complexes: the TACV complex, which includes all of
the known New World arenaviruses, and the LCMV-Lassa complex, which
includes the Old World arenaviruses (8).
We noted that coexpression of Z did not prevent encapsidation of the
plasmid-supplied LCMV minigenome (Fig. 6A, panel i) but affected both
transcription and replication of the minigenome similarly (Fig. 6B).
Based on results shown in Fig. 6A, panel i, it appears as though the
presence of Z causes a modest increase (two- to fourfold) on the levels
of encapsidated minigenome RNA (compare lanes 1, 3, 4, and 6 in Fig.
6A, panel i). Nevertheless, the semiquantitative nature of the assay
should caution about the significance of these apparent differences.
The results shown in Fig. 6A, panel i, however, provide strong evidence
against the possibility that Z has a significant negative effect on the encapsidation of the minigenome RNA. Amplification of minigenome sequences by RT-PCR in the encapsidation assay could have been due to
contaminant plasmid DNA. We rule out this possibility based on the lack
of amplified sequences when the RT step was omitted (Fig. 6A, panel i,
lane 9). These findings suggest that Z is acting at a very early stage
after encapsidation. Z could act on the encapsidated template, the
polymerase complex, or both. The amount of Z plasmid that caused ca.
50% inhibition was 15-fold lower and 4-fold higher than the molar
concentrations of the NP and L plasmids, respectively, suggesting that
it is more likely that Z is acting on L.
Biochemical and immunological studies have shown that Z is a structural
component of the virion, where it is closely associated with NP.
Treatment of LCMV with nonionic detergents showed that Z partitions
into the hydrophobic phase rather than remaining associated with the
viral nucleocapsid. Moreover, infectious and transcriptionally active
LCMV RNP did not contain detectable levels of Z. These findings suggest
that Z might be the arenavirus counterpart of the matrix (M) proteins
found in other negative-strand RNA viruses (48, 49). For
several negative-strand RNA viruses, the association of the M protein
with the RNP core appears to shut down virus transcription (15,
42, 56, 58). Whether LCMV Z plays an equivalent role in LCMV
infections remains to be determined. LCMV Z has also been shown to
interact with several host cell proteins (3, 4, 12). The
association of Z with the eukaryotic initiation factor 4E (eIF-4E) has
been implicated in the repression of protein synthesis in an
eIF-4E-dependent manner (12). Therefore, it is possible
that low levels of Z protein could be sufficient to affect the
expression of a host cell factor required to initiate synthesis of RNA
by the LCMV polymerase.
All arenavirus Z genes sequenced thus far contain a conserved RING
finger domain of the type RING HC
(C1-X2-C2-X9-C3-X2-H1-X2-C4-X2-C5-X10-C6-X2-C7) (22).
Double-point mutations of the zinc-binding residues in the RING finger
domain have been shown to unfold the RING and to affect the function of
these proteins (2, 3). Using site-directed mutagenesis, we
generated an LCMV Arm Z protein wherein the C1 and C2 positions within
its RING finger were changed to F and G, respectively (Z-F32G35). This
mutated Z-F32G35 protein was stable and could be expressed at levels
similar to that of Z-wt, but the mutant Z lost the inhibitory activity
(Fig. 7). This result indicated a key role of the RING domain in
Z-mediated inhibition of the LCMV minigenome. However, other viral and
nonviral RING proteins not related to Z did not have any effect on the
LCMV minigenome expression (Fig. 8), suggesting that the presence of a
RING-finger domain per se is not responsible for the Z inhibitory effect. The RING domain is thought to mediate protein-protein interaction rather than binding to nucleic acids (12, 19, 21, 30,
57). Hence, the inhibitory activity of Z may involve its
interaction with L and/or specific host cell factors through its RING
finger domain. Recent findings from a number of laboratories have led
to the realization that many RING finger proteins can play a key role
in the control of intracellular protein degradation by acting as
ubiquitin (Ub)-protein ligases (or E3s) (29, 30). E3s
provide specificity to Ub conjugation by facilitating the transfer of
Ub from a Ub-conjugating enzyme (Ubc or E2) to ubiquitination targets.
It is appealing to speculate that the Z inhibitory effect might be
related to its potential E3 activity. This E3 activity would provide Z
with the capability to specifically target for degradation proteins
required at early stages of RNA synthesis mediated by LCMV polymerase.
Nevertheless, our attempts to demonstrate an E3 activity associated
with Z yielded negative results. These assays were done using E2 Ubc4
and Z itself as a target for ubiquitination. Therefore, we cannot rule
out that Z has an E3 activity that requires interaction with a
different E2 or that Z itself is not a target for ubiquitination. In
the future, it would be of interest to analyze whether Z has E3
activity when examined in the context of different E2s, as well as
using a variety of potential ubiquitination targets.
The NS1 protein of respiratory syncytial virus (RSV) has been shown to
have an inhibitory activity (1) similar to that described
here for Z. These findings raise the obvious question of why RSV and
LCMV encode a protein with an activity that would seem to be
counterproductive for viral replication. It may not be accidental that,
like RSV, many arenaviruses are characterized by their relative modest
growth properties compared to other negative-strand RNA viruses.
Negative regulatory proteins such as NS1 and Z could contribute to
restricted virus replication and gene expression. Z likely plays
different roles during the life cycle of LCMV. Its expression at low
levels early during the life cycle of LCMV (Fig. 5) could have a
negative regulatory effect on RNA synthesis that might contribute to
the restricted replication and noncytopathic properties of many
arenaviruses. Increased levels of Z protein at later times of the LCMV
life cycle could be required for virus maturation and budding. Levels
of Z mRNA increased abruptly by between 12 and 18 h p.i., and we
could not detect Z protein prior to 24 h p.i, which postdated the
onset of synthesis of L RNA. Thus, the expression of Z during the
progression from early to late phases of the LCMV life cycle may be
highly regulated. Expression of high levels of Z protein earlier than
needed during the virus life cycle could have a very strong negative
impact on virus multiplication. This possibility is likely to be
recreated in our minigenome rescue assay with use of increasing amounts
of Z plasmid. Consistent with this hypothesis, cells transfected with
Z, but not with ZF32G35, exhibited decreased susceptibility to LCMV
(Fig. 9). This effect of Z appears to be specific since cell
susceptibility to VSV infection was not altered in cells transfected
with Z. In addition, cells expressing a Z not related to the
transfected gene and untransfected control cells showed similar
susceptibilities to LCMV infection. These findings suggest that Z could
play previously unsuspected roles in the control of arenavirus RNA
synthesis. A detailed understanding of the mechanisms by which LCMV Z
exerts its inhibitory activity could provide valuable information for
the design of new antiviral strategies against highly pathogenic human
arenaviruses such as Lassa fever virus.
 |
ACKNOWLEDGMENTS |
We thank L. Whitton and M. B. A. Oldstone for valuable
discussions, A. Bang for the Ch-Rb cDNA, R. Evans for the PML cDNA, R. D. Everett for the Vmw110 cDNA and the monoclonal antibody to
Vmw110, P. Ghazal for the IE86 cDNA and the monoclonal antibody to
IE86, M. Salvato for the polyclonal antibody to Z, and M. Whitt for the
rabbit polyclonal serum to the C-tail of VSV G and the mouse monoclonal
antibody to VSV M.
This work was supported by NIH grant AG04342 (J.C.D.L.T.) and AI09484
(T.I.C.).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: The Scripps
Research Institute, Department of Neuropharmacology, IMM-6, 10550 N. Torrey Pines Rd., La Jolla, CA 92037. Phone: (858) 784-9462. Fax: (858) 784-9981. E-mail: juanct{at}scripps.edu.
Publication 13869-NP from The Scripps Research Institute.
 |
REFERENCES |
| 1.
|
Atreya, P. L.,
M. E. Peeples, and P. L. Collins.
1998.
The NS1 protein of human respiratory syncytial virus is a potent inhibitor of minigenome transcription and RNA replication.
J. Virol.
72:1452-1461[Abstract/Free Full Text].
|
| 2.
|
Borden, K. L.,
M. N. Boddy,
J. Lally,
N. J. O'Reilly,
S. Martin,
K. Howe,
E. Solomon, and P. S. Freemont.
1995.
The solution structure of the RING finger domain from the acute promyelocytic leukaemia proto-oncoprotein PML.
EMBO J.
14:1532-1541[Medline].
|
| 3.
|
Borden, K. L.,
E. J. Campbell-Dwyer, and M. S. Salvato.
1998.
An arenavirus RING (zinc-binding) protein binds the oncoprotein promyelocyte leukemia protein (PML) and relocates PML nuclear bodies to the cytoplasm.
J. Virol.
72:758-766[Abstract/Free Full Text].
|
| 4.
|
Borden, K. L.,
E. J. Campbell-Dwyer,
G. W. Carlile,
M. Djavani, and M. S. Salvato.
1998.
Two RING finger proteins, the oncoprotein PML and the arenavirus Z protein, colocalize with the nuclear fraction of the ribosomal P proteins.
J. Virol.
72:3819-3826[Abstract/Free Full Text].
|
| 5.
|
Borden, K. L.,
E. J. Campbell-Dwyer, and M. S. Salvato.
1997.
The promyelocytic leukemia protein PML has a pro-apoptotic activity mediated through its RING domain.
FEBS Lett.
418:30-34[CrossRef][Medline].
|
| 6.
|
Borrow, P., and M. B. Oldstone.
1994.
Mechanism of lymphocytic choriomeningitis virus entry into cells.
Virology
198:1-9[CrossRef][Medline].
|
| 7.
|
Borrow, P., and M. B. A. Oldstone.
1997.
Lymphocitic choriomeningitis virus, p. 593-627.
In
N. Nathanson (ed.), Viral pathogenesis, vol. 1. Lippincott-Raven, Philadelphia, Pa.
|
| 8.
|
Bowen, M. D.,
C. J. Peters, and S. T. Nichol.
1997.
Phylogenetic analysis of the Arenaviridae: patterns of virus evolution and evidence for cospeciation between arenaviruses and their rodent hosts.
Mol. Phylogenet. Evol.
8:301-316[CrossRef][Medline].
|
| 9.
|
Buchholz, U. J.,
S. Finke, and K. K. Conzelmann.
1999.
Generation of bovine respiratory syncytial virus (BRSV) from cDNA: BRSV NS2 is not essential for virus replication in tissue culture, and the human RSV leader region acts as a functional BRSV genome promoter.
J. Virol.
73:251-259[Abstract/Free Full Text].
|
| 10.
|
Buchmeier, M. J., and A. J. Zajac.
1999.
Lymphocytic choriomeningitis virus, p. 575-605.
In
R. Ahmed, and J. Chen (ed.), Persistent viral infections, vol. 1. John Wiley & Sons, Ltd., London, England.
|
| 11.
|
Buckley, S. M.,
J. Casals, and W. G. Downs.
1970.
Isolation and antigenic characterization of Lassa virus.
Nature
227:174[Medline].
|
| 12.
|
Campbell-Dwyer, E. J.,
H. Lai,
R. C. MacDonald,
M. S. Salvato, and K. L. Borden.
2000.
The lymphocytic choriomeningitis virus RING protein Z associates with eukaryotic initiation factor 4E and selectively represses translation in a RING-dependent manner.
J. Virol.
74:3293-3300[Abstract/Free Full Text].
|
| 13.
|
Cao, W.,
M. D. Henry,
P. Borrow,
H. Yamada,
J. H. Elder,
E. V. Ravkov,
S. T. Nichol,
R. W. Compans,
K. P. Campbell, and M. B. Oldstone.
1998.
Identification of alpha-dystroglycan as a receptor for lymphocytic choriomeningitis virus and Lassa fever virus.
Science
282:2079-2081[Abstract/Free Full Text].
|
| 14.
|
Ciampor, F.
1988.
The role of cytoskeleton and nuclear matrix in virus replication.
Acta Virol.
32:168-189[Medline].
|
| 15.
|
Clinton, G. M.,
S. P. Little,
F. S. Hagen, and A. S. Huang.
1978.
The matrix (M) protein of vesicular stomatitis virus regulates transcription.
Cell
15:1455-1462[CrossRef][Medline].
|
| 16.
|
Cubitt, B., and J. C. de la Torre.
1994.
Borna disease virus (BDV), a nonsegmented RNA virus, replicates in the nuclei of infected cells where infectious BDV ribonucleoproteins are present.
J. Virol.
68:1371-1381[Abstract/Free Full Text].
|
| 17.
|
Djavani, M.,
I. S. Lukashevich,
A. Sanchez,
S. T. Nichol, and M. S. Salvato.
1997.
Completion of the Lassa fever virus sequence and identification of a RING finger open reading frame at the L RNA 5' end.
Virology
235:414-418[CrossRef][Medline].
|
| 18.
|
Doyle, M. V., and M. B. Oldstone.
1978.
Interactions between viruses and lymphocytes. I. In vivo replication of lymphocytic choriomeningitis virus in mononuclear cells during both chronic and acute viral infections.
J. Immunol.
121:1262-1269[Abstract/Free Full Text].
|
| 19.
|
Duan, H.,
Y. Wang,
M. Aviram,
M. Swaroop,
J. A. Loo,
J. Bian,
Y. Tian,
T. Mueller,
C. L. Bisgaier, and Y. Sun.
1999.
SAG, a novel zinc RING finger protein that protects cells from apoptosis induced by redox agents.
Mol. Cell. Biol.
19:3145-3155[Abstract/Free Full Text].
|
| 20.
|
Everett, R. D.
1991.
Construction and characterization of herpes simplex type 1 viruses without introns in immediate early gene 1.
J. Gen. Virol.
72:651-659[Abstract/Free Full Text].
|
| 21.
|
Fang, S.,
J. P. Jensen,
R. L. Ludwig,
K. H. Vousden, and A. M. Weissman.
2000.
Mdm2 is a RING finger-dependent ubiquitin protein ligase for itself and p53.
J. Biol. Chem.
275:8945-8951[Abstract/Free Full Text].
|
| 22.
|
Freemont, P. S.
2000.
RING for destruction?
Curr. Biol.
10:R84-R87[CrossRef][Medline].
|
| 23.
|
Fuller-Pace, F. V., and P. J. Southern.
1989.
Detection of virus-specific RNA-dependent RNA polymerase activity in extracts from cells infected with lymphocytic choriomeningitis virus: in vitro synthesis of full-length viral RNA species.
J. Virol.
63:1938-1944[Abstract/Free Full Text].
|
| 24.
|
Fuller-Pace, F. V., and P. J. Southern.
1988.
Temporal analysis of transcription and replication during acute infection with lymphocytic choriomeningitis virus.
Virology
162:260-263[CrossRef][Medline].
|
| 25.
|
Garcin, D.,
S. Rochat, and D. Kolakofsky.
1993.
The Tacaribe arenavirus small zinc finger protein is required for both mRNA synthesis and genome replication.
J. Virol.
67:807-812[Abstract/Free Full Text].
|
| 26.
|
Ghazal, P.,
J. Young,
E. Giulietti,
C. DeMattei,
J. Garcia,
R. Gaynor,
R. M. Stenberg, and J. A. Nelson.
1991.
A discrete cis element in the human immunodeficiency virus long terminal repeat mediates synergistic trans activation by cytomegalovirus immediate-early proteins.
J. Virol.
65:6735-6742[Abstract/Free Full Text].
|
| 27.
|
Gibadulinova, A.,
V. Zelnik,
L. Reiserova,
E. Zavodska,
M. Zatovicova,
F. Ciampor,
S. Pastorekova, and J. Pastorek.
1998.
Sequence and characterisation of the Z gene encoding ring finger protein of the lymphocytic choriomeningitis virus MX strain.
Acta Virol.
42:369-374[Medline].
|
| 28.
|
Iapalucci, S.,
N. Lopez,
O. Rey,
M. M. Zakin,
G. N. Cohen, and M. T. Franze-Fernandez.
1989.
The 5' region of Tacaribe virus L RNA encodes a protein with a potential metal binding domain.
Virology
173:357-361[CrossRef][Medline].
|
| 29.
|
Joazeiro, C. A., and A. M. Weissman.
2000.
RING finger proteins: mediators of ubiquitin ligase activity.
Cell
102:549-552[CrossRef][Medline].
|
| 30.
|
Joazeiro, C. A.,
S. S. Wing,
H. Huang,
J. D. Leverson,
T. Hunter, and Y. C. Liu.
1999.
The tyrosine kinase negative regulator c-Cbl as a RING-type, E2-dependent ubiquitin-protein ligase.
Science
286:309-312[Abstract/Free Full Text].
|
| 31.
|
Kakizuka, A.,
W. H. Miller, Jr.,
K. Umesono,
R. P. Warrell, Jr.,
S. R. Frankel,
V. V. Murty,
E. Dmitrovsky, and R. M. Evans.
1991.
Chromosomal translocation t(15;17) in human acute promyelocytic leukemia fuses RAR alpha with a novel putative transcription factor, PML.
Cell
66:663-674[CrossRef][Medline].
|
| 32.
|
Lai, M. M.
1998.
Cellular factors in the transcription and replication of viral RNA genomes: a parallel to DNA-dependent RNA transcription.
Virology
244:1-12[CrossRef][Medline].
|
| 33.
|
Lee, K. J.,
I. S. Novella,
M. N. Teng,
M. B. Oldstone, and J. C. de La Torre.
2000.
NP and L proteins of lymphocytic choriomeningitis virus (LCMV) are sufficient for efficient transcription and replication of LCMV genomic RNA analogs.
J. Virol.
74:3470-3477[Abstract/Free Full Text].
|
| 34.
|
Moss, B.,
O. Elroy-Stein,
T. Mizukami,
W. A. Alexander, and T. R. Fuerst.
1990.
Product review. New mammalian expression vectors.
Nature
348:91-92[CrossRef][Medline].
|
| 35.
|
Moyer, S. A.,
S. Smallwood-Kentro,
A. Haddad, and L. Prevec.
1991.
Assembly and transcription of synthetic vesicular stomatitis virus nucleocapsids.
J. Virol.
65:2170-2178[Abstract/Free Full Text].
|
| 36.
|
Myers, T. M., and S. A. Moyer.
1997.
An amino-terminal domain of the Sendai virus nucleocapsid protein is required for template function in viral RNA synthesis.
J. Virol.
71:918-924[Abstract].
|
| 37.
|
Oldstone, M. B.
1991.
Molecular anatomy of viral persistence.
J. Virol.
65:6381-6386[Free Full Text].
|
| 38.
|
Oldstone, M. B.
1989.
Viral persistence.
Cell
56:517-520[CrossRef][Medline].
|
| 39.
|
Oldstone, M. B.
1998.
Viral persistence: mechanisms and consequences.
Curr. Opin. Microbiol.
1:436-441[CrossRef][Medline].
|
| 40.
|
Oldstone, M. B.,
R. Ahmed,
J. Byrne,
M. J. Buchmeier,
Y. Riviere, and P. Southern.
1985.
Virus and immune responses: lymphocytic choriomeningitis virus as a prototype model of viral pathogenesis.
Br. Med. Bull.
41:70-74[Abstract/Free Full Text].
|
| 41.
|
Parodi, A. S.,
C. E. Coto,
M. Boxaca,
S. Lajmanovich, and S. Gonzalez.
1966.
Characteristics of Junin virus. Etiological agent of Argentine hemorrhagic fever.
Arch. Gesamte Virusforsch.
19:393-402[CrossRef][Medline].
|
| 42.
|
Perez, D. R., and R. O. Donis.
1998.
The matrix 1 protein of influenza A virus inhibits the transcriptase activity of a model influenza reporter genome in vivo.
Virology
249:52-61[CrossRef][Medline].
|
| 43.
|
Peters, C. J.,
M. Buchmeier,
P. E. Rollin, and T. G. Ksiazek.
1996.
Arenaviruses, p. 1521-1551.
In
D. M. Knipe, B. N. Fields, and P. M. Howley (ed.), Fields virology, 3rd ed., vol. 2. Lippincott-Raven Publishers, Philadelphia, Pa.
|
| 44.
|
Riviere, Y.,
R. Ahmed,
P. J. Southern,
M. J. Buchmeier,
F. J. Dutko, and M. B. Oldstone.
1985.
The S RNA segment of lymphocytic choriomeningitis virus codes for the nucleoprotein and glycoproteins 1 and 2.
J. Virol.
53:966-968[Abstract/Free Full Text].
|
| 45.
|
Salvato, M.,
P. Borrow,
E. Shimomaye, and M. B. Oldstone.
1991.
Molecular basis of viral persistence: a single amino acid change in the glycoprotein of lymphocytic choriomeningitis virus is associated with suppression of the antiviral cytotoxic T-lymphocyte response and establishment of persistence.
J. Virol.
65:1863-1869[Abstract/Free Full Text].
|
| 46.
|
Salvato, M.,
E. Shimomaye, and M. B. Oldstone.
1989.
The primary structure of the lymphocytic choriomeningitis virus L gene encodes a putative RNA polymerase.
Virology
169:377-384[CrossRef][Medline].
|
| 47.
|
Salvato, M.,
E. Shimomaye,
P. Southern, and M. B. Oldstone.
1988.
Virus-lymphocyte interactions. IV. Molecular characterization of LCMV Armstrong (CTL+) small genomic segment and that of its variant, Clone 13 (CTL ).
Virology
164:517-522[CrossRef][Medline].
|
| 48.
|
Salvato, M. S.
1993.
The Arenaviridae, vol. 1.
Plenum Press, New York, N.Y.
|
| 49.
|
Salvato, M. S.,
K. J. Schweighofer,
J. Burns, and E. M. Shimomaye.
1992.
Biochemical and immunological evidence that the 11 kDa zinc-binding protein of lymphocytic choriomeningitis virus is a structural component of the virus.
Virus Res.
22:185-198[CrossRef][Medline].
|
| 50.
|
Salvato, M. S., and E. M. Shimomaye.
1989.
The completed sequence of lymphocytic choriomeningitis virus reveals a unique RNA structure and a gene for a zinc finger protein.
Virology
173:1-10[CrossRef][Medline].
|
| 51.
|
Saurin, A. J.,
K. L. Borden,
M. N. Boddy, and P. S. Freemont.
1996.
Does this have a familiar RING?
Trends Biochem Sci.
21:208-214[CrossRef][Medline].
|
| 52.
|
Singh, M. K.,
F. V. Fuller-Pace,
M. J. Buchmeier, and P. J. Southern.
1987.
Analysis of the genomic L RNA segment from lymphocytic choriomeningitis virus.
Virology
161:448-456[CrossRef][Medline].
|
| 53.
|
Southern, P. J.
1996.
Arenaviridae: the viruses and their replication, p. 1505-1551.
In
D. M. Knipe, B. N. Fields, and P. M. Howley (ed.), Fields virology, 3rd ed., vol. 2. Lippincott-Raven Publishers, Philadelphia, Pa.
|
| 54.
|
Southern, P. J.,
M. K. Singh,
Y. Riviere,
D. R. Jacoby,
M. J. Buchmeier, and M. B. Oldstone.
1987.
Molecular characterization of the genomic S RNA segment from lymphocytic choriomeningitis virus.
Virology
157:145-155[CrossRef][Medline].
|
| 55.
|
Speir, R. W.,
O. Wood,
H. Liebhaber, and S. M. Buckley.
1970.
Lassa fever, a new virus disease of man from West Africa. IV. Electron microscopy of Vero cell cultures infected with Lassa virus.
Am. J. Trop. Med. Hyg.
19:692-694.
|
| 56.
|
Suryanarayana, K.,
K. Baczko,
V. ter Meulen, and R. R. Wagner.
1994.
Transcription inhibition and other properties of matrix proteins expressed by M genes cloned from measles viruses and diseased human brain tissue.
J. Virol.
68:1532-1543[Abstract/Free Full Text].
|
| 57.
|
Takahashi, R.,
Q. Deveraux,
I. Tamm,
K. Welsh,
N. Assa-Munt,
G. S. Salvesen, and J. C. Reed.
1998.
A single BIR domain of XIAP sufficient for inhibiting caspases.
J. Biol. Chem.
273:7787-7790[Abstract/Free Full Text].
|
| 58.
|
Watanabe, K.,
H. Handa,
K. Mizumoto, and K. Nagata.
1996.
Mechanism for inhibition of influenza virus RNA polymerase activity by matrix protein.
J. Virol.
70:241-247[Abstract].
|
| 59.
|
Weber, F.,
E. F. Dunn,
A. Bridgen, and R. M. Elliott.
2001.
The Bunyamwera virus nonstructural protein NSs inhibits viral RNA synthesis in a minireplicon system.
Virology
281:67-74[CrossRef][Medline].
|
| 60.
|
Wright, K. E.,
R. C. Spiro,
J. W. Burns, and M. J. Buchmeier.
1990.
Post-translational processing of the glycoproteins of lymphocytic choriomeningitis virus.
Virology
177:175-183[CrossRef][Medline].
|
Journal of Virology, October 2001, p. 9415-9426, Vol. 75, No. 19
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.19.9415-9426.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Casabona, J. C., Levingston Macleod, J. M., Loureiro, M. E., Gomez, G. A., Lopez, N.
(2009). The RING Domain and the L79 Residue of Z Protein Are Involved in both the Rescue of Nucleocapsids and the Incorporation of Glycoproteins into Infectious Chimeric Arenavirus-Like Particles. J. Virol.
83: 7029-7039
[Abstract]
[Full Text]
-
Baize, S., Marianneau, P., Loth, P., Reynard, S., Journeaux, A., Chevallier, M., Tordo, N., Deubel, V., Contamin, H.
(2009). Early and Strong Immune Responses Are Associated with Control of Viral Replication and Recovery in Lassa Virus-Infected Cynomolgus Monkeys. J. Virol.
83: 5890-5903
[Abstract]
[Full Text]
-
Neumann, P., Lieber, D., Meyer, S., Dautel, P., Kerth, A., Kraus, I., Garten, W., Stubbs, M. T.
(2009). Crystal structure of the Borna disease virus matrix protein (BDV-M) reveals ssRNA binding properties. Proc. Natl. Acad. Sci. USA
106: 3710-3715
[Abstract]
[Full Text]
-
Wilda, M., Lopez, N., Casabona, J. C., Franze-Fernandez, M. T.
(2008). Mapping of the Tacaribe Arenavirus Z-Protein Binding Sites on the L Protein Identified both Amino Acids within the Putative Polymerase Domain and a Region at the N Terminus of L That Are Critically Involved in Binding. J. Virol.
82: 11454-11460
[Abstract]
[Full Text]
-
Ellenberg, P., Linero, F. N., Scolaro, L. A.
(2007). Superinfection exclusion in BHK-21 cells persistently infected with Junin virus. J. Gen. Virol.
88: 2730-2739
[Abstract]
[Full Text]
-
Capul, A. A., Perez, M., Burke, E., Kunz, S., Buchmeier, M. J., de la Torre, J. C.
(2007). Arenavirus Z-Glycoprotein Association Requires Z Myristoylation but Not Functional RING or Late Domains. J. Virol.
81: 9451-9460
[Abstract]
[Full Text]
-
Chase, G., Mayer, D., Hildebrand, A., Frank, R., Hayashi, Y., Tomonaga, K., Schwemmle, M.
(2007). Borna Disease Virus Matrix Protein Is an Integral Component of the Viral Ribonucleoprotein Complex That Does Not Interfere with Polymerase Activity. J. Virol.
81: 743-749
[Abstract]
[Full Text]
-
Kunz, S., Rojek, J. M., Roberts, A. J., McGavern, D. B., Oldstone, M. B. A., de la Torre, J. C.
(2006). Altered central nervous system gene expression caused by congenitally acquired persistent infection with lymphocytic choriomeningitis virus.. J. Virol.
80: 9082-9092
[Abstract]
[Full Text]
-
Garcia, C. C., Djavani, M., Topisirovic, I., Borden, K. L. B., Salvato, M. S., Damonte, E. B.
(2006). Arenavirus Z protein as an antiviral target: virus inactivation and protein oligomerization by zinc finger-reactive compounds.. J. Gen. Virol.
87: 1217-1228
[Abstract]
[Full Text]
-
Sanchez, A. B., Perez, M., Cornu, T., de la Torre, J. C.
(2005). RNA Interference-Mediated Virus Clearance from Cells both Acutely and Chronically Infected with the Prototypic Arenavirus Lymphocytic Choriomeningitis Virus. J. Virol.
79: 11071-11081
[Abstract]
[Full Text]
-
Sanchez, A. B., de la Torre, J. C.
(2005). Genetic and Biochemical Evidence for an Oligomeric Structure of the Functional L Polymerase of the Prototypic Arenavirus Lymphocytic Choriomeningitis Virus. J. Virol.
79: 7262-7268
[Abstract]
[Full Text]
-
Pinschewer, D. D., Perez, M., de la Torre, J. C.
(2005). Dual Role of the Lymphocytic Choriomeningitis Virus Intergenic Region in Transcription Termination and Virus Propagation. J. Virol.
79: 4519-4526
[Abstract]
[Full Text]
-
Neuman, B. W., Adair, B. D., Burns, J. W., Milligan, R. A., Buchmeier, M. J., Yeager, M.
(2005). Complementarity in the Supramolecular Design of Arenaviruses and Retroviruses Revealed by Electron Cryomicroscopy and Image Analysis. J. Virol.
79: 3822-3830
[Abstract]
[Full Text]
-
Hass, M., Golnitz, U., Muller, S., Becker-Ziaja, B., Gunther, S.
(2004). Replicon System for Lassa Virus. J. Virol.
78: 13793-13803
[Abstract]
[Full Text]
-
Perez, M., Greenwald, D. L., de La Torre, J. C.
(2004). Myristoylation of the RING Finger Z Protein Is Essential for Arenavirus Budding. J. Virol.
78: 11443-11448
[Abstract]
[Full Text]
-
Cornu, T. I., Feldmann, H., de la Torre, J. C.
(2004). Cells Expressing the RING Finger Z Protein Are Resistant to Arenavirus Infection. J. Virol.
78: 2979-2983
[Abstract]
[Full Text]
-
Baize, S., Kaplon, J., Faure, C., Pannetier, D., Georges-Courbot, M.-C., Deubel, V.
(2004). Lassa Virus Infection of Human Dendritic Cells and Macrophages Is Productive but Fails to Activate Cells. J. Immunol.
172: 2861-2869
[Abstract]
[Full Text]
-
Perez, M., Craven, R. C., de la Torre, J. C.
(2003). The small RING finger protein Z drives arenavirus budding: Implications for antiviral strategies. Proc. Natl. Acad. Sci. USA
100: 12978-12983
[Abstract]
[Full Text]
-
Jacamo, R., Lopez, N., Wilda, M., Franze-Fernandez, M. T.
(2003). Tacaribe Virus Z Protein Interacts with the L Polymerase Protein To Inhibit Viral RNA Synthesis. J. Virol.
77: 10383-10393
[Abstract]
[Full Text]
-
Strecker, T., Eichler, R., Meulen, J. t., Weissenhorn, W., Dieter Klenk, H., Garten, W., Lenz, O.
(2003). Lassa Virus Z Protein Is a Matrix Protein Sufficient for the Release of Virus-Like Particles. J. Virol.
77: 10700-10705
[Abstract]
[Full Text]
-
Pinschewer, D. D., Perez, M., Sanchez, A. B., de la Torre, J. C.
(2003). Recombinant lymphocytic choriomeningitis virus expressing vesicular stomatitis virus glycoprotein. Proc. Natl. Acad. Sci. USA
100: 7895-7900
[Abstract]
[Full Text]
-
Pinschewer, D. D., Perez, M., de la Torre, J. C.
(2003). Role of the Virus Nucleoprotein in the Regulation of Lymphocytic Choriomeningitis Virus Transcription and RNA Replication. J. Virol.
77: 3882-3887
[Abstract]
[Full Text]
-
Perez, M., de la Torre, J. C.
(2002). Characterization of the Genomic Promoter of the Prototypic Arenavirus Lymphocytic Choriomeningitis Virus. J. Virol.
77: 1184-1194
[Abstract]
[Full Text]
-
Cornu, T. I., de la Torre, J. C.
(2002). Characterization of the Arenavirus RING Finger Z Protein Regions Required for Z-Mediated Inhibition of Viral RNA Synthesis. J. Virol.
76: 6678-6688
[Abstract]
[Full Text]
-
Lee, K. J., Perez, M., Pinschewer, D. D., de la Torre, J. C.
(2002). Identification of the Lymphocytic Choriomeningitis Virus (LCMV) Proteins Required To Rescue LCMV RNA Analogs into LCMV-Like Particles. J. Virol.
76: 6393-6397
[Abstract]
[Full Text]