Previous Article | Next Article 
Journal of Virology, October 2001, p. 9302-9311, Vol. 75, No. 19
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.19.9302-9311.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Displacement of YY1 by Differentiation-Specific Transcription
Factor hSkn-1a Activates the P670 Promoter of Human
Papillomavirus Type 16
Iwao
Kukimoto and
Tadahito
Kanda*
Division of Molecular Genetics, National
Institute of Infectious Diseases, Shinjuku-ku, Tokyo 162-8640, Japan
Received 9 April 2001/Accepted 5 July 2001
 |
ABSTRACT |
Transcription from human papillomavirus type 16 (HPV16)
P670, a promoter in the E7 open reading frame, is repressed
in undifferentiated keratinocytes but becomes activated upon
differentiation. We showed that the transient luciferase expression
driven by P670 was markedly enhanced in HeLa cells
cotransfected with an expression plasmid for human Skn-1a
(hSkn-1a), a transcription factor specific to differentiating
keratinocytes. The hSkn-1a POU domain alone, which mediates
sequence-specific DNA binding, was sufficient to activate the
expression of luciferase. Electrophoretic mobility shift assay revealed
the presence of two binding sites, sites 1 and 2, upstream of
P670, which were shared by hSkn-1a and YY1. Site 1 bound more strongly to hSkn-1a than site 2 did. YY1 complexing
with a short DNA fragment having site 1 was displaced by
hSkn-1a, indicating that hSkn-1a's affinity with site
1 was stronger than YY1's. Disrupting the binding sites by nucleotide
substitutions raised the basal expression level of luciferase and
decreased the enhancing effect of hSkn-1a. In HeLa cells
transfected with circular HPV16 DNA along with the expression plasmid
for hSkn-1a, the transcript from P670 was
detectable, which indicates that the results obtained with the reporter
plasmids are likely to have mimicked the regulation of
P670 in authentic HPV16 DNA. The data strongly suggest that the transcription from P670 is repressed primarily by YY1
binding to the two sites, and the displacement of YY1 by
hSkn-1a releases P670 from the repression.
 |
INTRODUCTION |
Human papillomaviruses (HPVs), a
group of small icosahedral viruses with circular 8-kb DNA, have a
strong epithelial tropism (57). To date more than 80 HPV
genotypes have been identified and classified on the basis of their
pathogenicity and target tissues. HPVs that infect the cutaneous
epithelium, such as types 1, 2, 4, and 8, mainly cause skin warts. HPVs
that infect the mucosal epithelium, such as types 6 and 11, cause
benign condyloma, but types 16, 18, 31, and 33 cause cervical cancer
(35, 58). All HPVs have overall similarity in genomic
organization; the early region encoding the nonstructural viral
proteins (E1 through E7 proteins), the late region encoding the two
capsid proteins (L1 and L2 proteins), and the noncoding regulatory
region (long control region [LCR]) between the L1 and E6 genes
(57).
HPVs that infect basal cells of the epithelium through
microlesions are known to express their genes in such a way as
to be tightly linked to the differentiation state of the host
cells (34). The differentiation-dependent viral
transcription has been studied mainly in immortalized human
keratinocytes harboring HPV16 (15, 18, 29) or HPV31
(7, 25, 37). In undifferentiated cells the promoter in the
LCR, such as HPV16 P97 or HPV31 P97, is active
and directs transcription of E6, E7, and some other early genes, but
the promoter in the E7 open reading frame (ORF), such as HPV16
P670 or HPV31 P742, is
suppressed (18, 25, 38). Differentiation of the host cells
induces a dramatic increase of transcriptional activities of
P670 and P742, resulting in
expression of E1 and its downstream late genes (18, 21, 25, 31,
38, 45). Recently, the promoter in the HPV6 E7 ORF has been
shown to be negatively regulated by CCAAT displacement protein (CDP) (2) and YY1, a multifunctional protein acting as a
transcriptional activator or repressor (1). CDP and YY1
bind directly to the upstream region of the promoter in
undifferentiated cells (1, 2). However, the detailed
regulatory mechanism for the promoters in the HPV E7 ORF has yet to be
fully elucidated.
A number of transcription factors that regulate cell differentiation
have been found and grouped as the POU domain family (46).
The POU domain is a DNA-binding domain originally identified in
mammalian proteins Pit-1 (8, 27), Oct-1 (50),
and Oct-2 (10) and in Caenorhabditis
elegans protein unc-86 (13). Pit-1, Oct-2,
and unc-86 induce terminal differentiation of pituitary cells, B
lymphocytes, and neuronal cells, respectively. Skn-1a (4)
(also referred to as Epoc-1 [56] or Oct-11
[17]), a member of the POU domain family, is primarily
expressed in differentiating suprabasal keratinocytes but not
in proliferating basal cells and plays important regulatory roles in
both epidermal development and keratinocyte differentiation
(5). Also, Skn-1a activates keratin 10 (4)
and small proline-rich protein (14) genes and
downregulates involucrin (52) and profilaggrin
(28) genes through direct binding to their promoter
regions, considered a trigger for epithelial differentiation
(5). Murine Skn-1 and the recently isolated human Skn-1a
(hSkn-1a) (22) have been shown to enhance transcription
from promoters in the LCR of HPV types 1a, 16, and 18 (3, 22,
55).
In this study we have focused on the possible involvement of
hSkn-1a in regulation of HPV16 P670 and
found that hSkn-1a activated expression of the luciferase gene
driven by P670, probably through direct binding
to the promoter region in a sequence-specific manner. The binding sites
were shared with YY1, and disruption of the sites raised the basal
level of luciferase. YY1 in the YY1-DNA complex was displaced by
hSkn-1a, strongly suggesting that the primary repression of
P670 by YY1 is abrogated by replacement of YY1
with hSkn-1a, which is expressed only in the
differentiating keratinocytes.
 |
MATERIALS AND METHODS |
Construction of expression plasmids for
hSkn-1a.
The hSkn-1a cDNA in a human placenta cDNA
library (Takara, Osaka, Japan) was amplified by PCR (advantage2 PCR
kit; Clontech) using the sense primer (5'-AGG ATG GTG AAT CTG GAG TCC
ATG CAC) and the antisense primer (5'-GTC TAC GTG GAG GTA GGT GGA ATG
ATT). The DNA fragment was cloned into pGEM-T easy vector (Promega) to
generate pGEM-T/hSkn-1a. The nucleotide sequence of the obtained cDNA
was identical to that of the previously reported hSkn-1a cDNA
(22). The DNA fragment encoding hSkn-1a was
excised from pGEM-T/hSkn-1a by digestion with EcoRI, end
blunted, and inserted into the pCMV4 expression plasmid
(6) at the SmaI site, generating pCMV/hSkn-1a.
The EcoRI fragment was also inserted in frame into pHM6
(Roche Molecular Biochemicals) at the EcoRI site to generate pHM/hSkn-1a, which expresses the N-terminal hemagglutinin (HA)-tagged hSkn-1a protein. The expression plasmid for Skn-1a with an
N-terminal 187-amino-acid deletion (dN) was constructed by digestion of
pHM/hSkn-1a with XhoI and self ligation. The DNA fragments
encoding hSkn-1a with a C-terminal 92-amino-acid deletion (dC),
both N- and C-terminal deletions (dN/dC), or POU domain deletion (dPOU)
were synthesized by PCR (advantage-HF PCR kit; Clontech) using
pGEM-T/hSkn-1a as a template. The sense primers were 5'-CGG AAT TCG
ATG GTG AAT CTG GAG TCC for dC, 5'-CGG AAT TCC CTC GAG GAG CTG GAG AAG
for dN/dC, and 5'-CGG AAT TCG ATG GTG AAT CTG GAG TCC for dPOU. The antisense primers were 5'-CGG AAT TCA GGC CAC AGG GCA GTT GAT for dC
and dN/dC and 5'-CGG AAT TCA GTC ACT GGG CTC ATC GGC for dPOU. The
primers were designed to have EcoRI sites at their 5' ends.
The DNA fragments obtained by PCR were digested with EcoRI and inserted into pHM6 at the EcoRI site.
Construction of luciferase reporter plasmids.
Construction
of pLCR-Luc, which expresses the firefly luciferase gene under control
of the HPV16 LCR, was described previously (33). To
monitor transcription from P670, p670-Luc was
constructed by insertion of the DNA fragment carrying the luciferase
gene in the place of the E1 gene. Luciferase DNA, which was synthesized by PCR using primers having NcoI sites at their 5' ends and
digested with NcoI, was inserted at the NcoI site
of the HPV16 PstI-B fragment in the pUC/LCR
(33), pUC19 containing the 1776-bp PstI-B
fragment. In the resultant plasmid, p670-Luc, an HPV16 DNA fragment
from nucleotides (nt) 7010 through 7906 and from nt 1 to 864 was
fused with the luciferase DNA at the first ATG codon of the E1 gene. Nucleotide substitutions were introduced into the TATA motif in the LCR
or into the binding sites for hSkn-1a in pLCR-Luc or p670-Luc by using a Mutan-Super Express Km site-directed mutagenesis kit (Takara). The synthetic oligonucleotide used to abolish the TATA motif
was 5'-AAA TGT CTG CTT TGA
TGC TAA CCG GTT TC, and those to abrogate
binding with hSkn-1a were 5'-CAG CTG TAA TCA
AGG ACG GAG
ATA CAC CTA (for binding site 1) and 5'-GAT ACA CCT ACA
TAG
GAC GAA TAT ATG TTA (for
binding site 2). Nucleotides different from those of authentic
sequences are underlined.
Cell culture and luciferase assays.
HeLa S3 cells were grown
in Dulbecco's modified Eagle medium supplemented with 10% fetal calf
serum. In standard cotransfection assays, a mixture containing 200 ng
of luciferase reporter plasmids, 200 ng of expression plasmids for
hSkn-1a (or the backbone plasmid pCMV4), and 0.5 ng of a
control plasmid containing the cytomegalovirus (CMV) promoter-driven
Renilla luciferase was transfected into 40% confluent cells
per well of a 24-well plate using the Effectene transfection reagent
(Qiagen). At 48 h after transfection, luciferase activities of
cellular extracts were measured by using the PicaGene Dual SeaPansy
Luminescence Kit (Toyo Ink Co., Tokyo, Japan) and a microplate
luminometer LB96V (Perkin Elmer Applied Biosystems). Efficiency of
transfection was normalized using Renilla luciferase activity.
Immunoblotting.
HeLa cells in a 10-cm-diameter dish
were transfected with 2 µg of expression plasmids for
hSkn-1a. Forty-eight hours later cells were washed twice
with phosphate-buffered saline (PBS), resuspended in a sodium dodecyl
sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) sample buffer,
boiled for 5 min, and then subjected to SDS-12.5% PAGE. The
resolved proteins were transferred electrophoretically onto Hybond-P
membranes (Amersham Pharmacia Biotech, Uppsala, Sweden). The membranes
were incubated with anti-Skn-1a antibody (Santa Cruz) (1:1,000) or
anti-HA antibody (Roche Molecular Biochemicals) (1:10,000) in TBST (20 mM Tris [pH 7.5], 150 mM NaCl, and 0.1% Tween 20) containing 5%
(wt/vol) skim milk for 1 h at room temperature, washed four times
with TBST, incubated with horseradish peroxidase-conjugated anti-rabbit
or anti-mouse antibody in TBST containing 5% skim milk for 1 h at
room temperature, and then washed with TBST four times. Immunoreactive
proteins were visualized by the ECL plus chemiluminescence detection
system (Amersham Pharmacia Biotech).
Preparation of recombinant proteins.
The hSkn-1a
protein fused with glutathione S-transferase
(GST-hSkn-1a) and the DNA-binding domain of human YY1 protein
(amino acids 293 to 414) fused with GST (GST-
YY1) (24)
were bacterially produced. The EcoRI fragment isolated from
pGEM-T/hSkn-1a was inserted in frame into the EcoRI site
of pGEX-4T-3 (Amersham Pharmacia Biotech) to produce
pGEX-4T-3/hSkn-1a. The DNA fragment encoding the YY1 DNA-binding
domain was synthesized by PCR with a sense primer (5'-CGG AAT TCC AAG
AAC AAT AGC TTG CCC), an antisense primer (5'-CGG AAT TCA CTG GTT GTT
TTT GGC CTT), and a HeLa cell cDNA library. The PCR product was
digested with EcoRI and cloned in frame into pGEX-2TK at the
EcoRI site to produce pGEX-2TK/
YY1. pGEX-4T-3/hSkn-1a
and pGEX-2TK/
YY1 were introduced into Escherichia coli
strains BL21(DE3) plysS and JM109, respectively. The fusion proteins
were purified by GSTrap affinity-column chromatography (Amersham
Pharmacia Biotech) with AKTAprime (Amersham Pharmacia Biotech).
Electrophoretic mobility shift assay (EMSA).
A mixture
containing double-stranded 32P-labeled
oligonucleotides (0.4 pmol), either 1 µg of purified fusion proteins
or 10 µg of total extracts from HeLa cells, 1 µg of poly(dI-dC) in
a final volume of 10 µl of a buffer consisting of 20 mM Tris (pH 8.0), 50 mM NaCl, 10 mM MgCl2, 10% glycerol, 1 mM dithiothreitol (DTT), 0.5 mM phenylmethylsulfonyl fluoride (PMSF),
and 2 µg of aprotinin/ml was incubated at room temperature for 30 min. For supershift, anti-YY1 mouse monoclonal antibody (SC-7341; Santa Cruz Biotechnology, Inc., Santa Cruz, Calif.) (4 µg) was added to the
reaction mixture. The sample was then loaded on a 5% polyacrylamide gel and electrophoresed in 0.5× Tris-borate-EDTA buffer at 4°C. Gels were dried and visualized by autoradiography on X-ray films.
The sequences of double-stranded oligonucleotides are as follows: A (nt
501 to 530), 5'-CCGGTCGATGTATGTCTTGTTGCAGATCAT; B (nt 531 to 560),
5'-CAAGAACACGTAGAGAAACCCAGCTGTAAT; C (nt 551 to 580),
5'-CAGCTGTAATCATGCATGGAGATACACCTA; D (nt 561 to 590), 5'-CAT
GCATGGAGATACACCTACATTGCATGA; E (nt 571 to 600), 5'-GATA CACCTACATTGCATGAATATATGTTA; F (nt 581 to 610), 5'-CATTGCAT
GAATATATGTTAGATTTGCAAC; G (nt 591 to 620), 5'-ATATATGTTA
GATTTGCAACCAGAGACAAC; H (nt 611 to 640), 5'-CAGAGACAACT
GATCTCTACTGTTATGAGC; I (nt 641 to 670), 5'-AATTAAATGACAGCTCAGAGGAGGAGGATG; mC,
5'-CAGCTGTAATCAAGGACGGAGATACACCTA; mE,
5'-GATACACCTACATAGGACGAATATATGTTA;
mG,
5'-ATATATGTTAGATTAGGACCCAGAGACAAC; 7721-7750, 5'-TAACTAACCTAATTGCATATTTGGCATAAG; m7721-7750,
5'-TAACTAACCTAATAGGACATTTGGCATAAG; YY1-wt, 5'-CGCTCCGCGGCCATCTTGGCGGCTGGT; YY1-mut,
5'-CGCTCCGCGATTATCTTGGCGGCTGGT. Numbers in parentheses
indicate nucleotide numbers of the HPV16 genome (from the HPV Sequence
Database of Los Alamos National Laboratory), and nucleotides used for
substitution mutations are underlined.
Cellular extracts for EMSAs detecting complexes of hSkn-1a and
the probes were prepared using HeLa cells (2 × 10
6) transfected with 2 µg of expression
plasmids for hSkn-1a. At
48 h after transfection the cells
were washed with PBS twice and
resuspended in an extraction buffer
consisting of 50 mM HEPES
(pH 7.5), 420 mM KCl, 0.1 mM EDTA, 5 mM
MgCl
2, 2% glycerol, 1
mM DTT, 0.5 mM PMSF,
and 2 µg of aprotinin/ml, followed by freeze-thaw
five times. The
supernatant obtained by a centrifugation at 10,000
×
g
for 15 min at 4°C was used for
EMSAs.
HeLa cell extracts used for EMSAs detecting complexes of cellular YY1
and the probes were prepared as follows. The extracts
from HeLa cells
were obtained by freeze-thaw in the extraction
buffer and
centrifugation as described above. Then the supernatant
was dialyzed
against the extraction buffer lacking KCl for 4 h
at 4°C and
again centrifuged at 10,000 ×
g for 15 min at 4°C to
remove precipitates formed during
dialysis.
Detection of HPV transcripts by 5' RACE and Southern
blotting.
The HPV16 genome, excised from pHPV16K (30)
by digestion with BamHI and purified by extraction from an
agarose gel after electrophoresis, was self ligated at concentrations
of 50 ng/µl to avoid the formation of multimers. Using the Effectene
transfection reagent, HeLa cells (106 cells) were
transfected with the circular HPV16 DNA (2 µg) with pCMV4 (2 µg) or
pCMV/hSkn-1a (2 µg). At 48 h after transfection, mRNAs were
extracted by using the QuickPrep mRNA Purification Kit (Amersham
Pharmacia Biotech), followed by cDNA synthesis with the Marathon cDNA
library kit (Clontech). cDNAs specific to HPV16 in the libraries were
amplified by 5' rapid amplification of cDNA ends (RACE) (advantage2 PCR
kit; Clontech) using 5' RACE adapter sense primer and antisense primer
I (5'-ATC ATG TAT AGT TGT TTG CAG CTC TGT G, nt 178 to 151 of HPV16) or
antisense primer II (5'-CAC TAC AGC CTC TAC ATA AAA CC, nt 939 to 917).
PCR consisted of 5 cycles of denaturation at 94°C for 5 s and
annealing/extension at 72°C for 2 min, 5 cycles of denaturation at
94°C for 5 s and annealing/extension at 70°C for 2 min, and 25 cycles of denaturation at 94°C for 5 s and annealing/extension
at 68°C for 2 min. The PCR products were electrophoresed in a 0.7%
agarose gel, transferred to Hybond-XL membranes (Amersham Pharmacia
Biotech), and probed with 32P-labeled
oligonucleotides derived from HPV16 DNA, nt 7005 to 868 (the
PstI fragment) or nt 628 to 868 (synthesized by PCR). Prehybridization and hybridization were done at 60°C for 1 h in ExpressHyb hybridization solution (Clontech) followed by washes in 2×
SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate)-0.05% SDS at
room temperature and in 0.1× SSC-0.1% SDS at 50°C. The 5' RACE
products were directly cloned into pGEM-T easy, and the clones
containing HPV16 sequences were selected by standard colony hybridization with the probe of 32P-labeled
oligonucleotide derived from HPV16 nt 628 to 868. The cDNAs were
sequenced with an ABI310 sequencer (Perkin-Elmer Applied Biosystems).
 |
RESULTS |
Activation of P670 promoter by hSkn-1a.
To
examine expression from P670, which drives E1 and
late genes in HPV16 (18, 31), we constructed expression
plasmids p670-Luc and, for comparison, pLCR-Luc (Fig.
1A). Plasmids pLCR-Luc and p670-Luc had a
luciferase gene as a reporter in place of the E7 gene driven by
P97 and the E1 gene, respectively. For
measurement of enhancing effects of hSkn-1a, HeLa cells were
transfected with pLCR-Luc or p670-Luc together with the expression
plasmid for hSkn-1a (pCMV/hSkn-1a) or its backbone plasmid,
pCMV4. hSkn-1a expressed in HeLa cells transfected with
pCMV/hSkn-1a or pHM/hSkn-1a was detected by immunoblotting using
anti-hSkn-1a antibody, but endogenous hSkn-1a was
undetectable in mock-transfected HeLa cells (data not shown).
Forty-eight hours later, the luciferase activity was measured with the
cellular lysates (Fig. 1A). As reported previously with murine Skn-1a
(3, 55), hSkn-1a markedly enhanced luciferase
expression from P97 in pLCR-Luc. The luciferase
expression with p670-Luc, although less efficiently than with pLCR-Luc,
was also enhanced by hSkn-1a. It seems likely, from the
following observations, that the expression of luciferase with
p670-Luc, which contained the promoters P97 and
P670 (Fig. 1A), was mainly directed by
P670.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 1.
Activation of HPV16 P670 by hSkn-1a.
(A) Structures of the reporter plasmids are schematically illustrated
on the left. HeLa cells were cotransfected with 0.2 µg of the
luciferase reporter plasmids and 0.2 µg of pCMV4 or pCMV/hSkn-1a.
Luciferase activities of cell extracts were measured at 48 h after
transfection. Results are presented as means ± standard
deviations of three independent experiments. (B) Effects of HPV16 E2
expression on the hSkn-1a-mediated activation of
P670. HeLa cells were cotransfected with pCMV/hSkn-1a (1 µg), pLCR-Luc (0.2 µg) or p670-Luc (0.2 µg), and increasing
amounts of pCMV/E2 (a gift from Peter M. Howley). Luciferase activities
of cell extracts were measured at 48 h after transfection. Results
are presented as means ± standard deviations of three independent
experiments.
|
|
Disruption of the TATA motif for P
97 almost
abolished the luciferase expression with plasmid mTATA/pLCR-Luc but
did not greatly
affect the expression with mTATA/p670-Luc, which
lacked the TATA
motif for P
97 but retained
P
670 intact (Fig.
1A). With or without
P
97, the enhancing effects of hSkn-1a
were comparable on the expression
of luciferase in the position of the
E1 gene in the construct
of p670-Luc (Fig.
1A). It is expected from the
HPV transcription
studies (
9,
25,
39,
40,
43,
49) that
luciferase is
not efficiently translated from mRNA transcribed from
P
97 in p670-Luc,
because E6 and/or E7 ORFs are
polycistronically present upstream
of the luciferase ORF. Furthermore,
although the hSkn-1a-mediated
enhancement of the luciferase
expression with pLCR-Luc was interfered
with by HPV16 E2 protein, which
negatively regulates P
97 (
11,
23,
32,
41), the luciferase expression from p670-Luc was
enhanced by
hSkn-1a in the presence of E2 (Fig.
1B).
Similar results were obtained in experiments using pHM/hSkn-1a
expressing N-terminal HA-tagged hSkn-1a or in experiments using
HaCat cells, a human cell line of spontaneously immortalized
keratinocytes
negative for HPVs (data not
shown).
The POU domain of hSkn-1a capable of activating
P670.
The POU domain, which acts as a DNA-binding
motif and determines its binding specificity to target sequences
(20), was sufficient to activate
P670. Plasmids were constructed for expression of N-terminal HA-tagged hSkn-1a (pHM/hSkn-1a) and its family of
truncated proteins; the one with deletion of the N-terminal domain
(pHM/dN), the one with deletion of the C-terminal domain (pHM/dC), the
one with deletion of both domains (pHM/dNdC), and the one with deletion of the POU domain (pHM/dPOU) (Fig. 2A).
Expression of the truncated proteins in HeLa cells transfected with
these plasmids was shown by immunoblotting with anti-HA antibody (Fig.
2B). Capabilities of truncated hSkn-1a to activate
transcription from P670 were examined by
measuring luciferase activities of lysate obtained from HeLa cells
transfected with p670-Luc together with each of the pHM plasmids (Fig.
2C). The results showed that, like a full-size hSkn-1a, the POU
domain alone (dN/dC) seems to be capable of transactivating P670. The hSkn-1a lacking the POU domain
did not transactivate P670. Apparently, it
remains to be investigated how the other domains, the C-terminal
primary transactivation domain (22) and the N-terminal
domain, which has been reported to exhibit either inhibitory or
stimulatory effects on the transactivation by hSkn-1a
(22), affect the activation of P670.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 2.
hSkn-1a domains capable of transactivating
P670. (A) Schematic representation of N-terminal HA-tagged
truncated hSkn-1a expressed by pHM6 vector. (B) Immunoblotting
detection of the truncated hSkn-1a in total extracts from HeLa
cells transfected with pHM6 (a backbone plasmid) or expression plasmids
for HA-tagged hSkn-1a with or without deletion. (C) Activation
of P670 by the truncated hSkn-1a. HeLa cells were
cotransfected with p670-Luc (0.2 µg) and 0.2 µg of the expression
plasmids for HA-tagged hSkn-1a with or without deletion.
Luciferase activities of cell extracts were measured at 48 h after
transfection. Results are presented as means ± standard
deviations of three independent experiments.
|
|
Binding of hSkn-1a to the upstream region of
P670.
EMSAs showed that bacterially expressed and
purified hSkn-1a fused with glutathione
S-transferase (GST-hSkn-1a) bound to the synthetic
double-stranded oligonucleotide probe having the sequence of HPV16 nt
7721 to 7750 (Fig. 3A and B). The
nucleotide sequence from nt 7733 to 7738, TTGCAT, is similar to the
previously described core sequence of mouse Skn-1a-binding sites in
HPV18 LCR, TGCAT(A/C)T (55). Substitutions of A for T (nt
7733), G for C (nt 7735), and C for T (nt 7737) reduced binding of
hSkn-1a with the probe. The results strongly suggest that
hSkn-1a specifically binds to the HPV16 LCR sequence, which is
similar to the mouse Skn-1a-binding site in HPV18 LCR
(55).

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 3.
Binding of hSkn-1a with synthetic
oligonucleotides having partial sequences of the HPV16 E7 ORF. (A)
Probes A through I used for EMSAs have nucleotide sequences of the
regions schematically presented as rectangles. Numbers in parentheses
indicate nucleotide numbers in HPV16 DNA (from the HPV Sequence
Database of the Los Alamos National Laboratory). (B) EMSA detecting the
complex of GST-Skn-1a with the 32P-labeled HPV16 probe.
The DNA-protein complex was electrophoresed on a 5% polyacrylamide gel
and visualized by autoradiography. (C) EMSA detecting the complex of
GST-Skn-1a with the 32P-labeled probes having mutations in
the putative hSkn-1a binding sites. TGCA(A/T) in probes C, E,
and G were replaced with AGGAC to generate probes mC, mE, and mG,
respectively. (D) Cross-competition in an EMSA. Complex formed
GST-hSkn-1a, and a mixture of 32P-labeled probes
(0.4 pmol) and 4 pmol (×10) or 20 pmol (×50) of unlabeled competitors
was electrophoresed on a 5% polyacrylamide gel and visualized by
autoradiography. (E) EMSA detecting the complex of Skn-1a expressed in
HeLa cells and probe E. Total extracts from HeLa cells transfected with
the expression plasmids for HA-tagged hSkn-1a with or without
deletion was allowed to form a complex with 32P-labeled
probe E.
|
|
Direct binding of hSkn-1a to the upstream region of
P
670 was strongly suggested by EMSAs.
GST-hSkn-1a was mixed with the radiolabeled
probes having
nucleotide sequences of the regions designated A
to I (Fig.
3A), and
complex formation of GST-hSkn-1a with each
probe was detected
by mobility shift (Fig.
3B). GST-hSkn-1a bound
with probes C
to G, suggesting that at least two hSkn-1a-binding
sites were
located within the region from nt 551 to 620. Since
hSkn-1a did
not form complex with probes A, B, H, and I, the binding
of
hSkn-1a with the probes was shown to be sequence specific.
Boiling GST-hSkn-1a for 5 min completely abolished the binding
to the probes (data not shown), suggesting that conformational
integrity of hSkn-1a is required for its DNA binding. Moreover,
GST-hSkn-1a did not bind any synthetic single-stranded
oligonucleotides
used to generate the probes by annealing (data not
shown).
Consistent with the mobility shift data (Fig.
3B), the sequences of
probes C to G were found to contain motifs similar to
those found in
the HPV18 or HPV16 LCR (TTGCAT). Three imperfect
palindromes composed
of two octamer-like sequences, (A/T)TGCA(A/T)XX,
were located at nt 560 to 569 (site 1), at nt 581 to 590 (site
2), and at nt 602 to 611 (site
3) (Fig.
4). To test whether these
motifs
in the probes are actually involved in binding with hSkn-1a,
they were subjected to substitution mutation.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 4.
Nucleotide sequence upstream of P670. The
putative hSkn-1a binding sites 1, 2, and 3 are underlined.
Boxed in gray is CAT, which may serve as a core of YY1-binding sites.
The sequence is from the Los Alamos National Laboratory database.
|
|
Nucleotide substitutions of AGGAC for TGCA(A/T) were introduced
into the putative hSkn-1a binding sites in the probes of
C,
E, and G to produce mutated probes mC, mE, and mG, respectively,
which were tested for binding with GST-hSkn-1a and then
examined
by EMSA (Fig.
3C). Probes mC and mE totally lost their
capability
of complexing with hSkn-1a, indicating that the sequences of
sites
1 and 2 were essential for probes C and E, respectively, to bind
with hSkn-1a. However, mG bound to hSkn-1a with a
reduced level,
indicating that the binding of hSkn-1a to probe
G was not specific
to the nucleotide sequence of site 3. Thus, it was
concluded that
hSkn-1a appears to bind to the upstream region
of P
670 at sites
1 and 2 in a sequence-specific
manner.
The relative binding affinity of hSkn-1a with the three sites
was examined by cross competition using probes C, E, and G in
EMSA
(Fig.
3D). The binding of GST-hSkn-1a with the radiolabeled
C
and E probes was clearly competed by excess homologous cold
competitors added to the reaction mixtures. Formation of the hSkn-1a/C
complex was partly disrupted by addition of the excess E probe.
Formation of hSkn-1a/E complex was disrupted by the addition of
the
excess C probe but not by the excess G probe. Thus, site 1
in probe C
had the strongest hSkn-1a-binding affinity, followed
by site 2 in probe E and then site 3 in probe G. Because of its
low sequence
specificity and weak binding affinity, site 3 was
not analyzed
further.
Like bacterially expressed GST-hSkn-1a, hSkn-1a
expressed in eukaryotic cells was found to bind to probe E. Total
lysates
of HeLa cells transfected with pHM/hSkn-1a, pHM/dN, pHM/dC,
pHM/dPOU,
and pHM/dNdC expression plasmids for N-terminal HA-tagged
hSkn-1a,
HA-tagged hSkn-1a with deletion of N-terminal
domain, HA-tagged
hSkn-1a with deletion of C-terminal domain,
HA-tagged hSkn-1a
with deletion of POU domain, and HA-tagged
hSkn-1a with deletions
of both N- and C-terminal domains,
respectively, were mixed with
the
32P-labeled E
probe, and complex formation was examined (Fig.
3E).
All of the
proteins having the POU domain showed the capability
of binding to the
probe and showed that the protein lacking the
POU domain lost the
capability, indicating that the binding was
mediated by the POU domain.
Full-length hSkn-1a transiently expressed
in HeLa cells was
also found to bind to radiolabeled probes C
and G (data not
shown).
Binding of YY1 to the upstream region of P670.
YY1, a potential transcriptional repressor, was examined for its
ability to bind to the upstream region of HPV16
P670, because a recent study of HPV6
(1) suggests that it may negatively regulate expression
from P670. For binding assays, fusion protein GST-
YY1 was used, which is comprised of the DNA-binding domain of
human YY1 protein (amino acids 293 to 414) and GST. GST-
YY1 was
found to form a complex with the 32P-labeled
YY1-wt, an oligonucleotide probe containing the consensus YY1-binding
motif (19), but not with YY1-mut, the probe having a
mutation in the motif in EMSA (Fig. 5A).
Because DNA-binding properties of
YY1 and full-length YY1 have been
shown to be indistinguishable (23), the EMSA data using
GST-
YY1 is considered to reflect the behavior of native YY1 in
complex formation.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 5.
Binding of YY1 with synthetic oligonucleotides having
partial sequences of the HPV16 E7 ORF. (A) EMSA detecting the complex
of GST- YY1 with 32P-labeled probe having sequences with
which YY1 has been shown to bind (YY1-wt) or not to bind (YY1-mut)
(19) (left panel) and the complex of GST- YY1 with the
32P-labeled HPV16 probes (see Fig. 3A) (right panel). The
DNA-protein complexes were electrophoresed on a 5% polyacrylamide gel
and visualized by autoradiography. (B) EMSA detecting the complex of
GST- YY1 with the 32P-labeled probes having mutations in
the putative hSkn-1a binding sites (see the legend to Fig. 3C).
(C) EMSA showing displacement of YY1 from the complex of YY1/probe
C by Skn-1a. The mixture of GST- YY1 and 32P-labeled
probe C or 32P-labeled probe YY1-wt was incubated (inc.)
for 30 min. Then GST-Skn-1a was added to the mixture, and the
mixture was further incubated for 5 min. The DNA-protein complexes were
electrophoresed on a 5% polyacrylamide gel and visualized by
autoradiography. Closed and open triangles indicate complexes of
GST- YY1/probe C and GST-Skn-1a/probe C, respectively. (D) EMSA
detecting the complex of HeLa cell YY1 and 32P-labeled
probes. The HeLa extract containing endogenous YY1 was mixed with
the probe indicated (see the legends to Fig. 3A and 5A), and the
mixture was incubated. The DNA-protein complexes were separated
by electrophoresis on a 5% polyacrylamide gel and visualized by
autoradiography. To detect the presence of YY1 in the complex, anti-YY1
mouse monoclonal antibody ( -YY1) or purified mouse immunoglobulin G
was added to the reaction mixture to show the supershift of the
migrating bands. Closed and hatched triangles indicate the complexes of
YY1/probe and the YY1/anti-YY1 antibody/probe, respectively. Ab,
antibody.
|
|
Mobility shift assays showed that the hSkn-1a-binding site
serves as a binding site for YY1. GST-

YY1 was found to bind to
probes C (containing site 1), D (site 1), E (site 2), and I among
the
probes (A to I) tested (Fig.
5A). However, GST-

YY1 did not
form a
complex with probes mC or mE, which had the nucleotide
substitutions in
hSkn-1a-binding sites 1 and 2, respectively (Fig.
5B). Sites 1 and 2 contain CAT, the core motif of YY1 binding
sites (
26,
54) (Fig.
4). Thus, YY1 is likely to bind to sites
1 and 2, sharing these binding sites with hSkn-1a. It should be
noted
that the signal of GST-

YY1/E complex was weaker than that
of
GST-

YY1/C complex in the autoradiograms (Figs.
5A and B),
suggesting that the affinity of YY1 is weaker with site 2 (in
probe E)
than with site 1 (probe
C).
Addition of hSkn-1a to the preformed YY1/C complex resulted in
displacement of YY1 by hSkn-1a in EMSA (Fig.
5C). The preformed
complex of GST-

YY1 and
32P-labeled probe C
(the complex migrating faster in Fig.
5C) was
reformed to make the
GST-hSkn-1a/C complex (migrating slower)
within 5 min after
the addition of GST-hSkn-1a. GST-

YY1 made
a firm complex
with probe YY1-wt, which contains the consensus
YY1-binding motif, and
the resulting complex was not disrupted
by hSkn-1a. Thus, it
was concluded that the affinity of site 1
is stronger with
hSkn-1a than with
YY1.
Using HeLa cell extracts, we attempted to show by EMSA that cellular
endogenous YY1 binds to the hSkn-1a-binding site (Fig.
5D). The
complex formed in the mixture of the extracts and
32P-labeled probe C was supershifted in the
presence of anti-YY1
mouse monoclonal antibody, indicating that the
complex contained
YY1. With probe mC in place of probe C, however, the
complex was
undetectable. Thus, like bacterially expressed GST-

YY1,
endogenous
YY1 in HeLa cells was found to bind to site 1 in probe C. On
the
other hand, binding of probe E with the HeLa extract under the
same
conditions as above was not detected, probably because of
the weaker
affinity with site
2.
Expression of luciferase with p670-Luc having mutations in
hSkn-1a/YY1 binding sites 1 and 2.
When the nucleotide
substitutions that abolished bindings of hSkn-1a and YY1 to
probes C and E in EMSAs (Fig. 3C and 5B) were introduced into
corresponding regions of mTATA/p670-Luc to abolish bindings with YY1
and hSkn-1a, the basal level of the luciferase expression from
P670 without hSkn-1a was raised and the
effects of mutations in the two sites were synergistic. Luciferase
activities of HeLa cells transfected with mTATA/m1/p670-Luc and
mTATA/m2/p670-Luc, which had the mutations in hSkn-1a-binding sites 1 and 2, respectively, were elevated to nearly half of the activities
obtained by the activation by hSkn-1a (Fig.
6). Luciferase activity of HeLa cells transfected with mTATA/m1&m2/p670-Luc, of which the two sites were
mutated, was higher than those obtained with mTATA/m1/p670-Luc or
mTATA/m2/p670-Luc, and the activation by hSkn-1a was no longer prominent. The results indicate that transcription from
P670 is primarily suppressed by YY1.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 6.
Activation of P670 by disruption of the
hSkn-1a/YY1-binding sites. The nucleotide substitutions (see the
legend to Fig. 3C) were introduced in sites 1 and 2 in mTATA/p670-Luc
to generate plasmids lacking binding sites for hSkn-1a/YY1. HeLa cells
were cotransfected with 0.2 µg of the plasmids with the mutations and
0.2 µg of pCMV4 or pCMV/Skn-1a. Luciferase activities of cell
extracts were measured at 48 h after transfection. Results are
presented as means ± standard deviations of three independent
experiments.
|
|
Effect of hSkn-1a on transcription from P670 of
HPV16 DNA.
Expression of hSkn-1a resulted in activation of
transcription from P670 in HPV16 DNA to produce
mRNA encoding the E1 protein (Fig. 7). To
analyze the effect of hSkn-1a on authentic transcription from
HPV16 DNA, HeLa cells were transfected with a complete circular genome
of HPV16 together with pCMV/hSkn-1a or with pCMV4. At 48 h after
transfection, mRNA was isolated by oligo(dT) column chromatography, followed by cDNA synthesis. HPV16-specific transcripts were amplified by 5' RACE using two HPV16-specific primers; primer I anneals the E6
region and primer II anneals the E1 region, which is not present in
E1
E4 mRNA generated by the splicing. The
amplified DNA fragments were electrophoresed on an agarose gel,
followed by Southern blotting using two radiolabeled probes hybridizing
the HPV16 region of nt 7005 to 868 or nt 628 to 868 (Fig. 7A). 5' RACE
with primer I similarly amplified cDNAs derived from
transcripts from P97 with or without
hSkn-1a (Fig. 7B). The enhancing effect of hSkn-1a on
transcription from P97 may be interfered with by
E2 protein in a negative-feedback manner. 5' RACE with primer
II amplified cDNA of around 300 bp in the cDNA library constructed
from HeLa cells expressing hSkn-1a (Fig. 7C). Without
hSkn-1a, the cDNA was not synthesized. The cDNA molecules were
cloned into pGEM-T easy plasmid and were sequenced. The 5' ends of
cDNAs were near at nt 670, and the most 5'-upstream nucleotide of cDNAs
sequenced was G at nt 694. The function of transiently expressed
hSkn-1a was verified by induction of synthesis of keratin 10 mRNA in HeLa cells transfected with pCMV/hSkn-1a (Fig. 7D). Thus, the
results obtained in the experiments using expression plasmids for
luciferase driven by P670 seem to mimic
expression of the E1 gene in HPV16 infection.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 7.
Transcription from circular HPV16 DNA in HeLa cells
expressing hSkn-1a. (A) Schematic representation of the gene
organization of HPV16 and transcripts from P97 and
P670. I and II are primers used to amplify cDNAs derived
from HPV16 transcripts by 5' RACE. (B) The cDNAs were amplified by 5'
RACE using the primer I and cDNA libraries constructed from HeLa cells
transfected with pCMV4 (the backbone plasmid) (lane 1) or pCMV/hSkn-1a
(lane 2). The PCR products were electrophoresed in a 0.7% agarose gel,
transferred to nylon membranes, and probed with 32P-labeled
oligonucleotides derived from the indicated region of HPV16 DNA. cDNAs
hybridized with the probes were visualized by autoradiography. (C)
Experiments were carried out as described for panel B except that
primer II was used for 5' RACE. (D) PCR-amplified cDNAs of human
keratin 10 and human -actin in cDNA libraries constructed
from HeLa cells transfected with pCMV4 (lane 1) or with pCMV/hSkn-1a
(lane 2). The cDNA corresponding to the region from exons 2 to 4 of
human keratin 10 (44) was amplified using the sense primer
5'-CTAACAACTGAT AATGCCAACATCCTG and the antisense primer 5'-GGGGCA
GCATTCATTTCCACATTCACA. Part of the -actin cDNA was amplified using
the primer set of TaqMan -actin Control Reagent (Perkin Elmer
Applied Biosystems). The PCR products were electrophoresed on a 1.2%
agarose gel, followed by staining with ethidium bromide. The sequences
of the cDNAs agreed with those in the database (GenBank).
|
|
 |
DISCUSSION |
This study has shown that the POU transcription factor
hSkn-1a, which is known to modulate the expression of several
genes associated with keratinocyte differentiation (4, 5),
activates HPV16 P670 on the expression plasmid
and the circular HPV16 DNA in the transient expression assays and that
the upstream promoter region contains two specific binding sites for
hSkn-la, which are shared by YY1, a transcriptional regulator. The
results indicate that hSkn-la is probably capable of activating
transcription from P670 by binding to DNA in a
sequence-specific manner in natural HPV16 infection. Transcripts from
promoters in the E7 ORF, such as P670 and
P742 of HPV31, encode helicase (E1) and capsid
proteins (L1 and L2) (25, 31, 38). Replication of the HPV
genome and accumulation of HPV capsid proteins have been observed in the suprabasal differentiating strata (45), where
hSkn-1a is predominantly expressed (4, 5). Thus,
hSkn-1a, by activating P670, is likely to
initiate HPV16 vegetative replication leading to virion production in
differentiating keratinocytes.
Human Skn-1a seems to activate P670 by displacing
YY1 bound to the two sites for hSkn-1a. The displacement was
shown to occur in vitro in this study (Fig. 5C). Because YY1 is
abundant in most cells (47, 51) and is a probable
transcriptional repressor in the HPV6 replication
(1), it would be reasonable to presume that YY1 in HeLa
cells or undifferentiated keratinocytes readily binds to the viral
hSkn-1a-binding sites, resulting in repression of
P670 on the transfecting expression plasmid or
persisting episomal HPV16 DNA (16, 36, 42, 48, 53). In
fact, the expression from P670 was enhanced
greatly when YY1 was prevented from binding to the promoter region
modified by the substitution mutations (Fig. 6). It is probable,
therefore, that hSkn-1a emerging in differentiating
keratinocytes removes YY1 bound to the hSkn-1a sites in the
promoter region on episomal HPV16 DNA and initiate virion production.
The results of substitution analyses (Fig. 6) also suggest that the
activation of P670 by hSkn-1a depends
mostly on the removal of YY1 but not on the potential activator
function of hSkn-1a, because when the binding sites were
disrupted by nucleotide substitutions, the basal level of expression
from P670 was comparable to that brought about by
hSkn-1a-mediated activation. The results are consistent with
the fact that the POU domain alone was sufficient to activate the
expression as efficiently as the full-length hSkn-1a (Fig. 2).
The putative binding sequence for hSkn-1a, (A/T)TGCA(A/T)XX,
found in this study with HPV16 was searched for in the homologous promoter regions of various HPVs (of the HPV Sequence Database of the
Los Alamos National Laboratory). The sequence was found in HPV types 6 (11), 18, 31, and 45 but not in types 1, 5, 8, 33, 52, and
58. It remains to be investigated whether hSkn-1a can bind to a
different motif or whether a yet unidentified factor(s) other than
hSkn-1a can initiate HPV replication in the differentiating cells.
It would be of interest to know whether other keratinocyte-specific
transcription factors can activate HPV promoters. Besides Skn-1a, the
epidermis contains other POU domain transcription factors, such as
Tst-1, Oct-1, and Oct-2 (5). The expression of Tst-1 is
also linked to keratinocyte differentiation (12), whereas
the ubiquitous factor Oct-1 is expressed independently of the
differentiation and Oct-2 is expressed only in undifferentiated keratinocytes. Since Skn-1a and Tst-1 appear to function redundantly in
keratinocyte differentiation in mice (5), it is possible that Tst-1 is capable of activating HPV promoters. Understanding the
transcriptional regulation of HPVs in differentiating keratinocytes would help develop a cell culture system that allows HPVs to grow efficiently in vitro.
 |
ACKNOWLEDGMENTS |
We thank Kunito Yoshiike for critical reading of the manuscript
and Peter M. Howley for providing the expression plasmid for the HPV16
E2 protein.
This work was supported by a grant-in-aid from the Ministry of Health
and Welfare for the Second-Term Comprehensive 10-year Strategy for
Cancer Control and for Research on Human Genome and Gene Therapy and by
a research grant from the Princess Takamatsu Cancer Reseach Fund
(00-23204).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Division of
Molecular Genetics, National Institute of Infectious Diseases, 1-23-1 Toyama, Shinjuku-ku, Tokyo 162-8640, Japan. Phone: (81) 3-5285-1111. Fax: (81) 3-5285-1166. E-mail: kanda{at}nih.go.jp.
 |
REFERENCES |
| 1.
|
Ai, W.,
J. Narahari, and A. Roman.
2000.
Yin yang 1 negatively regulates the differentiation-specific E1 promoter of human papillomavirus type 6.
J. Virol.
74:5198-5205[Abstract/Free Full Text].
|
| 2.
|
Ai, W.,
E. Toussaint, and A. Roman.
1999.
CCAAT displacement protein binds to and negatively regulates human papillomavirus type 6 E6, E7, and E1 promoters.
J. Virol.
73:4220-4229[Abstract/Free Full Text].
|
| 3.
|
Andersen, B.,
A. Hariri,
M. R. Pittelkow, and M. G. Rosenfeld.
1997.
Characterization of Skn-1a/i POU domain factors and linkage to papillomavirus gene expression.
J. Biol. Chem.
272:15905-15913[Abstract/Free Full Text].
|
| 4.
|
Andersen, B.,
M. D. Schonemann,
S. E. Flynn,
R. V. D. Pearse,
H. Singh, and M. G. Rosenfeld.
1993.
Skn-1a and Skn-1i: two functionally distinct Oct-2-related factors expressed in epidermis.
Science
260:78-82[Abstract/Free Full Text].
|
| 5.
|
Andersen, B.,
W. C. Weinberg,
O. Rennekampff,
R. J. McEvilly,
J. R. Bermingham, Jr.,
F. Hooshmand,
V. Vasilyev,
J. F. Hansbrough,
M. R. Pittelkow,
S. H. Yuspa, and M. G. Rosenfeld.
1997.
Functions of the POU domain genes Skn-1a/i and Tst-1/Oct-6/SCIP in epidermal differentiation.
Genes Dev.
11:1873-1884[Abstract/Free Full Text].
|
| 6.
|
Andersson, S.,
D. L. Davis,
H. Dahlback,
H. Jornvall, and D. W. Russell.
1989.
Cloning, structure, and expression of the mitochondrial cytochrome P-450 sterol 26-hydroxylase, a bile acid biosynthetic enzyme.
J. Biol. Chem.
264:8222-8229[Abstract/Free Full Text].
|
| 7.
|
Bedell, M. A.,
J. B. Hudson,
T. R. Golub,
M. E. Turyk,
M. Hosken,
G. D. Wilbanks, and L. A. Laimins.
1991.
Amplification of human papillomavirus genomes in vitro is dependent on epithelial differentiation.
J. Virol.
65:2254-2260[Abstract/Free Full Text].
|
| 8.
|
Bodner, M.,
J. L. Castrillo,
L. E. Theill,
T. Deerinck,
M. Ellisman, and M. Karin.
1988.
The pituitary-specific transcription factor GHF-1 is a homeobox-containing protein.
Cell
55:505-518[CrossRef][Medline].
|
| 9.
|
Chow, L. T.,
M. Nasseri,
S. M. Wolinsky, and T. R. Broker.
1987.
Human papillomavirus types 6 and 11 mRNAs from genital condylomata acuminata.
J. Virol.
61:2581-2588[Abstract/Free Full Text].
|
| 10.
|
Clerc, R. G.,
L. M. Corcoran,
J. H. LeBowitz,
D. Baltimore, and P. A. Sharp.
1988.
The B-cell-specific Oct-2 protein contains POU box- and homeobox-type domains.
Genes Dev.
2:1570-1581[Abstract/Free Full Text].
|
| 11.
|
Dong, G.,
T. R. Broker, and L. T. Chow.
1994.
Human papillomavirus type 11 E2 proteins repress the homologous E6 promoter by interfering with the binding of host transcription factors to adjacent elements.
J. Virol.
68:1115-1127[Abstract/Free Full Text].
|
| 12.
|
Faus, I.,
H. J. Hsu, and E. Fuchs.
1994.
Oct-6: a regulator of keratinocyte gene expression in stratified squamous epithelia.
Mol. Cell. Biol.
14:3263-3275[Abstract/Free Full Text].
|
| 13.
|
Finney, M., and G. Ruvkun.
1990.
The unc-86 gene product couples cell lineage and cell identity in C. elegans.
Cell
63:895-905[CrossRef][Medline].
|
| 14.
|
Fischer, D. F.,
S. Gibbs,
P. van De Putte, and C. Backendorf.
1996.
Interdependent transcription control elements regulate the expression of the SPRR2A gene during keratinocyte terminal differentiation.
Mol. Cell. Biol.
16:5365-5374[Abstract].
|
| 15.
|
Flores, E. R.,
B. L. Allen-Hoffmann,
D. Lee,
C. A. Sattler, and P. F. Lambert.
1999.
Establishment of the human papillomavirus type 16 (HPV-16) life cycle in an immortalized human foreskin keratinocyte cell line.
Virology
262:344-354[CrossRef][Medline].
|
| 16.
|
Galvin, K. M., and Y. Shi.
1997.
Multiple mechanisms of transcriptional repression by YY1.
Mol. Cell. Biol.
17:3723-3732[Abstract].
|
| 17.
|
Goldsborough, A. S.,
L. E. Healy,
N. G. Copeland,
D. J. Gilbert,
N. A. Jenkins,
K. R. Willison, and A. Ashworth.
1993.
Cloning, chromosomal localization and expression pattern of the POU domain gene Oct-11.
Nucleic Acids Res.
21:127-134[Abstract/Free Full Text].
|
| 18.
|
Grassmann, K.,
B. Rapp,
H. Maschek,
K. U. Petry, and T. Iftner.
1996.
Identification of a differentiation-inducible promoter in the E7 open reading frame of human papillomavirus type 16 (HPV-16) in raft cultures of a new cell line containing high copy numbers of episomal HPV-16 DNA.
J. Virol.
70:2339-2349[Abstract].
|
| 19.
|
Hariharan, N.,
D. E. Kelley, and R. P. Perry.
1991.
Delta, a transcription factor that binds to downstream elements in several polymerase II promoters, is a functionally versatile zinc finger protein.
Proc. Natl. Acad. Sci. USA
88:9799-9803[Abstract/Free Full Text].
|
| 20.
|
Herr, W., and M. A. Cleary.
1995.
The POU domain: versatility in transcriptional regulation by a flexible two-in-one DNA-binding domain.
Genes Dev.
9:1679-1693[Free Full Text].
|
| 21.
|
Higgins, G. D.,
D. M. Uzelin,
G. E. Phillips,
P. McEvoy,
R. Marin, and C. J. Burrell.
1992.
Transcription patterns of human papillomavirus type 16 in genital intraepithelial neoplasia: evidence for promoter usage within the E7 open reading frame during epithelial differentiation.
J. Gen Virol.
73:2047-2057[Abstract/Free Full Text].
|
| 22.
|
Hildesheim, J.,
R. A. Foster,
M. E. Chamberlin, and J. C. Vogel.
1999.
Characterization of the regulatory domains of the human skn-1a/Epoc-1/Oct-11 POU transcription factor.
J. Biol. Chem.
274:26399-26406[Abstract/Free Full Text].
|
| 23.
|
Hou, S. Y.,
S. Y. Wu,
T. Zhou,
M. C. Thomas, and C. M. Chiang.
2000.
Alleviation of human papillomavirus E2-mediated transcriptional repression via formation of a TATA binding protein (or TFIID)-TFIIB-RNA polymerase II-TFIIF preinitiation complex.
Mol. Cell. Biol.
20:113-125[Abstract/Free Full Text].
|
| 24.
|
Houbaviy, H. B.,
A. Usheva,
T. Shenk, and S. K. Burley.
1996.
Cocrystal structure of YY1 bound to the adeno-associated virus P5 initiator.
Proc. Natl. Acad. Sci. USA
93:13577-13582[Abstract/Free Full Text].
|
| 25.
|
Hummel, M.,
J. B. Hudson, and L. A. Laimins.
1992.
Differentiation-induced and constitutive transcription of human papillomavirus type 31b in cell lines containing viral episomes.
J. Virol.
66:6070-6080[Abstract/Free Full Text].
|
| 26.
|
Hyde-DeRuyscher, R. P.,
E. Jennings, and T. Shenk.
1995.
DNA binding sites for the transcriptional activator/repressor YY1.
Nucleic Acids Res.
23:4457-4465[Abstract/Free Full Text].
|
| 27.
|
Ingraham, H. A.,
R. P. Chen,
H. J. Mangalam,
H. P. Elsholtz,
S. E. Flynn,
C. R. Lin,
D. M. Simmons,
L. Swanson, and M. G. Rosenfeld.
1988.
A tissue-specific transcription factor containing a homeodomain specifies a pituitary phenotype.
Cell
55:519-529[CrossRef][Medline].
|
| 28.
|
Jang, S. I.,
N. Karaman-Jurukovska,
M. I. Morasso,
P. M. Steinert, and N. G. Markova.
2000.
Complex interactions between epidermal POU domain and activator protein 1 transcription factors regulate the expression of the profilaggrin gene in normal human epidermal keratinocytes.
J. Biol. Chem.
275:15295-15304[Abstract/Free Full Text].
|
| 29.
|
Jeon, S.,
B. L. Allen-Hoffmann, and P. F. Lambert.
1995.
Integration of human papillomavirus type 16 into the human genome correlates with a selective growth advantage of cells.
J. Virol.
69:2989-2997[Abstract].
|
| 30.
|
Kanda, T.,
S. Watanabe, and K. Yoshiike.
1987.
Human papillomavirus type 16 transformation of rat 3Y1 cells.
Jpn. J. Cancer Res.
78:103-108[Medline].
|
| 31.
|
Klumpp, D. J., and L. A. Laimins.
1999.
Differentiation-induced changes in promoter usage for transcripts encoding the human papillomavirus type 31 replication protein E1.
Virology
257:239-246[CrossRef][Medline].
|
| 32.
|
Kovelman, R.,
G. K. Bilter,
E. Glezer,
A. Y. Tsou, and M. S. Barbosa.
1996.
Enhanced transcriptional activation by E2 proteins from the oncogenic human papillomaviruses.
J. Virol.
70:7549-7560[Abstract].
|
| 33.
|
Kozuka, T.,
Y. Aoki,
K. Nakagawa,
K. Ohtomo,
H. Yoshikawa,
K. Matsumoto,
K. Yoshiike, and T. Kanda.
2000.
Enhancer-promoter activity of human papillomavirus type 16 long control regions isolated from cell lines SiHa and CaSki and cervical cancer biopsies.
Jpn. J. Cancer Res.
91:271-279[CrossRef][Medline].
|
| 34.
|
Laimins, L. A.
1993.
The biology of human papillomaviruses: from warts to cancer.
Infect. Agents Dis.
2:74-86[Medline].
|
| 35.
|
Lorincz, A. T.,
R. Reid,
A. B. Jenson,
M. D. Greenberg,
W. Lancaster, and R. J. Kurman.
1992.
Human papillomavirus infection of the cervix: relative risk associations of 15 common anogenital types.
Obstet. Gynecol.
79:328-337[Medline].
|
| 36.
|
May, M.,
X. P. Dong,
E. Beyer-Finkler,
F. Stubenrauch,
P. G. Fuchs, and H. Pfister.
1994.
The E6/E7 promoter of extrachromosomal HPV16 DNA in cervical cancers escapes from cellular repression by mutation of target sequences for YY1.
EMBO J.
13:1460-1466[Medline].
|
| 37.
|
Meyers, C.,
M. G. Frattini,
J. B. Hudson, and L. A. Laimins.
1992.
Biosynthesis of human papillomavirus from a continuous cell line upon epithelial differentiation.
Science
257:971-973[Abstract/Free Full Text].
|
| 38.
|
Ozbun, M. A., and C. Meyers.
1997.
Characterization of late gene transcripts expressed during vegetative replication of human papillomavirus type 31b.
J. Virol.
71:5161-5172[Abstract].
|
| 39.
|
Ozbun, M. A., and C. Meyers.
1998.
Human papillomavirus type 31b E1 and E2 transcript expression correlates with vegetative viral genome amplification.
Virology
248:218-230[CrossRef][Medline].
|
| 40.
|
Ozbun, M. A., and C. Meyers.
1998.
Temporal usage of multiple promoters during the life cycle of human papillomavirus type 31b.
J. Virol.
72:2715-2722[Abstract/Free Full Text].
|
| 41.
|
Rapp, B.,
A. Pawellek,
F. Kraetzer,
M. Schaefer,
C. May,
K. Purdie,
K. Grassmann, and T. Iftner.
1997.
Cell-type-specific separate regulation of the E6 and E7 promoters of human papillomavirus type 6a by the viral transcription factor E2.
J. Virol.
71:6956-6966[Abstract].
|
| 42.
|
Raught, B.,
B. Khursheed,
A. Kazansky, and J. Rosen.
1994.
YY1 represses beta-casein gene expression by preventing the formation of a lactation-associated complex.
Mol. Cell. Biol.
14:1752-1763[Abstract/Free Full Text].
|
| 43.
|
Remm, M.,
A. Remm, and M. Ustav.
1999.
Human papillomavirus type 18 E1 protein is translated from polycistronic mRNA by a discontinuous scanning mechanism.
J. Virol.
73:3062-3070[Abstract/Free Full Text].
|
| 44.
|
Rieger, M., and W. W. Franke.
1988.
Identification of an orthologous mammalian cytokeratin gene. High degree of intron sequence conservation during evolution of human cytokeratin 10.
J. Mol. Biol.
204:841-856[CrossRef][Medline].
|
| 45.
|
Ruesch, M. N.,
F. Stubenrauch, and L. A. Laimins.
1998.
Activation of papillomavirus late gene transcription and genome amplification upon differentiation in semisolid medium is coincident with expression of involucrin and transglutaminase but not keratin-10.
J. Virol.
72:5016-5024[Abstract/Free Full Text].
|
| 46.
|
Ryan, A. K., and M. G. Rosenfeld.
1997.
POU domain family values: flexibility, partnerships, and developmental codes.
Genes Dev.
11:1207-1225[Free Full Text].
|
| 47.
|
Shi, Y.,
J. S. Lee, and K. M. Galvin.
1997.
Everything you have ever wanted to know about Yin Yang 1.
Biochim. Biophys. Acta
1332:F49-F66[Medline].
|
| 48.
|
Shi, Y.,
E. Seto,
L. S. Chang, and T. Shenk.
1991.
Transcriptional repression by YY1: a human GLI-Kruppel-related protein, and relief of repression by adenovirus E1A protein.
Cell
67:377-388[CrossRef][Medline].
|
| 49.
|
Stoler, M. H.,
S. M. Wolinsky,
A. Whitbeck,
T. R. Broker, and L. T. Chow.
1989.
Differentiation-linked human papillomavirus types 6 and 11 transcription in genital condylomata revealed by in situ hybridization with message-specific RNA probes.
Virology
172:331-340[CrossRef][Medline].
|
| 50.
|
Sturm, R. A.,
G. Das, and W. Herr.
1988.
The ubiquitous octamer-binding protein Oct-1 contains a POU domain with a homeobox subdomain.
Genes Dev.
2:1582-1599[Abstract/Free Full Text].
|
| 51.
|
Thomas, M. J., and E. Seto.
1999.
Unlocking the mechanisms of transcription factor YY1: are chromatin modifying enzymes the key?
Gene
236:197-208[CrossRef][Medline].
|
| 52.
|
Welter, J. F.,
H. Gali,
J. F. Crish, and R. L. Eckert.
1996.
Regulation of human involucrin promoter activity by POU domain proteins.
J. Biol. Chem.
271:14727-14733[Abstract/Free Full Text].
|
| 53.
|
Yang, W. M.,
C. Inouye,
Y. Zeng,
D. Bearss, and E. Seto.
1996.
Transcriptional repression by YY1 is mediated by interaction with a mammalian homolog of the yeast global regulator RPD3.
Proc. Natl. Acad. Sci. USA
93:12845-12850[Abstract/Free Full Text].
|
| 54.
|
Yant, S. R.,
W. Zhu,
D. Millinoff,
J. L. Slightom,
M. Goodman, and D. L. Gumucio.
1995.
High affinity YY1 binding motifs: identification of two core types (ACAT and CCAT) and distribution of potential binding sites within the human beta globin cluster.
Nucleic Acids Res.
23:4353-4362[Abstract/Free Full Text].
|
| 55.
|
Yukawa, K.,
K. Butz,
T. Yasui,
H. Kikutani, and F. Hoppe-Seyler.
1996.
Regulation of human papillomavirus transcription by the differentiation-dependent epithelial factor Epoc-1/skn-1a.
J. Virol.
70:10-16[Abstract].
|
| 56.
|
Yukawa, K.,
T. Yasui,
A. Yamamoto,
H. Shiku,
T. Kishimoto, and H. Kikutani.
1993.
Epoc-1: a POU-domain gene expressed in murine epidermal basal cells and thymic stromal cells.
Gene
133:163-169[CrossRef][Medline].
|
| 57.
|
zur Hausen, H.
1996.
Papillomavirus infections a major cause of human cancers.
Biochim. Biophys. Acta
1288:F55-F78[Medline].
|
| 58.
|
zur Hausen, H.
2000.
Papillomaviruses causing cancer: evasion from host-cell control in early events in carcinogenesis.
J. Natl. Cancer Inst.
92:690-698[Abstract/Free Full Text].
|
Journal of Virology, October 2001, p. 9302-9311, Vol. 75, No. 19
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.19.9302-9311.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Bodily, J. M., Meyers, C.
(2005). Genetic Analysis of the Human Papillomavirus Type 31 Differentiation-Dependent Late Promoter. J. Virol.
79: 3309-3321
[Abstract]
[Full Text]
-
Glahder, J. A., Hansen, C. N., Vinther, J., Madsen, B. S., Norrild, B.
(2003). A promoter within the E6 ORF of human papillomavirus type 16 contributes to the expression of the E7 oncoprotein from a monocistronic mRNA. J. Gen. Virol.
84: 3429-3441
[Abstract]
[Full Text]
-
Nakahara, T., Nishimura, A., Tanaka, M., Ueno, T., Ishimoto, A., Sakai, H.
(2002). Modulation of the Cell Division Cycle by Human Papillomavirus Type 18 E4. J. Virol.
76: 10914-10920
[Abstract]
[Full Text]