This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guo, M.
Right arrow Articles by Saif, L. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guo, M.
Right arrow Articles by Saif, L. J.

 Previous Article  |  Next Article 

Journal of Virology, October 2001, p. 9239-9251, Vol. 75, No. 19
0022-538X/01/$04.00+0   DOI: 10.1128/JVI.75.19.9239-9251.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.

Comparative Pathogenesis of Tissue Culture-Adapted and Wild-Type Cowden Porcine Enteric Calicivirus (PEC) in Gnotobiotic Pigs and Induction of Diarrhea by Intravenous Inoculation of Wild-Type PEC

M. Guo,1 J. Hayes,2 K. O. Cho,1 A. V. Parwani,1 L. M. Lucas,1 and L. J. Saif1,*

Food Animal Health Research Program, Department of Veterinary Preventive Medicine, Ohio Agricultural Research and Development Center, The Ohio State University, Wooster, Ohio 44691,1 and Animal Disease Diagnostic Laboratory, Ohio Department of Agriculture, Reynoldsburg, Ohio 430682

Received 30 January 2001/Accepted 22 June 2001


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Porcine enteric calicivirus (PEC/Cowden) causes diarrhea in pigs, grows in cell culture, and is morphologically and genetically similar to the Sapporo-like human caliciviruses. Genetic analysis revealed that the tissue culture-adapted (TC) Cowden PEC has one distant and three clustered amino acid substitutions in the capsid region and 2 amino acid changes in the RNA polymerase region compared to wild-type (WT) PEC (M. Guo, K.-O. Chang, M. E. Hardy, Q. Zhang, A. V. Parwani, and L. J. Saif, J. Virol. 73:9625-9631, 1999). In this study, the TC PEC, passaged in a porcine kidney cell line, and the WT PEC, passaged in gnotobiotic (Gn) pigs, were used to orally inoculate 13 4- to 6-day-old Gn pigs. No diarrhea developed in the TC-PEC-exposed pigs, whereas moderate diarrhea developed in the WT-PEC orally inoculated pigs, persisting for 2 to 5 days. Fecal virus shedding persisting for at least 7 days was detected by both reverse transcription (RT)-PCR and antigen-enzyme-linked immunosorbent assay (antigen-ELISA) in both TC-PEC and WT-PEC orally inoculated pigs but not in mock-inoculated pigs. The PEC particles were detected by immunoelectron microscopy (IEM) in intestinal contents from all the WT-PEC-inoculated pigs, but not from the TC-PEC-inoculated pigs. Mild (duodenum and jejunum) or no (ileum) villous atrophy was observed in histologic sections of the small intestines of TC-PEC-inoculated pigs, whereas WT PEC caused mild to severe (duodenum and jejunum) villous atrophy and fusion. Scanning electron microscopy confirmed mild shortening and blunting of villi in the duodenum and jejunum of the TC-PEC-inoculated pigs, in contrast to moderate to severe villous shortening and blunting in the duodenum and jejunum of WT-PEC-inoculated pigs. Higher numbers of PEC antigen-positive villous enterocytes were detected by immunofluorescent (IF) staining in the proximal small intestine of the WT-PEC-inoculated pigs, in contrast to low numbers of PEC antigen-positive enterocytes in only one of four TC-PEC-inoculated pigs. No PEC antigen-positive cells were observed in the colon or extraintestinal tissues of all inoculated pigs or in the small intestine of one mock-inoculated pig. Thus, the TC PEC was at least partially attenuated (no diarrhea, mild lesions) after serial passage in cell culture. In further experiments, three 4- to 6-day-old Gn pigs were intravenously (i.v.) inoculated with WT PEC, and all pigs developed diarrhea and villous atrophy in the small intestines resembling that observed in the orally inoculated pigs. Fecal viral shedding persisting for 8 days was detected by both RT-PCR and antigen-ELISA, and PEC was detected by IEM in feces or intestinal contents. The PEC RNA and antigens (at low titers) were detected in acute-phase sera from all the WT-PEC i.v.-inoculated pigs and also from seven of nine of the WT-PEC orally inoculated pigs. Oral or i.v. inoculation of four additional pigs with the PEC-positive acute-phase sera induced diarrhea, small intestinal lesions, PEC shedding in feces, and seroconversion to PEC, confirming the occurrence of viremia during PEC infection, with infectious PEC present in acute-phase sera. No diarrhea, histopathologic changes, or IF staining in the small intestine or fecal or serum detection of PEC was evident in two pigs i.v. mock-inoculated or a pig inoculated i.v. with inactivated WT PEC. To our knowledge, this is the first report of an attenuated enteric calicivirus, the induction of diarrhea, and intestinal lesions in Gn pigs caused by i.v. inoculation of WT PEC and the presence of viremia following PEC infection.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Caliciviruses are small, nonenveloped viruses 27 to 38 nm in diameter and possess a single-stranded, plus-sense RNA genome of 7.3 to 8.3 kb and a single capsid protein of 56 to 71 kDa. Caliciviruses are divided into four distinct genera: Vesivirus, Lagovirus, Norwalk-like viruses (NLVs), and Sapporo-like viruses (SLVs) (14). Human caliciviruses (HuCVs) have emerged as the leading cause of food- and waterborne, acute, nonbacterial gastroenteritis in humans worldwide (10, 23, 38). These uncultivable enteric caliciviruses belong to either the NLV or SLV genus. The NLVs are commonly identified as causative pathogens in outbreaks of gastroenteritis in humans of all ages (10, 21, 38, 41). The SLVs are mainly associated with sporadic, acute gastroenteritis in infants and young children (9, 20), but also cause viral gastroenteritis in the elderly or other age groups (26, 39).

Animal enteric caliciviruses also cause gastroenteritis in swine, calves, chickens, cats, dogs, and mink (4, 16, 32, 42). A number of these animal enteric caliciviruses are closely related genetically to HuCVs (7, 15, 16, 22), raising public health concerns for potential cross-species transmission and animal reservoirs for enteric caliciviruses related to HuCVs (36, 37).

The HuCVs remain refractory to cell culture propagation, and no susceptible animal models are available, which impedes the understanding of their replication strategies, pathogenesis, and host immunity. Although the genomes of a number of HuCVs have been sequenced, knowledge about viral replication and pathogenesis is still limited and derived mainly from volunteer studies (20). The HuCVs such as Norwalk virus (NV), Snow Mountain virus, and Hawaii virus (HV) caused diarrhea in volunteers, and histologic lesions were evident in jejunal biopsies (20). However, the extent of small intestinal involvement in HuCV infections is unknown, and the major site of viral replication is undetermined (9). The bovine enteric caliciviruses, Jena virus and Newbury agent, caused diarrhea and villous atrophy in the small intestine of gnotobiotic (Gn) calves (18, 22). A porcine enteric calicivirus (PEC) was first identified in the feces of a piglet with diarrhea in 1980 (32), which is morphologically and genetically similar to SLV HuCVs (15). The wild-type (WT) PEC Cowden strain induced diarrhea and villous atrophy in orally inoculated Gn pigs, with PEC-specific immunofluorescence detected in villous epithelial cells and villous atrophy observed in the proximal small intestine (12). The PEC/Cowden is the only enteric calicivirus that has been adapted to cell culture using a porcine kidney cell line (LLC-PK) with incorporation of intestinal content (IC) preparations from uninfected Gn pigs into the medium (11, 29). Genomic sequence analyses indicated that the TC PEC has one distant and three clustered amino acid substitutions in the hypervariable region 2 of the predicted capsid protein, and two amino acid changes in the RNA-dependent RNA polymerase region, compared with the WT PEC (15). Thus, it was of interest to examine if the virulence of the TC PEC in pigs was changed after serial passage in the LLC-PK cells. Future studies could then address if changes detected in the virulence of the TC PEC are associated with the predicted amino acid substitutions in the capsid region of the TC PEC.

In this report, the serially passaged TC PEC/Cowden was used to orally inoculate Gn pigs, and its pathogenesis was compared with that of WT PEC. We also examined the influence of the route of inoculation (oral versus intravenous [i.v.]) on the pathogenesis of the WT PEC, including analyzing the sites of intestinal and extraintestinal replication (lung, liver, kidney, and spleen) and lesions, determined by the immunofluorescence (IF) test and histopathology, respectively. We assessed the occurrence of diarrhea and fecal virus shedding by reverse transcription (RT)-PCR, enzyme-linked immunosorbent assay (ELISA), and immunoelectron microscopy (IEM). The presence of viremia following PEC infection was also examined by RT-PCR and ELISA in serum from the pigs inoculated orally or i.v. with WT PEC and confirmed by inoculation of additional pigs with acute-phase serum from the viremic pigs.

(This report represents a portion of a dissertation submitted by M. Guo to the Graduate School of The Ohio State University as partial fulfillment of the requirements for the Ph.D. degree.)


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Calicivirus inocula. The WT PEC/Cowden was originally obtained from the intestinal contents of a 27-day-old diarrheic suckling pig (32). The WT PEC/Cowden was passaged 15 times in Gn pigs, consistently causing diarrhea at each passage (12). The WT PEC/Cowden inoculum was obtained from the 15th Gn pig passage and was prepared by making a 20% suspension of the pooled intestinal contents in serum-free Eagle's minimal essential medium (EMEM). For i.v. inoculation, the WT PEC inoculum was centrifuged at 1,200 × g for 30 min and filtered through 0.45-µm-pore-size filters. As a control, WT PEC was also inactivated by using formalin. Briefly, formalin was added to the WT PEC filtrate at a final concentration of 0.4%, and the mixture was incubated at 37°C for 48 h with occasional shaking every 2 to 3 h.

The TC PEC/Cowden was passaged 19 times in primary porcine kidney cells (PPK) and then an additional 19 times in LLC-PK cells as described (11, 29). For preparation of the TC PEC inoculum, confluent monolayers of LLC-PK cells in 162-cm2 flasks were inoculated with suspensions from the 18th passage of TC PEC/Cowden in LLC-PK cells. After 1 h of inoculation, serum-free EMEM containing 10% IC preparations from uninfected Gn pigs was added (11). The infected cell cultures were harvested at postinoculation day (PID) 2 to 3, frozen and thawed three times, and then used as the oral inoculum for the Gn pigs. Titration of the TC PEC in the viral inoculum was determined by a cell culture IF (CCIF) assay (11). Briefly, the virus inoculum was serially diluted 10-fold (1:10 to 1:109) in serum-free EMEM, each dilution was inoculated into two wells of confluent LLC-PK monolayers in six-well plates, and IC was added to the wells as described previously (11, 29). The infected cell cultures were harvested at PID 2 to 3, and the cells in 1.0 ml of the culture suspensions were washed twice with 0.01 M phosphate-buffered saline (PBS), pH 7.2, and then resuspended in 1.0 ml of 0.01 M PBS, pH 7.2. The cell suspensions were added to eight-well glass slides (Bellco Glass, Inc., Vineland, N.J.) at 25 µl/well. The cells were fixed in acetone, rinsed in distilled water, and then stained with fluorescein isothiocyanate (FITC)-conjugated hyperimmune anti-PEC serum. The mock-infected cells were used as controls. The virus titer was defined as the reciprocal of the highest dilution of the TC PEC producing immunofluorescence in the inoculated cells. The PEC inocula were also titrated by an antigen-ELISA described below. The serum-free EMEM was used for mock inoculation of control Gn pigs via oral or i.v. routes.

The PEC-positive (by both RT-PCR and an antigen-ELISA) acute-phase serum samples (PID 4 to 8) from pigs (Gn pigs 8-8 and 8-9) and i.v.-inoculated pigs (pigs 8-1 and 8-2) were diluted 1:2 in 0.01 M PBS, pH 7.2, and filtered through 0.22-µm-pore-size filters. The filtrates were used to inoculate Gn pigs orally or i.v., as described below.

Animals, experimental design, and samples. Gn pigs were procured and maintained as previously described (24). A total of 24 3- to 6-day-old Gn pigs were used in this study and assigned to eight groups as indicated in Table 1. Groups I, II, and III were inoculated orally with TC PEC, WT PEC, or the serum-free EMEM (mock inoculation), respectively. For i.v. inoculation, the inocula were injected slowly via venipuncture into the anterior vena cava, jugular vein, or femoral vein. The Gn pigs in groups IV, V, and VI were inoculated i.v. with WT PEC, formalin-inactivated WT PEC, or serum-free EMEM, respectively. The Gn pigs in groups VII and VIII were inoculated orally or i.v. with PEC-positive acute-phase serum from WT-PEC-infected pigs inoculated orally or i.v. All inoculated pigs were observed daily for diarrhea, and their feces were scored as follows: 0, normal; 1, pasty; 2, semiliquid; 3, liquid. Diarrhea was indicated as fecal scores of >= 2. Rectal swab fluids were collected daily and processed by suspension into 8 ml of serum-free EMEM and stored at -20°C for detection of viral shedding. For i.v.-inoculated pigs, blood was drawn at PID 0, 2, 4, 6, and 8 or at euthanasia, and the serum was separated and stored at -20°C. The inoculated pigs were euthanatized at the onset of diarrhea, 1 to 5 days after the onset of diarrhea, or at PID 7 if they did not show diarrhea. Three orally or i.v.-inoculated control pigs were euthanatized at either PID 4 or 8. Euthanasia was performed by electrocution. For the Gn pigs in groups VII and VIII orally inoculated with PEC-positive acute-phase serum, blood was drawn at PID 0, 2, 4, 6, 8, 10, 14, and 21 or at euthanasia, and both serum and white blood cells (WBC) (see "RT-PCR" below) were collected in glass tubes. Convalescent-phase serum samples were examined for seroconversion to PEC by using a virus-like particle ELISA (VLP-ELISA) for detection of antibodies to PEC (18).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Experimental design for inoculation of Gn pigs with TC or WT Cowden PEC

At euthanasia, the intestinal tracts were removed from the abdominal cavities, and the blood and the small and large intestinal contents were collected. Fresh specimens of the duodenum, jejunum, ileum, colon, liver, spleen, lungs, and kidneys were collected and placed on ice for preparation of impression smears. Intestinal segments were excised and immediately immersed in the different fixatives for histologic examination (10% buffered zinc formalin) and scanning electron microscopy (see below). The small intestinal segments examined included the duodenum (approximately 15 cm caudal to the pyloric valve), jejunum (midregion of the small intestine) and ileum (approximately 15 cm cranial to the ileocecal junction). The upper portion of the colon and the liver, spleen, lung, and kidneys were also excised and immediately placed in 10% buffered zinc formalin.

Histologic examination. Formalin-fixed sections of the duodenum, jejunum, ileum, colon, lungs, spleen, liver, and kidneys were routinely processed, embedded in paraffin, sectioned at 5 µm, stained with Mayer's hematoxylin and eosin, and examined microscopically (12). The histologic evaluation was done in a blind fashion on coded samples, and a comparison was made with tissues from age-matched controls. Villous length and crypt depth were measured for histologic sections of the duodenum, jejunum, and ileum by using an ocular micrometer. The mean villous length and crypt depth were determined by measurement of 10 randomly selected villi and crypts on intestinal histologic sections, respectively, similar to methods described previously (12).

Detection of PEC in tissues by IF staining. To evaluate the distribution of PEC antigens in the tissues, impression smears prepared from fresh specimens of the duodenum, jejunum, ileum, colon, liver, spleen, lungs and kidneys collected at necropsy were stained directly by using hyperimmune antisera to PEC conjugated to FITC. The smears were prepared, stained, and examined by IF microscopy as described (3, 12).

Scanning electron microscopy. Segments of the duodenum, jejunum, ileum, and colon were fixed in a mixture containing 3% glutaraldehyde, 2% paraformaldehyde, and 1.5% acrolein in 0.1 M collidine buffer, pH 7.3, as described previously (12). The specimens were dehydrated in an ethanol-dry ice series and gently vacuum dried. The dried tissues were sputter coated with approximately 150 Å of platinum and observed using a scanning electron microscope (ISI-40; International Scientific Instruments Inc., Tokyo, Japan), and the tissues were photographed.

Detection of PEC in rectal swab fluids, intestinal contents, and serum samples. (i) IEM. IEM was performed as described (32). Small and large intestinal contents and fecal samples from inoculated pigs were diluted 1:5 in 0.01 M PBS, pH 7.2, and filtered (0.45-µm pore size) after centrifugation at 1,200 × g for 30 min. The filtrates were incubated with 1:500 diluted hyperimmune antiserum to PEC at 4°C overnight, followed by ultracentrifugation at 69,020 × g twice for 35 min each time. The final pellet was resuspended in 0.05 ml of distilled water; negatively stained with an equal volume of 2% phosphotungstic acid, pH 7.0; and examined using an electron microscope (model 201; Philips-Norelco, Eindhoven, The Netherlands).

(ii) RT-PCR. The PEC RNA was extracted and purified from rectal swab fluids, intestinal contents, serum and WBC (only for pigs in group VIII) of inoculated Gn pigs by using TRIZOL LS or TRIZOL reagent (only for WBC) according to the instructions provided by the supplier (Life Technologies, Grand Island, N.Y.). Rectal swab fluids and 20% suspensions of intestinal contents in 0.01 M PBS, pH 7.2, were centrifuged at 1,200 × g for 30 min, and the supernatants were used for RNA extraction. For groups VII and VIII, WBC were prepared by adding 40 volumes of sterile distilled water to blood samples from pigs to lyse red blood cells, followed by centrifugation at 800 × g for 10 min. The cell pellets were washed twice with distilled water and resuspended in 0.01 M PBS, pH 7.2, to one-fifth of the volume of the original blood sample. For PEC RNA extraction, rectal swab fluids, 20% suspensions of intestinal contents, serum samples, or WBC suspensions were mixed with 3 volumes of TRIZOL LS or TRIZOL reagent by vortexing and incubated at 15 to 30°C for 5 min. The mixture was mixed with four-fifths volume of chloroform by vigorous vortexing for 1 min followed by centrifugation at 14,000 × g for 15 min at 4°C. The viral RNA in the upper aqueous phase was precipitated with 1 µl of glycogen (20 µg/ml) and an equal volume of isopropanol. The RNA pellet was resuspended in 50 µl of diethyl pyrocarbonate-treated water and stored at -20°C until use.

For RT, total RNA was reverse transcribed with a PEC-specific reverse primer, PEC45 (5'-4883TCTGTGGTGCGGTTAGCCTT4864-3') or PEC65 (5'-4656ATACACACAATCATCCCCGTA4347-3'), by using SuperScript II reverse transcriptase (Gibco BRL, Gaithersburg, Md.) at 42°C for 1 h. The cDNA was then amplified by PCR using Taq DNA polymerase (Promega, Madison, Wis.) and the primer pair PEC45-PEC46 (5'-4312GTGCTCTATTGCCTGGACTA4331-3') or PEC65-PEC66 (5'-4327GACTACAGCAAGTGGGATTCC4347-3') both targeting the RNA polymerase region (15). The PCR was performed for 35 cycles of denaturation at 94°C for 30 s, annealing at 50°C for 30 s, and elongation at 72°C for 90 s followed by an extension at 72°C for 7 min. The PCRs were analyzed by electrophoresis on 1.2% agarose gels containing ethidium bromide. The expected products were 572 bp with the primer pair PEC45-PEC46 and 330 bp using the PEC65-PEC66 primer set for the PEC-positive samples. Fifteen virus-negative rectal swab fluids or intestinal contents collected from preexposure Gn pigs and mock-inoculated pigs were used as negative controls. The presence of PEC RNA in the formalin-inactivated WT-PEC inoculum was confirmed by RT-PCR.

(iii) Antigen-ELISA. An antigen-ELISA was performed as described elsewhere (19; M. Guo, G. J. Bowman, Q. Wang, and L. J. Saif, unpublished data). Hyperimmune guinea pig antiserum to PEC/Cowden was prepared by immunizing guinea pigs with PEC virus-like particles (VLPs) as described previously (17) and was used to coat Nunc-Immuno plates (MaxiSorp; Nalge Nunc International, Roskilde, Demark) at a dilution of 1:2,000 in 0.05 M carbonate buffer, pH 9.6. The plates were incubated at 4°C overnight, followed by blocking with 4% nonfat dry milk in 0.01 M PBS, pH 7.2. After washing the plates three times, PEC-positive, PEC-negative control fecal samples or IC, and PEC-negative serum samples from Gn pigs and test samples (rectal swab suspensions or 1:25 diluted intestinal contents supernatants or serum samples from i.v.-inoculated pigs) were added to the wells, followed by incubation at 37°C for 120 min. After washing three times, 1:2,000-diluted hyperimmune pig antisera to PEC/Cowden were added to the wells, and the plates were then incubated at 37°C for 90 min. Antigen binding was detected by adding 1:2,000-diluted horseradish peroxidase-labeled goat anti-pig immunoglobulin G-Fc conjugate (Bethyl Laboratories, Inc., Montgomery, Tex.) to the wells (100 µl/well) followed by incubation at 37°C for 90 min. After washing the plates three times, the substrate, 2,2'-azino-bis-3-ethylbenz-thiazoline sulfonic acid (ABTS) (Sigma, St. Louis, Mo.) was added to the wells for color development (at 37°C for 30 min). The samples were tested at a single sample dilution (1:25), and positive samples were defined as ones with an absorbance greater than or equal to the mean absorbance (A) of the antigen-negative control wells + 3 standard deviations (SD). The comparative absorbances of positive samples were designated as follows: +++, A492 >1; ++, A492 = 0.5 to 1.0; +, A492 < 0.5; -, A492 < A + 3 SD. For titration by the antigen-ELISA, both the TC-PEC and WT-PEC inocula were twofold serially diluted beginning at 1:40, and their PEC antigen titers were expressed as the reciprocal of the highest dilution with an absorbance of >= A + 3 SD.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Diarrhea and virus shedding in Gn pigs. (i) Oral inoculation with TC PEC or WT PEC. The TC-PEC inoculum had a virus titer of 106 fluorescent focus-forming units/ml by CCIF (11). Both the TC-PEC and WT-PEC inocula had a comparable PEC antigen titer of 1:2,560 by the antigen-ELISA. Marked differences were observed between the WT-PEC and TC-PEC orally inoculated Gn pigs in terms of diarrhea and fecal virus shedding (Table 2). Mild to moderate diarrhea developed in all WT-PEC orally inoculated pigs by PID 2 to 4 and persisted for 2 to 5 days (Table 2). Diarrhea was not observed in either the TC-PEC orally inoculated or the mock-inoculated pig. The WT-PEC orally inoculated pigs also had higher cumulative fecal scores compared with the TC-PEC orally inoculated and the mock-orally inoculated pigs (data not shown). The PEC RNA was detected by RT-PCR in rectal swab fluids from PID 1 to PID 7 or 9 (or until euthanasia) and in the intestinal contents of both WT-PEC and TC-PEC orally inoculated pigs at euthanasia, but not in the intestinal contents of the mock-inoculated pig. The PEC particles were detected by IEM in the small and large intestinal contents from WT-PEC orally inoculated pigs that were euthanatized between PID 3 and PID 9, but not from the TC-PEC orally inoculated pigs (Table 2). Virus particles were also detected by IEM from fecal samples (when available) collected from the WT-PEC-inoculated diarrheic pigs.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 2.   Summary of diarrhea and fecal virus shedding of Gn pigs after oral inoculation with TC PEC or WT PEC

The PEC antigens were detected by an antigen-ELISA in rectal swab fluids and intestinal contents from both the TC PEC- and WT-PEC orally inoculated pigs from PID 1 to PID 7 or 9 (Table 2). However, the ELISA absorbance values for the virus antigens in samples from the TC-PEC-inoculated pigs were consistently lower than those in the corresponding samples from the WT-PEC-inoculated pigs during PID 3 to 7 (Table 2), which were reflected as an absorbance value at 492 nm for a single dilution (1:25) of the samples. In WT-PEC-inoculated pigs, high ELISA absorbance values for viral antigens were detected in rectal swab fluids or intestinal contents from PID 2 to 9.

(ii) i.v. inoculation with WT PEC. Mild to moderate diarrhea was observed at PID 4 to 5 in all WT-PEC i.v.-inoculated Gn pigs (Table 3). The PEC RNA was detected in both rectal swab fluids and intestinal contents from WT-PEC i.v.-inoculated pigs from PID 1 to PID 8 (or until euthanasia), and PEC particles were detected in intestinal contents of all 3 pigs. The PEC antigens were detected by ELISA in rectal swab fluids from PID 3 to 8. High ELISA absorbance values for virus antigens were detected in rectal swab fluids or intestinal contents from PID 4 to 8. No diarrhea developed in the mock-i.v.-inoculated Gn pigs or the pig i.v.-inoculated with formalin-inactivated WT PEC. No PEC particles, antigens, or RNA was detected by IEM, ELISA, and RT-PCR, respectively, in the fecal swab fluids and intestinal contents from the mock- and formalin-inactivated WT-PEC i.v.-inoculated Gn pigs.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 3.   Summary of diarrhea, fecal virus shedding, and virus in serum of Gn pigs after i.v. inoculation with WT PEC

(iii) Oral or i.v. inoculation with WT-PEC-positive acute-phase sera. Moderate diarrhea developed in Gn pigs inoculated both orally and i.v. with PEC-positive acute-phase sera from WT-PEC orally or i.v.-inoculated pigs at PID 2 to 5 (Table 4). The diarrhea persisted for 5 to 8 days. The PEC RNA and antigens were detected in rectal swab fluids or intestinal contents of i.v.-inoculated Gn pigs from PID 2 to 8; PEC particles were detected by IEM in feces or intestinal contents of 2 i.v.-inoculated pigs euthanatized at PID 3 or 7 and in feces collected from PID 2 to PID 4 of 2 orally inoculated pigs. Of the 2 orally inoculated pigs, the PEC antigens were detected by using an antigen-ELISA in rectal swab fluids from PID 2 and up to PID 17, whereas PEC RNA was detected from PID 1 to 27 (data not shown). High ELISA absorbance values for PEC antigens were detected in rectal swab fluids, feces or intestinal contents from PID 2 to 8 (Table 4).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 4.   Summary of diarrhea, fecal virus shedding, and virus in serum of Gn pigs after inoculation with WT PEC-positive sera

Examination of serum samples from WT-PEC i.v.- or orally inoculated pigs for PEC RNA or antigens by using RT-PCR and ELISA, respectively. Serum samples collected from the WT-PEC i.v.-inoculated pigs (group IV) at PID 2, 4, 6, and 8 (or until euthanasia) were examined for PEC RNA by RT-PCR. The PEC RNA was detected in serum samples from all three of the WT-PEC i.v.-inoculated pigs from PID 2 to PID 8, but not from two mock-i.v.-inoculated pigs or one formalin-inactivated WT-PEC i.v.-inoculated pig (Table 3). The PEC antigens were detected by ELISA at low absorbance values in serum samples (1:25 dilution) from all three WT-PEC i.v.-inoculated pigs at PID 2 to 6, but not from the mock- or formalin-inactivated WT-PEC-inoculated pigs (Table 3). The PEC RNA or antigens were also detected in acute-phase serum samples from seven of nine WT-PEC orally inoculated pigs from PID 2 to 10 (data not shown). Furthermore, the PEC RNA or antigens were detected in sera from all four pigs in groups VII and VIII inoculated with acute-phase serum from pigs i.v. or orally inoculated with WT PEC (Table 4). The duration for PEC RNA or antigen detection was 5 to 6 days. The PEC RNA was also detected in WBC from both pigs in group VII at PID 6 to 14 and from one of two pigs in group VIII at PID 8 to 14 (partial data shown in Table 4).

Examination of PEC antigen distribution in tissues. (i) Oral inoculation of Gn pigs with TC PEC or WT PEC. By using IF staining, the PEC antigens were detected in impression smears from the small intestinal tissues from all the WT-PEC-inoculated pigs except for two recovered pigs euthanatized at PID 9 (Table 5). There were consistently higher numbers of PEC antigen-positive villous epithelial cells in the proximal small intestine (duodenum and jejunum, 0.05 to 15%) than in the distal small intestine (ileum, 0.01 to 0.5%). The PEC antigens were also detected by IF staining in small intestinal impression smears from only one of four TC-PEC-inoculated pigs, but the numbers of PEC-positive cells were much lower (0.01%) and limited to the jejunum only. Mucosal impression smears from the small intestine of a mock-inoculated pig were negative for PEC antigen by IF staining, and so were impression smears from the colon and extraintestinal tissues (lungs, liver, spleen and kidneys) of all orally inoculated pigs.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 5.   Summary of histopathologic findings and distribution of PEC antigens in the small intestine of Gn pigs after inoculation with TC PEC or WT PEC

(ii) i.v. inoculation of Gn pigs with WT PEC. The villous epithelial cells in the small intestine were positive for PEC antigens by IF staining of the small intestinal impression smears from the Gn pigs inoculated i.v. with WT PEC (Table 5). Viral antigens were not detected by IF in the small intestinal impression smears from two mock-i.v.-inoculated pigs or one pig inoculated i.v. with formalin-inactivated WT PEC. Impression smears prepared from the colon, liver, lungs, spleen and kidneys of all pigs were negative for PEC by IF staining.

(iii) Oral or i.v. inoculation of Gn pigs with PEC-positive acute-phase sera. The PEC antigens were detected in the small intestinal impression smears from the inoculated pigs euthanatized at PID 3 and 7 (Table 5), but not from the ones euthanatized at PID 21 or 28 (data not shown). However, serum antibodies to PEC/Cowden were detected by using VLP-ELISA in convalescent-phase serum samples collected at PID 21 (pig 14-4, 1:800; pig 15-9, 1:1600) and 28 (pig 14-4, 1:1,600). Impression smears prepared from the colon, liver, lungs, spleen, and kidneys of all pigs were negative for PEC by IF staining.

Histologic findings. (i) Oral inoculation of Gn pigs with TC PEC or WT PEC. Mild to severe villous atrophy, mild to moderate and multifocal villous fusion, and crypt hyperplasia were observed in the small intestine (mainly in the duodenum and jejunum) of all WT-PEC orally inoculated pigs that were euthanatized from PID 3 to PID 9 (Table 5; Fig. 1C). Villous atrophy in the duodenum was moderate to marked in five of six pigs examined on PID 3 and 4, and was mild in one pig each at PID 4 and PID 7, and two pigs at PID 9. In the jejunum, villous atrophy was absent at PID 3, was marked to severe in four of six pigs at PID 4 and 7, and was resolving by PID 9 (mild to moderate). Only mild villous atrophy was observed in the ileum of two of five pigs at PID 4 and in one pig at PID 7, and no villous atrophy in the ileum was observed in the other pigs. Enterocytes on the tips of the villi were occasionally cuboidal or flattened, lacked cytoplasmic droplets, and acquired a foamy, vacuolated cytoplasm. Epithelial cell vacuolization was seen primarily in the duodenum and jejunum, and seldom in the ileum. Crypt hyperplasia was demonstrated by elongation of crypt length, increased numbers of mitoses, and a disordered arrangement of crypt epithelial cells. Villous fusion was observed mainly in the duodenum and occasionally in the jejunum, but not in the ileum. Expansion of the villous lamina propria and dilatation of lacteal vessels in the submucosa were indicative of edema in some sections of the duodenum and jejunum.


View larger version (136K):
[in this window]
[in a new window]
 
FIG. 1.   Histologic lesions in the duodenum or jejunum of Gn pigs following oral or intravenous inoculation with PEC/Cowden. Hematoxylin and eosin stain. (A) Normal-appearing, long villi of the jejunum from a mock-inoculated Gn pig (pig 13-5). (B) Villi of the duodenum showing mild villous atrophy change from the TC-PEC orally inoculated pig (pig 4-6). (C) The severe blunting, shortening, and fusion of jejunal villi and crypt hyperplasia from the WT-PEC orally inoculated Gn pig (pig 8-9). (D) The severe, widespread villous atrophy and crypt hyperplasia and elongation in the jejunum from the WT-PEC i.v.-inoculated Gn pig (pig 8-1). Bar, 100 µm.

Only mild or no villous atrophy was observed in the small intestinal segments of the TC-PEC orally inoculated pigs (Table 5; Fig. 1B), which was reflected as mildly decreased villus/crypt ratios in the duodenum of one pig at PID 4 and in the duodenum and jejunum of another pig at PID 4 and PID 7 (Table 5). Mild to severe epithelial vacuolization was observed in the duodenum of all four pigs and in the jejunum at PID 4 and 7 but was not observed in the ileum at any time. No villous fusion was evident in any small intestine sections of this group. Small numbers of polymorphonuclear cells and mononuclear cells infiltrated into the lamina propria in some of the TC or WT-PEC-inoculated pigs. No lesions were observed in histologic sections of the small intestine of the mock-inoculated pigs and the colon, liver, lungs, spleen and kidneys of all inoculated Gn pigs.

(ii) i.v. inoculation of Gn pigs with WT PEC. Marked, widespread villous atrophy, crypt hyperplasia, and elongation were observed in the proximal small intestine (duodenum and jejunum) of WT-PEC i.v.-inoculated pigs (Table 5; Fig. 1D); this was similar to lesions observed in the WT-PEC orally inoculated pigs. Superficial epithelial cells were mildly attenuated (tall cuboidal), often retaining cytoplasmic vacuoles. There was mild and multifocal exfoliation and loss of enterocytes from the villous tips at PID 6. The crypt length increased significantly and the villus/crypt ratios were decreased dramatically. In contrast, no villous atrophy was observed in the ileum of the three pigs in this group. No lesions were observed in the small intestine of the mock- and formalin-inactivated WT-PEC i.v.-inoculated pigs, nor in the colon, liver, lungs, spleen and kidneys of all i.v.-inoculated Gn pigs.

iii) Oral or i.v. inoculation of Gn pigs with PEC-positive acute-phase sera. Moderate villous atrophy (duodenum) and severe villous atrophy and fusion (jejunum) were observed in the proximal small intestine of a Gn pig (pig 14-5) i.v. inoculated with PEC-positive acute-phase sera from WT-PEC i.v.-inoculated pigs and euthanatized at PID 7 (3 days after diarrhea onset) (Table 4). The pig (pig 15-10) inoculated i.v. but with PEC-positive acute-phase sera from WT-PEC orally inoculated pigs showed mild villous atrophy only in the duodenum when euthanatized at PID 3 (1 day after diarrhea onset). No villous atrophy was observed in the ileum of either pig. No villous atrophy was observed in the small intestines of the two Gn pigs orally inoculated with PEC-positive acute-phase sera and euthanatized at either PID 21 or 28. Both of these pigs seroconverted to PEC at PID 21 to 28.

Scanning electron microscopy. Small intestinal villi were long and finger-like, with circular transverse grooves on their surface, and the microvillous coat was uniform and densely packed in the mock-inoculated pigs (Fig. 2A, D, and G). In the WT-PEC-inoculated (orally or i.v.) pigs, denuding and shortening of the duodenal and jejunal villi was apparent, and the microvillous coat appeared irregular and patchy (Fig. 2C, F, and I). Some severely stunted villi appeared fused, cornical, or leaf-shaped. Enterocytes on the villous tips appeared swollen and degenerate and were exfoliated (Fig. 2F and I). Villous atrophy and fusion in the duodenum and jejunum were pronounced in contrast to minor changes in the ileum. In comparison, only mild or no villous shortening and irregularity along with occasional patchy microvillous coat were observed in the duodenum and jejunum of the TC-PEC-inoculated pigs (Fig. 2B, E, and H). No changes were observed in the ileum.


View larger version (135K):
[in this window]
[in a new window]
 
FIG. 2.   Scanning electron micrographs of duodenum segments from Gn pigs following oral inoculation with TC PEC/Cowden or WT PEC/Cowden. (A) Typical, long, finger-like villi showing circular transverse grooves on their surface from a mock-inoculated pig (pig 13-5). Magnification, ×130. (B) Finger-like villi with mildly irregular outer surface appearance from the TC-PEC-inoculated pig (pig 4-6). Magnification, ×120. (C) Shortened and fused villi with irregular appearance from the WT-PEC-inoculated pig (pig 4-4). Magnification, ×140. (D) Typical villous apex showing smooth surface from a mock-inoculated pig (pig 13-5). Magnification, ×490. (E) Villous apex with mildly irregular surface appearance from the TC-PEC-inoculated pig (pig 4-6). Magnification, ×510. (F) Shortened and fused villous apex, showing swollen enterocytes, exfoliation, and loss of enterocytes from the WT-PEC-inoculated pig (pig 4-4). Magnification, ×490. (G) Dense, uniform microvillous coat of the enterocytes from a mock-inoculated pig (pig 13-5). Magnification, ×3,870. (H) Smooth microvillous coat of enterocytes, showing mild irregularity, from the TC-PEC-inoculated pig (pig 4-6). Magnification, ×3,870. (I) Irregular microvillous coat of enterocytes from WT-PEC-inoculated pig (pig 4-4). Microvilli are fused, shortened, and more sparse. Magnification, ×3,870.


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The HuCVs are the leading cause of food- and waterborne viral gastroenteritis worldwide. In a recent report it was estimated that the HuCVs cause 23 million cases of food-borne illnesses annually, accounting for 67% of the cases caused by food-borne pathogens in the United States and 33% of annual hospitalizations due to food-borne illnesses (23), although most cases used for estimation lacked identifiable pathogens. Animal enteric caliciviruses are emerging pathogens that cause diarrhea in the respective animal host (4, 32; K. W. Theil and C. M. McCloskey, Abstr. 76th Annu. Meet. Conference of Research Workers in Animal Diseases, abstr. 110, 1995). These mostly uncultivable enteric caliciviruses are genetically related (7, 15, 22) and induce similar histologic lesions in the proximal small intestines of their respective hosts (12, 19, 20).

To date the PEC/Cowden is the only cultivable enteric calicivirus (11, 29), but for growth it requires an IC preparation from uninfected Gn pigs as a medium supplement. Previously the TC PEC was serially passaged 19 times in primary porcine kidney cells (11). In this study, the TC PEC was passaged another 19 times in a continuous porcine kidney cell line (LLC-PK) and then used to orally inoculate Gn pigs to examine its virulence. No diarrhea developed in the TC-PEC orally inoculated Gn pigs, and only mild or no villous atrophy was observed in the small intestine. In contrast, all WT-PEC orally inoculated Gn pigs developed diarrhea, and all of them euthanatized at PID 3 to 4 demonstrated moderate to severe villous atrophy and fusion in the proximal small intestine (duodenum, nine of nine; jejunum, six of nine from PID 3 to 9), which was similar to results previously reported (12). The histologic lesions in the WT-PEC-inoculated pigs correlated with the PEC antigen distribution, and coincided with the detection of fecal virus shedding and clinical signs. The ELISA absorbance values of fecal PEC antigen shed were consistently higher in the WT-PEC-inoculated pigs than in the TC-PEC-inoculated pigs, in spite of the consistent detection of fecal PEC RNA in pigs of both groups. These data indicate that the TC PEC apparently infected Gn pigs and induced limited proximal small intestinal lesions and fecal virus shedding (with much lower virus titers), but did not cause clinical illness, suggesting the less efficient replication and growth of the TC PEC in Gn pigs following infection. Thus, the virulence of the TC PEC is at least partially attenuated after serial passage in cell culture. No dose-response was done in this experiment, but the pigs were given the highest available dose of the TC PEC, which had a comparable antigen titer (1:2,560) to that of the WT PEC inoculum. Previous studies indicated that the TC PEC has two amino acid changes in the polymerase region and one distant and three clustered amino acid substitutions in the capsid region (15). This hypervariable capsid region with three clustered amino acid changes forms the externally located P2 subdomain on the virus surface and corresponds to the binding region of the Norwalk virus (NV) capsid (rNV virus-like particles) to human and animal cells in vitro (30, 40). It is likely that this P2 subdomain determines host specificity (30, 40). The limited propagation of TC PEC in the small intestine of inoculated Gn pigs and its reduced virulence may be the result of a potential change in tissue tropism or binding that may be related to the amino acid substitutions in the hypervariable capsid region. Thus, the amino acid changes in the capsid hypervariable region may be associated with both the cell culture adaptation and the attenuation of the virulence of the TC PEC in Gn pigs. The TC PEC may be a useful candidate vaccine for future evaluation for prevention of PEC infections of swine.

In early volunteer studies, the HuCVs (NV, Snow Mountain virus, and HV) caused diarrhea or vomiting and induced histologic lesions evident in jejunal biopsies, which included broadening and blunting of the intestinal villi, crypt cell hyperplasia, cytoplasmic vacuolization, and infiltration of polymorphonuclear and mononuclear cells into the lamina propria (9, 20). In a previous study, it was reported that WT PEC/Cowden induced diarrhea and villous atrophy in orally inoculated neonatal Gn pigs (12). The present study confirmed these findings for Gn pigs inoculated orally with WT PEC. The proximal small intestinal villous atrophy and fusion, crypt cell hyperplasia and reduction of villus/crypt ratios, cytoplasmic vacuolization, and infiltration of polymorphonuclear and mononuclear cells into the lamina propria coincided with the appearance of clinical illness in the infected human volunteers and in the Gn pigs (1, 2, 8, 33, 34).

The diarrhea, fecal virus shedding, and intestinal lesions in Gn pigs in our study resembled those observed in human volunteer studies for the HuCVs (NV, HV, and Montgomery County agent) (1, 9,13, 20, 34) and in Gn calves inoculated orally with bovine enteric calicivirus Newbury agents (5, 19). The HuCVs and enteric caliciviruses in animals reportedly infect the proximal small intestine (1, 12, 19, 20, 33). However, in infected volunteers only jejunal biopsies were examined and the extent of involvement of the small intestine in disease progression, lesions and virus replication remains unclear. Our present and previous (12) data indicated that WT PEC infected villous enterocytes and induced histologic lesions mainly in the duodenum and jejunum, confirming that they are the major sites for PEC replication in the small intestine. Colon and extraintestinal tissues or organs may not support PEC replication, because no PEC-positive cells were detected by IF staining in impression smears of these tissues, nor were lesions evident, even from the pigs shown to have viremia following PEC infection. It is possible that the restricted growth of PEC to the small intestine relates to its requirement for specific receptors and factors present in intestinal contents as demonstrated for its in vitro cultivation (11, 29), and such factors or receptors may not be present at extraintestinal sites.

In NV-infected volunteers, the peak of virus shedding in stool as detected by a sensitive antigen-ELISA was between 25 and 72 h after oral inoculation, and its duration was at least 7 days (13). In WT-PEC orally inoculated pigs, fecal virus shedding was detected by both the RT-PCR and an antigen-ELISA from PID 1 to PID 9, with a peak from PID 2 to 7. Interestingly, in two Gn pigs that were orally inoculated with PEC-positive acute-phase sera and euthanatized at PID 21 or 28, the PEC RNA and antigens were detected in rectal swab fluids up to 27 days by RT-PCR and 17 days by ELISA, respectively. A recent study indicated that stool virus shedding was detected by RT-PCR and southern hybridization up to 28 days in patients naturally infected with a GII NLV during a long-term- care hospital outbreak (P. R. Hazelton, K. M. Combs, T. B. Ball, L. Klass, and P. Plourde, Abstr. 19th Annu. Meet. Am. Soc. Virol., abstr. W14-4, 2000). The long duration of fecal virus shedding may facilitate virus transmission, causing secondary infections or outbreaks. Thus, proper planning for intervention strategies and handling of outbreaks associated with HuCVs may help to control virus transmission and disease spread.

Enteropathogenic viruses like HuCVs and animal enteric caliciviruses are usually transmitted through the fecal-oral route. Some nonenteric caliciviruses, such as the vesiviruses, feline calicivirus, vesicular exanthema of swine virus, and San Miguel sea lion virus, are transmitted through direct contact, infected fomites, or respiratory routes (feline calicivirus) (6, 35). However, inoculation of pigs with vesicular exanthema of swine virus via intradermal, subcutaneous, intramuscular or i.v. routes, also produced vesicular disease in swine (35). The rabbit hemorrhagic disease virus (RHDV) causes a fatal systemic hemorrhage in rabbits that can be infected via many inoculation routes (27). Viremia appears within 24 h after inoculation and likely plays an important role in virus spread to the target organs or tissues including the liver. In this study, Gn pigs were inoculated i.v. with WT PEC. Interestingly, all WT-PEC i.v.-inoculated pigs developed diarrhea, characteristic histologic lesions and PEC antigens detectable in the proximal small intestine (mainly duodenum and jejunum), which were similar to those observed in WT-PEC orally inoculated pigs, although more severe villous atrophy was consistently seen in the jejunum. Other major differences were that the incubation period for clinical diarrhea was 1 to 2 days longer than that in the orally inoculated pigs and correspondingly the PEC antigens were first detected by ELISA in feces at PID 3 instead of PID 1 in most of the orally inoculated pigs, although fecal virus RNA was detected by RT-PCR in both groups at PID 1. The delay in clinical illness coincided with the initial presence of PEC antigen shedding detected in feces. The peak of fecal virus shedding detected by antigen-ELISA was from PID 4 to PID 7, and high numbers of PEC-infected enterocytes were evident by IF in the small intestine, suggesting that WT PEC replicated efficiently in the infected enterocytes. Subsequently, marked villous atrophy and fusion were observed in the proximal small intestine as a result of the damage, exfoliation and loss of enterocytes. This is further supported by the presence of high virus numbers (by IEM) in the intestinal contents from the WT-PEC i.v.-inoculated Gn pigs. In contrast, no diarrhea and small intestinal histologic lesions were evident in mock- or formalin-inactivated WT-PEC i.v.-inoculated pigs. Thus, WT PEC administered i.v. reached the small intestine presumably via the bloodstream, where it localized, propagated efficiently and induced small intestinal lesions characteristic of those observed in the WT-PEC orally inoculated pigs. To our knowledge, this is the first report of an enteric calicivirus causing symptomatic illness, fecal virus shedding and histologic lesions in the susceptible host following i.v. inoculation. How the WT PEC reaches the small intestine from the bloodstream and infects the villous enterocytes is unknown. In type 1 reovirus infection of mice, reoviruses in the bloodstream during viremia or after i.v. inoculation are transported to the ileum, where they infect crypt cells possibly via attachment to the basolateral membrane but not via the luminal surface (28). Other enteropathogenic animal viruses, such as adenovirus, parvovirus, and bovine virus diarrhea virus may infect crypt enterocytes via hematogenous dissemination after viremia in a similar manner (31). The PEC may be unique in this regard since i.v. inoculation leads to infection of mainly villous and not crypt enterocytes as detected by IF staining of small intestinal impression smears.

Previously it was unknown if enteric caliciviruses induced viremia. In this study, the PEC RNA and low titers of virus antigen were detected in serum samples from the WT-PEC i.v.-inoculated pigs and from seven of nine pigs inoculated with WT PEC orally. It is unlikely that the PEC RNA or antigen in serum was from the initial inoculum because the PEC RNA or antigens were also detected in sera from WT-PEC orally inoculated pigs and not from a control pig inoculated with killed WT PEC. In addition, the longer incubation periods for the onset of diarrhea and fecal viral antigen shedding coincided with a delay in transport of PEC from the bloodstream to the small intestine. Many viruses induce viremia during which the viruses circulate in the blood serum or WBCs and are spread to the target organs to initiate infection (25). To determine if the PEC-positive acute-phase sera contained infectious virus, the serum samples from the WT-PEC i.v.- and orally inoculated pigs were used to inoculate additional Gn pigs via the i.v. or oral routes. Diarrhea and fecal virus shedding developed in all inoculated pigs, with a pattern similar to that of intestinally derived WT-PEC i.v.- or orally inoculated pigs. In addition, seroconversion to PEC was detected at PID 21 in 2 orally inoculated pigs. Characteristic small intestinal lesions (described earlier) and PEC-positive enterocytes were observed in both of the i.v.-inoculated pigs examined, and the PEC RNA or antigens were detected in serum samples from all four inoculated pigs (Table 4). Additionally PEC RNA was also detected in the washed WBC from three of these pigs, but only later after PID 6 to 8. Because phagocytic cells in the blood phagocytize viruses in the process of viral destruction, we did not conduct pig infectivity experiments with the WBC to determine if they contained infectious PEC. However, it is interesting that after PEC and HuCV infections, polymorphonuclear and mononuclear cells infiltrate the small intestine; whether subsets of these are derived from WBC that might contain infectious PEC should be examined in the future studies. Collectively, these results suggest that viremia occurs following PEC infection and that the PEC-positive sera contain infectious virus. Considering the low virus titers by ELISA in PEC-positive acute-phase sera which induced illness in inoculated Gn pigs, the WT PEC/Cowden must be highly infectious for pigs. This is an important common property for PEC and the NV and related HuCVs associated with food- and waterborne viral gastroenteritis (9, 20).

In conclusion, the TC PEC induced a limited small intestinal infection and low levels of fecal virus shedding, but no diarrhea, in the Gn pigs. Infection with TC PEC caused only mild or no lesions in the small intestine. Thus, the TC PEC is at least partially attenuated after serial passage in cell culture in vitro, and it may be a potential candidate vaccine for further evaluation. The WT PEC induced diarrhea and characteristic histologic lesions (villous atrophy and fusion) in the proximal small intestine of Gn pigs following oral or intravenous inoculation. The WT PEC detected in serum of pigs i.v. or orally inoculated with WT PEC was infectious when inoculated into additional pigs. To our knowledge, this is the first report of an attenuated cell culture-adapted enteric calicivirus and of a WT enteric calicivirus that causes symptomatic illness and intestinal lesions via intravenous inoculation as well as the occurrence of viremia following PEC infection.


    ACKNOWLEDGMENTS

We thank Arden Agnes, Peggy Lewis, Paul Nielsen, Janet McCormick, Qiuhong Wang, and Juliette Hanson for technical assistance and acknowledge the technical support of the OARDC Molecular and Cellular Imaging Center.

This work was supported by grant NRI, CGP, #1999 02009 from the U.S. Department of Agriculture, NRI, and grant R01 AI 49716 from the National Institute of Allergy and Infectious Diseases, National Institutes of Health. Salaries and partial research support were provided by state and federal funds appropriated to the Ohio Agricultural Research and Development Center, The Ohio State University.


    FOOTNOTES

* Corresponding author. Mailing address: Food Animal Health Research Program, Department of Veterinary Preventive Medicine, Ohio Agricultural Research and Development Center (OARDC), The Ohio State University, 1680 Madison Ave., Wooster, OH 44691. Phone: (330) 263-3744. Fax: (330) 263-3677. E-mail: saif.2{at}osu.edu.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Agus, S. G., R. Dolin, R. G. Wyatt, A. J. Tousimis, and R. S. Northrup. 1973. Acute infectious nonbacterial gastroenteritis: intestinal histopathology. Ann. Intern. Med. 79:18-25.
2. Blacklow, N. R., R. Dolin, D. S. Fedson, H. Dupont, R. S. Northrup, R. B. Hornick, and R. M. Chanock. 1972. Acute infectious nonbacterial gastroenteritis: etiology and pathogenesis. Ann. Intern. Med. 76:993-1008.
3. Bohl, E. H., L. J. Saif, K. W. Theil, A. A. Agnes, and R. F. Cross. 1982. Porcine pararotavirus: detection, differentiation from rotavirus, and pathogenesis in gnotobiotic pigs. J. Clin. Microbiol. 15:312-319[Abstract/Free Full Text].
4. Bridger, J. C. 1990. Small viruses associated with gastroenteritis in animals, p. 161-182. In L. J. Saif, and K. W. Theil (ed.), Viral diarrheas of man and animals. CRC Press, Boca Raton, Fla.
5. Bridger, J. C., G. A. Hall, and J. F. Brown. 1984. Characterization of a calici-like virus (Newbury agent) found in association with astrovirus in bovine diarrhea. Infect. Immun. 43:133-138[Abstract/Free Full Text].
6. Carter, M. J., I. D. Milton, and C. R. Madeley. 1991. Caliciviruses. Rev. Med. Virol. 1:177-186.
7. Dastjerdi, A. M., J. Green, C. I. Gallimore, D. W. G. Brown, and J. C. Bridger. 1999. The bovine Newbury agent-2 is genetically more closely related to human SRSVs than to animal caliciviruses. Virology 254:1-5[CrossRef][Medline].
8. Dolin, R., A. G. Levy, R. G. Wyatt, T. S. Thornhill, and J. D. Gardner. 1975. Viral gastroenteritis induced by the Hawaii agent. Jejunal histopathology and serologic response. Am. J. Med. 59:761-768[CrossRef][Medline].
9. Estes, M. K., R. L. Atmar, and M. E. Hardy. 1997. Norwalk and related diarrhea viruses, p. 1073-1095. In D. D. Richman, R. J. Whitley, and F. G. Hayden (ed.), Clinical virology, 3rd ed. Churchill Livingstone, New York, N.Y.
10. Fankhauser, R. L., J. S. Noel, T. Ando, S. S. Monroe, and R. I. Glass. 1998. Molecular epidemiology of "Norwalk-like viruses" in outbreaks of gastroenteritis in the United States. J. Infect. Dis. 178:1571-1578[CrossRef][Medline].
11. Flynn, W. T., and L. J. Saif. 1988. Serial propagation of porcine enteric calicivirus-like virus in porcine kidney cells. J. Clin. Microbiol. 26:206-212[Abstract/Free Full Text].
12. Flynn, W. T., L. J. Saif, and P. G. Moorhead. 1988. Pathogenesis of porcine enteric calicivirus in four-day-old gnotobiotic piglets. Am. J. Vet. Res. 49:819-825[Medline].
13. Graham, D. Y., X. Jiang, T. Tanaka, A. R. Opekun, H. P. Madore, and M. K. Estes. 1994. Norwalk virus infection of volunteers: new insights based on improved assays. J. Infect. Dis. 170:34-43[Medline].
14. Green, K. Y., T. Ando, M. S. Balayan, T. Berke, I. N. Clarke, M. K. Estes, D. O. Matson, S. Nakata, J. D. Neill, M. J. Studdert, and H.-J. Thiel. 2000. Taxonomy of the caliciviruses. J. Infect. Dis. 181(Suppl. 2):S322-S330.
15. Guo, M., K.-O. Chang, M. E. Hardy, Q. Zhang, A. V. Parwani, and L. J. Saif. 1999. Molecular characterization of a porcine enteric calicivirus genetically related to Sapporo-like human caliciviruses. J. Virol. 73:9625-9631[Abstract/Free Full Text].
16. Guo, M., J. F. Evermann, and L. J. Saif. 2001. Detection and molecular characterization of cultivable caliciviruses from clinically normal mink and enteric caliciviruses associated with diarrhea in mink. Arch. Virol. 146:479-493[CrossRef][Medline].
17. Guo, M., Y. Qian, K.-O. Chang, and L. J. Saif. 2000. Expression and self-assembly in baculovirus of porcine enteric calicivirus capsids into virus-like particles and their use in ELISA for antibody detection in swine. J. Clin. Microbiol. 39:1487-1493[Abstract/Free Full Text].
18. Hall, G. A., J. C. Bridger, B. E. Brooker, K. R. Parsons, and E. Ormerod. 1984. Lesions of gnotobiotic calves experimentally infected with a calicivirus-like (Newbury) agent. Vet. Pathol. 21:208-215[Abstract].
19. Jiang, X., W. D. Cubbit, J. Hu, X. Dai, J. Treanor, D. O. Matson, and L. K. Pickering. 1995. Development of an ELISA to detect MX virus, a human calicivirus in the Snow mountain agent genogroup. J. Gen. Virol. 76:2739-2747[Abstract/Free Full Text].
20. Kapikian, A. Z., M. K. Estes, and R. M. Chanock. 1996. Norwalk group of viruses, p. 783-810. In B. N. Fields, D. M. Knipe, P. M. Howley, et al. (ed.), Fields virology, 3rd ed. Lippincott-Raven, Philadephia, Pa.
21. Lewis, D. C., A. Hale, X. Jiang, R. Eglin, and D. W. Brown. 1997. Epidemiology of Mexico virus, a small round-structured virus in Yorkshire, United Kingdom, between January 1992 and March 1995. J. Infect. Dis. 175:951-954[Medline].
22. Liu, B. L., P. R. Lambden, H. Günther, P. Otto, M. Elschner, and I. N. Clarke. 1999. Molecular characterization of a bovine enteric calicivirus: relationship to the Norwalk-like viruses. J. Virol. 73:819-825[Abstract/Free Full Text].
23. Mead, P. S., Slutsker, V. Dietz, L. F. McCaig, J. S. Bresee, C. Shapiro, P. M. Griffin, and R. V. Tauxe. 1999. Food-related illness and death in the United States. Emerg. Infect. Dis. 5:607-625[Medline].
24. Meyer, R. C., E. H. Bohl, and E. M. Kohler. 1964. Procurement and maintenance of germ-free swine for microbiological investigations. Appl. Microbiol. 12:295-300[Medline].
25. Mims, C. A., and D. O. White. 1984. Viral pathogenesis and immunology. Blackwell, Oxford, United Kingdom.
26. Noel, J. S., B. L. Liu, C. D. Humphrey, E. M. Rodriguez, P. R. Lambden, I. N. Clarke, D. M. Dwyer, T. Ando, R. I. Glass, and S. S. Monroe. 1997. Parkville virus: a novel genetic variant of human calicivirus in the Sapporo virus clade, associated with an outbreak of gastroenteritis in adults. J. Med. Virol. 52:173-178[CrossRef][Medline].
27. Ohlinger, V. F., B. Haas, and H. J. Thiel. 1993. Rabbit hemorrhagic disease (RHD): characterization of the causative calicivirus. Vet. Res. 24:103-116[Medline].
28. Organ, E. L., and D. H. Rubin. 1998. Pathogenesis of reovirus gastrointestinal and hepatobiliary disease. Curr. Top. Microbiol. Immunol. 233(II):67-83[Medline].
29. Parwani, A. V., W. T. Flynn, K. L. Gadfield, and L. J. Saif. 1991. Serial propagation of porcine enteric calicivirus: effects of medium supplementation with intestinal contents or enzymes. Arch. Virol. 120:115-122[CrossRef][Medline].
30. Prasad, B. V. V., M. E. Hardy, and M. K. Estes. 2000. Structural studies of recombinant Norwalk capsids. J. Infect. Dis. 181(Suppl. 2):S317-S321.
31. Saif, L. J. 1990. Comparative aspects of enteric viral infections, p. 10-31. In L. J. Saif, and K. W. Theil (ed.), Viral diarrheas of man and animals. CRC Press, Boca Raton, Fla.
32. Saif, L. J., E. H. Bohl, K. W. Theil, R. F. Cross, and J. A. House. 1980. Rotavirus-like, calicivirus-like and 23 nm virus-like particles associated with diarrhea in young pigs. J. Clin. Microbiol. 12:105-111[Abstract/Free Full Text].
33. Schreiber, D. S., N. R. Blacklow, and J. S. Trier. 1973. The mucosal lesion of the proximal small intestine in acute infectious nonbacterial gastroenteritis. N. Engl. J. Med. 288:1318-1323.
34. Schreiber, D. S., N. R. Blacklow, and J. S. Trier. 1974. The small intestinal lesion induced by Hawaii agent acute infectious nonbacterial gastroenteritis. J. Infect. Dis. 124:705-708.
35. Smith, A. W., and S. H. Madin. 1986. Vesicular exanthema of swine, p. 358-368. In A. D. Leman, B. Straw, R. D. Glock, W. L. Mengeling, R. H. C. Penny, and E. Scholl (ed.), Disease of swine, 6th ed. Iowa State Press, Ames.
36. Sugieda, M. H., Y. Nagaoka, Y. Kakishima, T. Ohshita, S. Nakamura, and S. Nakajima. 1998. Detection of Norwalk-like virus genes in the caecum contents of pigs. Arch. Virol. 143:1215-1221[CrossRef][Medline].
37. van der Poel, W. H. M., J. Vinje, R. van der Heide, M.-I. Herrera, A. Vivo, and M. P. G. Koopmans. 2000. Norwalk-like caliciviruses genes in farm animals. Emerg. Infect. Dis. 6:36-41[Medline].
38. Vinje, J., S. A. Altena, and M. P. G. Koopmans. 1997. The incidence and genetic variability of small round-structured viruses in outbreaks of gastroenteritis in the Netherlands. J. Infect. Dis. 176:1374-1378[Medline].
39. Vinje, J., H. Deijl, R. van der Heide, D. Lewis, K.-O. Hedlund, L. Svensson, and M. P. G. Koopmans. 2000. Molecular detection and epidemiology of Sapporo-like viruses. J. Clin. Microbiol. 38:530-536[Abstract/Free Full Text].
40. White, L. J., J. M. Ball, M. E. Hardy, T. N. Tanaka, N. Kitamoto, and M. K. Estes. 1996. Attachment and entry of recombinant Norwalk virus capsids to cultured human and animal cell lines. J. Virol. 70:6589-6597[Abstract/Free Full Text].
41. Wright, P. J., I. C. Gunesekere, J. C. Doultree, and J. A. Marshall. 1998. Small round-structured (Norwalk-like) viruses and classical human caliciviruses in southeastern Australia, 1980-1996. J. Med. Virol. 55:312-320[CrossRef][Medline].
42. Wyeth, P. J., N. J. Chettle, and J. Labram. 1981. Avian calicivirus. Vet. Rec. 109:477[Medline].


Journal of Virology, October 2001, p. 9239-9251, Vol. 75, No. 19
0022-538X/01/$04.00+0   DOI: 10.1128/JVI.75.19.9239-9251.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Zhang, W., Shen, Q., Hua, X., Cui, L., Liu, J., Yang, S. (2008). The First Chinese Porcine Sapovirus Strain That Contributed to an Outbreak of Gastroenteritis in Piglets. J. Virol. 82: 8239-8240 [Full Text]  
  • Bailey, D., Thackray, L. B., Goodfellow, I. G. (2008). A Single Amino Acid Substitution in the Murine Norovirus Capsid Protein Is Sufficient for Attenuation In Vivo. J. Virol. 82: 7725-7728 [Abstract] [Full Text]  
  • Martella, V., Lorusso, E., Banyai, K., Decaro, N., Corrente, M., Elia, G., Cavalli, A., Radogna, A., Costantini, V., Saif, L. J., Lavazza, A., Di Trani, L., Buonavoglia, C. (2008). Identification of a Porcine Calicivirus Related Genetically to Human Sapoviruses. J. Clin. Microbiol. 46: 1907-1913 [Abstract] [Full Text]  
  • Costantini, V. P., Azevedo, A. C., Li, X., Williams, M. C., Michel, F. C. Jr., Saif, L. J. (2007). Effects of Different Animal Waste Treatment Technologies on Detection and Viability of Porcine Enteric Viruses. Appl. Environ. Microbiol. 73: 5284-5291 [Abstract] [Full Text]  
  • Oka, T., Yamamoto, M., Katayama, K., Hansman, G. S., Ogawa, S., Miyamura, T., Takeda, N. (2006). Identification of the cleavage sites of sapovirus open reading frame 1 polyprotein.. J. Gen. Virol. 87: 3329-3338 [Abstract] [Full Text]  
  • Cheetham, S., Souza, M., Meulia, T., Grimes, S., Han, M. G., Saif, L. J. (2006). Pathogenesis of a Genogroup II Human Norovirus in Gnotobiotic Pigs.. J. Virol. 80: 10372-10381 [Abstract] [Full Text]  
  • Wang, Q.-H., Souza, M., Funk, J. A., Zhang, W., Saif, L. J. (2006). Prevalence of Noroviruses and Sapoviruses in Swine of Various Ages Determined by Reverse Transcription-PCR and Microwell Hybridization Assays.. J. Clin. Microbiol. 44: 2057-2062 [Abstract] [Full Text]  
  • Wobus, C. E., Thackray, L. B., Virgin, H. W. IV (2006). Murine norovirus: a model system to study norovirus biology and pathogenesis.. J. Virol. 80: 5104-5112 [Full Text]  
  • Costantini, V., Loisy, F., Joens, L., Le Guyader, F. S., Saif, L. J. (2006). Human and animal enteric caliciviruses in oysters from different coastal regions of the United States.. Appl. Environ. Microbiol. 72: 1800-1809 [Abstract] [Full Text]  
  • Wang, Q.-H., Han, M. G., Funk, J. A., Bowman, G., Janies, D. A., Saif, L. J. (2005). Genetic Diversity and Recombination of Porcine Sapoviruses. J. Clin. Microbiol. 43: 5963-5972 [Abstract] [Full Text]  
  • Azevedo, M. S., Yuan, L., Jeong, K.-I., Gonzalez, A., Nguyen, T. V., Pouly, S., Gochnauer, M., Zhang, W., Azevedo, A., Saif, L. J. (2005). Viremia and Nasal and Rectal Shedding of Rotavirus in Gnotobiotic Pigs Inoculated with Wa Human Rotavirus. J. Virol. 79: 5428-5436 [Abstract] [Full Text]  
  • Chang, K.-O., Sosnovtsev, S. S., Belliot, G., Wang, Q., Saif, L. J., Green, K. Y. (2005). Reverse Genetics System for Porcine Enteric Calicivirus, a Prototype Sapovirus in the Caliciviridae. J. Virol. 79: 1409-1416 [Abstract] [Full Text]  
  • Chen, R., Neill, J. D., Noel, J. S., Hutson, A. M., Glass, R. I., Estes, M. K., Prasad, B. V. V. (2004). Inter- and Intragenus Structural Variations in Caliciviruses and Their Functional Implications. J. Virol. 78: 6469-6479 [Abstract] [Full Text]  
  • Chang, K.-O., Sosnovtsev, S. V., Belliot, G., Kim, Y., Saif, L. J., Green, K. Y. (2004). Bile acids are essential for porcine enteric calicivirus replication in association with down-regulation of signal transducer and activator of transcription 1. Proc. Natl. Acad. Sci. USA 101: 8733-8738 [Abstract] [Full Text]  
  • Hutson, A. M., Atmar, R. L., Marcus, D. M., Estes, M. K. (2002). Norwalk Virus-Like Particle Hemagglutination by Binding to H Histo-Blood Group Antigens. J. Virol. 77: 405-415 [Abstract] [Full Text]  
  • Smiley, J. R., Chang, K. O., Hayes, J., Vinje, J., Saif, L. J. (2002). Characterization of an Enteropathogenic Bovine Calicivirus Representing a Potentially New Calicivirus Genus. J. Virol. 76: 10089-10098 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guo, M.
Right arrow Articles by Saif, L. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guo, M.
Right arrow Articles by Saif, L. J.