Previous Article | Next Article 
Journal of Virology, October 2001, p. 8917-8926, Vol. 75, No. 19
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.19.8917-8926.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
HERV-K(OLD): Ancestor Sequences of the Human Endogenous
Retrovirus Family HERV-K(HML-2)
Katrin
Reus,1
Jens
Mayer,1,2
Marlies
Sauter,3
Hans
Zischler,4
Nikolaus
Müller-Lantzsch,3 and
Eckart
Meese1,*
Institut für Humangenetik1 and
Institut für Medizinische Mikrobiologie und Hygiene,
Abteilung Virologie,3
Universitätskliniken des Saarlandes, Homburg/Saar, and
Primate Genetics, German Primate Center,
Göttingen,4 Germany, and
Department of Genetics, University of Pennsylvania School of
Medicine, Philadelphia, Pennsylvania2
Received 26 February 2001/Accepted 19 June 2001
 |
ABSTRACT |
Sequences homologous to the human endogenous retrovirus (HERV)
family HERV-K(HML-2) are present in all Old World primate species. A
previous study showed that a central region of the HERV-K(HML-2) gag genes in Hominoidea species displays
a 96-bp deletion compared to the gag genes in lower Old
World primates. The more ancient HERV-K(HML-2) sequences present in
lower Old World primates were apparently not conserved during hominoid
evolution, as opposed to the deletion variants. To further clarify the
evolutionary origin of the HERV-K(HML-2) family, we screened GenBank
with the 96-bp gag-sequence characteristic of lower Old
World primates and identified, to date, 10 human sequence entries
harboring either full-length or partially deleted proviral structures,
probably representing remnants of a more ancient HERV-K(HML-2) variant. The high degree of mutations demonstrates the long-time presence of
these HERV-K(OLD) proviruses in the genome. Nevertheless, they still
belong to the HML-2 family as deduced from dot matrix and phylogenetic
analyses. We estimate, based on the family ages of integrated
Alu elements and on long terminal repeat (LTR)
divergence data, that the average age of HERV-K(OLD) proviruses is ca.
28 million years, supporting an integration time before the
evolutionary split of Hominoidea from lower Old World
primates. Analysis of HERV-K(OLD) LTR sequences led to the distinction
of two subgroups, both of which cluster with LTRs belonging to an
evolutionarily older cluster. Taken together, our data give further
insight into the evolutionary history of the HERV-K(HML-2) family
during primate evolution.
 |
INTRODUCTION |
Integrations of different exogenous
retroviral sequences into the germ line occurred frequently during
evolution and gave rise to several families of endogenous retroviruses
in the genomes of some invertebrate and all vertebrate families. After
provirus insertion, retrotranspositional events in a retrovirus-like
fashion may have increased the copy numbers of particular families. The recent analysis of the draft sequence shows that ca. 8% of the human
genome is composed of retrovirus-like elements (8).
Several distinct human endogenous retrovirus (HERV) families with copy numbers from 1 to 1,000 can be defined (36). Mutations and
deletions rendered many of these HERVs unable to produce functional
proteins, and thus they are replication defective, although many
remained transcriptionally active. Unlike most other HERVs, the
HERV-K(HML-2) proviruses seem to be an exception, since they have
been shown to contain open reading frames (ORFs) for gag,
protease (prt), polymerase (pol), and envelope
(env); encode enzymatically functional retroviral proteins;
and even produce retrovirus-like particles (17).
The HERV-K superfamily has been classified by alignments of short
sequences from a conserved region within the retroviral reverse
transcriptase (21), and recent work has suggested the existence of up to 10 of these HML (human endogenous MMTV-like) subgroups (2). The HERV-K family seems to have integrated
into the germ line about 30 million years (Myr) ago, prior to the
evolutionary split of hominoids and lower Old World monkeys. However,
there is also evidence for an ongoing amplification of HERV-K(HML-2) sequences specifically in the hominoid and human lineage, and even
human-specific elements have been identified (20, 23). HERV-K(HML-2) proviral sequences exist in two different types, distinguished by a 292-bp deletion at the boundary of the
pol and env genes. Such mutated proviruses are
regarded as deficient, since they do not encode a correct Env protein
due to the lack of a signal peptide, for instance (27).
Since HERV-K genomes harboring this deletion can be detected only in
hominoid species, the mutational event appears to have occurred in a
hominoid predecessor species after the evolutionary split from lower
Old World monkeys. Both types of HERV-K genomes amplified in the
hominoid lineage and seem to have contributed equally to the family's
copy number in humans (18, 19).
In our previous study on the evolution of HERV-K homologous sequences
in Old World primates, we observed a second mutational event that
emerged at the same time in evolution, leading to a shortened
gag gene (19). This deletion of 96 bp shortens
gag but maintains the ORF and can be found exclusively in
hominoid species, whereas the longer gag is present in lower
Old World primates. Interestingly, only the deleted gag
sequences seem to have contributed to the amplification and expansion
of HERV-K(HML-2) homologues within the hominoid lineage, and the more
ancient gag variant was apparently not conserved during
evolution. Therefore, one hypothesis was that the shortened Gag protein
may have acquired an alternate function, perhaps becoming beneficial
for the host. The expression of the variant provirus would have
resulted, as an indirect consequence, in retrotransposition, and
therefore amplification of proviruses with gag ORFs. At the
time of our previous report, only one short Homo sapiens
GenBank entry (accession no. Z58084) showed similarities to the ancient
96-bp gag-sequence, which we interpreted as an evolutionary
remnant of the older HERV-K(HML-2) genome (19).
Utilizing the dramatically increasing data from the Human Genome
Mapping Project (HGMP), we set out to further clarify the evolution of
HERV-K(HML-2) sequences. Our analyses led to the identification and
characterization of 10 previously unknown ancient HERV-K(HML-2)
homologues, with characteristic features of long-time integration that
are conserved in the human genome until today.
 |
MATERIALS AND METHODS |
BLAST searches and sequence analysis.
The GenBank human
nonredundant (nr) and high-throughput genomic sequence (htgs) databases
were screened by BLAST search (1) with a 96-bp
gag-sequence from Cercopithecus aethiops
(accession no. AF018153) characteristic of an ancient HERV-K
gag (19). To characterize proviral portions in
the entries, comparison of the identified sequences with an intact
HERV-K element, HERV-K(HML-2.HOM) (20, 28), was done by
dot matrix analysis with MacVector software (Genetics Computer Group).
Parameters for the dot matrices were a window size of 30 nucleotides
(nt) and a minimum similarity of 70%. Proviral fragments identified in
the unfinished htgs entries were only subjected to further analyses
when they were located in a single contig of the htgs entry. Pairwise
sequence comparisons between the newly identified HERV-K(OLD) with one
another and also to HERV-K(HML-2.HOM) were performed using BLAST 2 sequences at the National Center for Biotechnology Information
(32) and Sequencher (Gene Codes Corporation), which also
served in the analysis of potential ORFs. Repetitive elements were
identified using the RepeatMasker Web Server (A. F. A. Smit
and P. Green, unpublished data
[http://ftp.genome.washington.edu/cgi-bin/RepeatMasker]), which was
also helpful in the exact localization of HERV-K(OLD) proviral fragments.
Evolutionary ages of proviruses.
The approximate integration
times of HERV-K(OLD) proviruses were estimated by two different
approaches. First, the age of the Alu subfamily members
(9, 24) inserted into some of the proviruses gave an
estimate of the minimum age of the respective proviral element. Second,
the evolutionary age of those proviruses with both flanking full-length
long terminal repeats (LTRs) was estimated by the sequence comparison
of the 5' and 3' LTRs. Both LTRs are supposed to be identical in
sequence at the time of integration and start to acquire mutations
afterward. Indels were excluded in the calculation of the percent
divergence between the two LTRs, and the divergence values were then
corrected for revertant and superimposed changes (10). The
approximate integration time T was obtained by the method
given in Lebedev et al. (12), with the formula
T = D/(2 × 0.13), where D
is the corrected divergence value and 0.13 is the average mutation rate
per Myr for the evolution of LTRs. The factor 2 accounts for the fact
that both LTRs acquire mutations independently, so that the sum of
mutations in both LTRs contributes to the percentage of divergence.
Sequence alignments and phylogenetic analyses.
Multiple
sequence alignments of HERV proviral portions were done using the
CLUSTALW algorithm (33) at the Institut Pasteur (http://bioweb.pasteur.fr/seqanal/interfaces/clustalw.html). The LTR and pol sequences of the proviruses reported here were
compared to HERV sequences previously described by others (11,
21, 23). Neighbor-joining, maximum likelihood, and maximum
parsimony trees were constructed using PHYLIP (Phylogeny Inference
Package, version 3.5c; J. Felsenstein, Department of Genetics,
University of Washington, Seattle). Gaps in alignments were excluded
from analyses. To obtain support values, bootstrap analysis was
performed with 1,000 replicates. The bootstrap values represent the
percentage of trees for which the sequences at one end of the branch
form a monophyletic group. To establish a HERV-K(OLD) dUTPase consensus sequence from a multiple sequence alignment, the server of the European
Molecular Biology Laboratory
(http://www.bork.embl-heidelberg.de:8080/Alignment/consensus.html) was used.
PCR primers and conditions.
HERV-K(OLD-AL035587) was
amplified from total genomic DNA from various primate species using the
primers LTRF (5'CTGGCCTATGTGCACATCCAGG3') and OLD3'FlankR
(5'CCAGTCTGGAGGAAACTGACC3'). PCR cycling conditions were as
follows: an initial cycle of 5 min at 94°C; followed by 30 cycles of
30 s at 94°C, 30 s at 57°C, and 1 min at 72°C; and a
final cycle of 10 min at 72°C. Reaction mixtures contained 0.5 µM
concentrations of each primer, 200 µM deoxynucleoside triphosphates, and 2.5 U of Taq polymerase in standard PCR buffer (Life Technologies).
 |
RESULTS |
Identification of human sequences homologous to the 96-bp
gag-sequence.
The 96-bp sequence
characteristic for the HERV-K(HML-2) gag genes of lower
Old World primates (19) was utilized to perform BLAST searches on the nr and htgs divisions of GenBank, the latter one
covering unfinished sequences of the HGMP. As of July 2000, we
identified 26 human sequence entries in the nr database and nine
entries in the htgs database producing significant E-values. Several of
these entries showed a more or less full-length similarity to the query
sequence, but some were only similar to the central part of the 96-bp
gag sequence (Table 1).
The presence of additional proviral portions within the
identified sequence entries was examined by dot matrix comparisons
with
known HERV-K proviruses. We identified novel proviral sequences
in 10 of the database entries, and the new HERV elements were
named according
to the accession number of the corresponding sequence
entry (Fig.
1). The locations and orientations of
proviral portions
within the respective sequence entries are given in
Table
2.
For all 10 of the identified
HERVs, the sequences immediately
downstream of the 5' LTR have been
compared to known tRNA sequences
from a database (
30). All
of the identified primer binding sites
showed strong homology to the
last 18 nt of tRNA
Lys (with a mean divergence of
3.7 nt) and less similarity to other
tRNA sequences, supporting the
classification as HERV-K (data
not shown). The dot matrices grouped all
new HERV-K proviruses
into the HERV-K(HML-2) family, displaying
significant similarity
to the most intact member of this family
HERV-K(HML-2.HOM) (
20,
28) (Fig.
1). In contrast,
comparisons to members of the HERV-K(HML-4)
(
29) or
HERV-K(HML-6) (
22) family produced clearly fewer and
shorter similar regions (data not shown). As deduced from these
dot
matrix analyses, pairwise sequence comparisons and the
chromosomal
location as annotated in the GenBank file, the following
accession
numbers represent identical genomic regions and proviral
loci,
respectively:
AL358753 and
AL023753,
AC010632 and
AC012309,
AP000346 and
AP000345, and
AC006078 and
AC004127.

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 1.
Dot matrix comparisons between the most intact member of
the HERV-K(HML2) family (20, 28) and the identified
HERV-K(OLD) proviruses. Lines represent regions with at least 70%
similarity in a window of 30 nt between the two proviral sequences.
HERV-K(OLD) sequences are shown on the x axis, and the
numbers give the position in the GenBank entry. The location of
features like deletions and insertions are indicated in the matrices.
|
|
Structure of HERV-K(OLD) proviral loci.
The structure of the
HERV-K(HML-2)-like sequences reported here ranges from almost complete
proviruses to the remains of proviruses, with large deletions or
rearrangements, and the retroviral ORFs are frequently interrupted by
stop codons. Furthermore, Alu elements from various
Alu subfamilies are frequently inserted into the proviral
sequences. However, all proviruses display the typical ancient
gag gene, having the uniform 96-bp sequence. Since all of
these features strongly suggest a long-time presence in the human
genome, we named this proviral group HERV-K(OLD).
Here we present the 10 proviral loci showing reasonably intact
structures in more detail, arranged in the same order as in
the BLAST
results in Table
1. HERV-K(OLD-AC004979) shows a deletion
of the 5'
portion of
pol as well as the complete
env gene
and
the 3' LTR, respectively. The remaining
gag,
prt, and
pol portions
are inverted compared to
the 5' LTR. HERV-K(OLD-AC012309) appears
to be the most intact
provirus, with a length of 9,519 bp (Fig.
1). A 5' LTR of 957 bp and a
3' LTR of 968 bp are present, and
the sequence has the highest overall
homology to HERV-K(HML-2.HOM).
The provirus is integrated into an
AluSx element. The central
region of the
pol gene
in HERV-K(OLD-AL121932
) contains
a solitary LTR (974 bp)
with strong similarities to the HERV-K(OLD)
LTRs. A target site
duplication AGATCCC for this integration can
also be found. This LTR
probably results from the integration
of an HERV-K element, and a
subsequent homologous recombination
led to the loss of the proviral
sequence, with only a solitary
LTR remaining. Approximately 100 bp of
the 5' end of the proviral
5' LTR appear to be deleted. There is no
information on the 3'
end of
env and the 3' LTR, since the
provirus is located at the
end of the GenBank sequence entry. The
HERV-K(OLD-AC004034) locus
displays the highest degree of mutations,
consisting only of a
LTR (986 bp) and a
gag gene. The
remaining
gag portions, showing
larger deletions and
rearrangements, are located in reverse orientation
compared to the 5'
LTR. The HERV-K(OLD-AL035587) provirus has
LTRs of 997 and 996 bp,
respectively. It appears to be a complete
provirus except that an
AluY element is inserted within the
gag-
prt boundary. HERV-K(OLD-AL023753) is only
5,818 bp long, displaying
deletions of the 3' end of the
pol
gene, the complete
env gene
and the 3' LTR, respectively.
Approximately 2.5 kb downstream
of the provirus, the gene for a protein
termed "melanoma preferentially
expressed antigen" (PRAME) has been
annotated in antisense orientation
in the sequence entry. Recently,
Tristem (
34) described another
proviral element in the
entry
AL023753, belonging to the highly
defective HERV.HS49C23 family,
which is not identical but rather
located next to the HERV-K(OLD)
provirus described here. Besides
some smaller deletions, the
HERV-K(OLD-AP000345) provirus has
an almost intact proviral structure,
with a partially deleted
3' LTR and an insertion of an
AluY
element in the 3' part of the
env gene. The proviral
sequence HERV-K(OLD-AL136419) has a deletion
of 300 bp in the 5' LTR,
compared to the 3' LTR of 1,024 bp. A
short deletion in the
gag gene explains why there is no full-length
similarity to
the 96-bp sequence in the initial BLAST search (see
Table
1). The 5'
half of the
pol gene and most of the
env gene
are
deleted, and a 480-bp CT-rich low complexity region can be
identified
here instead. HERV-K(OLD-AL031668) is integrated into
an L1 element and
itself shows insertions of four additional repetitive
elements,
including three
AluY and one SVA element. Two
AluY elements
in tandem orientation are inserted into the 5'
LTR, which is 995
bp without
Alu elements, compared to the
3' LTR of 984 bp. Another
AluY element is located in the
gag gene. The SVA element, which
is a composite retroposon
consisting of
Alu fragments and an HERV-K
LTR, is integrated
into the
pol-
env boundary. A deletion furthermore
removed the region ranging from the 3' half of
gag to the 5'
region
of
pol. A provirus found in the htgs section of
GenBank, HERV-K(OLD-AC004127),
also shows common insertions of other
repetitive elements. An
AluYb8 element is inserted into the
5' LTR, which is 970 bp without
the
Alu element, compared to
the 3' LTR of 960 bp. An
AluSg element
is integrated,
similar to the
AL031668 provirus, into the
pol-
env boundary. The sequence inserted into the
env gene (target site
duplication CCAGGATG) shows a 94%
similarity to the mRNA for a
KIAA1470 protein (accession no.
AB040903).
This presumably
processed pseudogene sequence is in the opposite
orientation to
the provirus and itself contains other repetitive
elements, such
as AluY, SVA-LTR, and simple repeats. Two other htgs
entries,
AC024690 and
AC022412, also contain relatively intact HERV-K
sequences, as deduced from dot matrices, but are due to the unfinished
status of the sequence assembly not considered
here.
Most genes in the HERV-K(OLD) proviruses have accumulated multiple stop
codons, but sometimes longer ORFs could be detected,
e.g., a
623-amino-acid (aa) ORF for
gag in HERV-K(OLD-AP000345).
However, a full-length ORF for the more ancient
gag genes is
estimated
ca. 730-aa. The
prt ORF in HERV-K(OLD-AL136419) is
intact, extending
into
pol and encoding 321 aa.
Nevertheless, a potential for protein
expression from these ORFs is
questionable.
Evolutionary age of HERV-K(OLD) proviruses.
The age of several
Alu subfamily members, inserted into some of the HERV-K(OLD)
loci, can be used to estimate the minimal age of the retroviral
elements (Table 2). Since Alu families have relatively high
ranges of evolutionary ages (9, 24), these data give only
an approximate estimate of integration times. For HERV-K(OLD-AC004127),
the minimum time of its presence in the genome can also be calculated
from the sequence divergence of the KIAA1470 pseudogene compared to the
mRNA (26). Based on a mutation rate of 1.5 × 10
9 substitutions/site/year for nonfunctional
sequences (15) and the 6% divergence to the KIAA1470 mRNA
sequence, the pseudogene, was formed roughly 20 Myr ago, when the
provirus was already present.
At the time of the proviral integration, both LTRs of a retrovirus are
identical in sequence but then acquire mutations independently
over
time, thus providing an evolutionary clock for the age of
the provirus
(
5). For those HERV-K(OLD) proviral elements with
apparently complete 5' and 3' LTRs, the corrected LTR sequence
divergence was used to calculate approximate integration times
(Table
2). Taken together, our data hint at HERV-K(OLD) proviral
integrations
around the evolutionary split of lower Old World
primates and the
hominoid lineage, which occurred ca. 28 Myr ago
(
4,
31).
HERV-K(OLD) LTR sequences.
A sequence alignment of HERV-K(OLD)
and the human-specific "modern" HERV-K(HML-2.HOM) LTR sequences led
to the distinction of two HERV-K(OLD) subgroups. The LTRs of one
subgroup proved to be longer in sequence, whereas the other
consistently displayed deletions of 8 and 23 bp, and were therefore
similar to HERV-K(HML-2.HOM) (Fig. 2).
Additionally, LTRs of both subgroups showed a deletion of 2 bp compared
to the HERV-K(HML-2.HOM) LTR. Interestingly, the solitary LTR inserted
into the pol gene of HERV-K(OLD-AL121932) is an intermediate
between the two subgroups, since it shows only the first deletion of 8 bp.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 2.
Multiple sequence alignment of HERV-K(OLD) LTR
sequences. Only the LTR regions harboring the diagnostic differences
between the two subgroups are shown. Positions 612 to 668 of the
human-specific HERV-K(HML-2.HOM) LTRs (20, 28) are shown
for comparison. 5' and 3' indicates the respective LTRs in a given
provirus. "solAL121932" indicates the solitary LTR present in
HERV-K(OLD-AL121932).
|
|
HERV-K(HML-2) LTR sequences have been previously reported to be grouped
into evolutionary older and younger clusters (
11,
12). We
performed a neighbor-joining analysis of the HERV-K(OLD)
LTR sequences
and included some representatives of these older
and younger HERV-K
LTRs. As can be seen in Fig.
3 the
HERV-K(OLD)
LTRs cluster with LTRs of the evolutionary older group
(LTRI)
and are separated from the younger LTRII sequences with a 100%
bootstrap support. Furthermore, HERV-K(OLD) LTRs without the described
deletions of 8 and 23 bp cluster separately from those containing
these
deletions, which appear phylogenetically more related to
the younger
LTRII group. The solitary LTR in HERV-K(OLD-AL121932)
has an
intermediate position in the tree.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 3.
Unrooted neighbor-joining tree of HERV-K LTR sequences.
HERV-K(OLD) LTRs were compared to previously reported LTR sequences
from evolutionary older (LTRI) and younger (LTRII) clusters derived
from chromosome 19 (11). HERV-K(OLD) LTRs without the
diagnostic deletions of 8 and 23 bp are boxed, and LTRII sequences are
circled. All HERV-K(OLD) LTRs cluster with the older LTRI sequences
(not included in the circle), independent from the presence or absence
of the 8- and 23-bp deletions (see text for further details). The
phylogenetic distances were calculated using the Kimura two-parameter
model with a transition/transversion ratio of 2. Support values (1,000 bootstrap replicates) are indicated on the corresponding branches. The
scale bar represents a 10% evolutionary distance.
|
|
Phylogenetic relationship of HERV-K(OLD) polymerase sequences.
Previously, the HERV-K sequences in the human genome have been divided
into at least six subfamilies, HML-1 through HML-6, based on sequence
comparison of conserved reverse transcriptase regions (2,
21). To examine the phylogenetic relationship between
HERV-K(OLD) and other HERV-K families, we compared the HERV-K(OLD)
pol regions present in eight proviruses with these previously described HML pol sequences. Additionally, the
pol sequences of the proviruses HERV-K(HML-2.HOM) (20,
28) and HERV-K-T47D (29) have also been included.
The phylogenetic analyses resulted in similar tree topologies for the
neighbor-joining, maximum likelihood, or maximum parsimony methods.
Remarkably, two HERV-K(OLD) pol sequences proved to be
identical to the described HML2-4 and HML2-5 pol sequences
(Fig. 4). The neighbor-joining tree in
Fig. 4 shows that all HERV-K(OLD) pol sequences cluster with
a bootstrap support of 100% with HERV-K(HML-2) sequences. However, the
various HML-2 and HERV-K(OLD) sequences did not cluster as a single
group but formed two subgroups with bootstrap supports of 72% for both
clades. Interestingly, the one cluster contains all HERV-K(OLD)
sequences for which longer LTRs have been determined, while the other
one contains the proviruses having the shorter LTR variant, thus
confirming the distinction of the two subgroups.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 4.
Neighbor-joining tree of HERV-K(OLD) polymerase
sequences and previously published HML polymerase sequences
(21). The tree is rooted with a HML-6 sequence being the
most distant of the six HML groups (21), but the HML6-3
and HML3-6 relation could not be resolved in this analysis. The
distances were calculated using the Kimura two-parameter model with a
transition/transversion ratio of 2. Support values (1,000 bootstrap
replicates) are indicated on the corresponding branches. The scale bar
represents a 10% evolutionary distance.
|
|
Analysis of the HERV-K(OLD) dUTPase region.
HERV-K elements
encode in the prt reading frame a rudimentary dUTPase.
dUTPase catalyzes the hydrolysis of dUTP to dUMP and PPi in some retroviruses (7), and it
has been shown that dUTPase might represent an example of
horizontal gene transfer between eukaryotic and archaeal hosts and
viral pathogens (3). However, the dUTPase protein sequence
of the human-specific HERV-K(HML-2.HOM) (20) shows
substitutions at highly conserved residues in four of five motifs
typically well conserved in dUTPase enzymes and therefore likely
contributes to an nonfunctional enzyme. The HERV-K(OLD) prt
sequences are relatively intact, in that they contain only a few stop
and frameshift mutations; a prt ORF can even be found in HERV-K(OLD-AL136419). Therefore, we compared an HERV-K(OLD) prt consensus sequence, derived from an alignment of eight
HERV-K(OLD) sequences, to the corresponding dUTPase motifs of reported
active enzymes (Fig. 5). The HERV-K(OLD)
prt consensus sequence displayed an ORF, and the translated
amino acid sequence resulted in motifs resembling those of a reported
enzymatically active HERV-K(HML-2) dUTPase construct (7).
Most notably the residues Gly (motif 3) and Phe (motif 5), which are
important for substrate recognition (25), and the residue
Gly (motif 4) seem to be wild type-like. Thus, HERV-K(OLD) proviruses
may have encoded an active dUTPase.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 5.
Amino acid alignment of conserved dUTPase motifs.
Residues in HERV-K proviral sequences differing from highly conserved
residues are indicated in boldface. "HERV-K Cons" corresponds to an
enzymatically active HERV-K(HML-2) dUTPase construct (7).
"HERV-K(OLD) Cons" is the dUTPase consensus sequence derived from
eight proviral sequences. Ambiguous amino acids are indicated below the
sequence. The amino acid sequence of HERV-K(OLD-AL136419), displaying a
prt ORF, is included for comparison.
|
|
 |
DISCUSSION |
Previously, we reported that HERV-K(HML-2) homologous sequences in
lower Old World primates exhibit a 96-bp-longer gag gene compared to human sequences. The shorter gag gene obviously
arose after the evolutionary split of hominoids from lower Old World primates and is amplified in copy number. The more ancient
HERV-K(HML-2) gag sequences could not be clearly identified
in the human sequence data available at that time (19).
With the increased sequence data generated by the HGMP, we were now
able to identify the remnants of such ancient HERV-K(HML-2) homologous
proviruses. The 10 detected retroviral elements show multiple signs of
long-time presence in the genome. The ORFs are usually interrupted by
multiple stop codons, deletions and inversions result in the loss or
rearrangement of large proviral portions, and some proviruses also
contain Alu elements from various families. We therefore
named these retroviral sequences HERV-K(OLD).
Using the age of inserted Alu subfamily members and the
calculated divergence values between 5' and 3' LTRs of HERV-K(OLD) proviruses, it was possible to roughly estimate the age of some retroviral elements. For instance, the LTR divergence in
HERV-K(OLD-AC012309) indicates a presence in the genome for ca. 30 Myr.
LTR divergence and the presence of an AluSg element in
HERV-K(OLD-AC004127) date this provirus from ca. 25 and 31 Myr ago,
respectively. It must be taken into account that the calculation of
integration times from LTR divergences assumes rate constancy, and thus
a molecular clock in the primate lineage but a slowdown in the mutation
rate in the hominoid lineage is conceivable (14). Attempts
were made to experimentally address the age of single HERV-K(OLD)
proviruses, but PCR studies proved to be technically difficult, due to
multiple mutations in proviral and flanking regions, preventing
effective primer design. Nevertheless, in one case it was possible to
trace the AL035587 provirus back to lower Old World Monkeys (Fig. 6), although the presence of an
AluY element dates this provirus to only 19 Myr ago. This
supports the notion that the calculated integration times given above
yield only minimum ages, and thus the examined endogenous retroviruses
may be considerably older. Another hint at the evolution of these
proviruses is the presence of a 292-bp sequence at the
pol-env boundary in six of the identified proviruses. (The remaining four proviruses lack this sequence due to
larger deletions within the pol or env genes; see
Fig. 1.) HERV-K proviral elements retaining this 292-bp sequence are thought to be the more ancient variants (16, 27). We
therefore suggest that the HERV-K(OLD) elements are remnants from a
time ca. 28 Myr ago when the genomes of lower Old World primates and hominoids were not yet evolutionarily separated (4, 31).

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 6.
Presence of HERV-K(OLD-AL035587) in hominoids and lower
Old World monkeys. PCR primers were specific for 3'-flanking sequences
and the HERV-K(OLD) LTR. NWM (New World monkeys): Age, Ateles
geoffroyi; Ase, Alouatta seniculus. OWM (Old
World monkeys): Msp, Mandrillus sphinx; Mfa,
Macaca fascicularis; Tge, Thercopithecus
gelada; Pha, Papio hamadryas. Hominoids: Hla,
Hylobates lar; Ptr, Pan troglodytes; Hsa,
Homo sapiens. M, marker (size of marker bands is given
in base pairs); N, PCR control without DNA.
|
|
Our study reveals further differences in these ancient HERV-K(HML-2)
homologous sequences within the LTR R-region. While one subgroup of
HERV-K(OLD) displays LTRs similar to modern HERV-K(HML-2), the other
subgroup harbors longer LTRs, with insertions of 8 and 23 bp,
respectively, within the LTR R-region. Interestingly, the solitary LTR
in HERV-K(OLD-AL121932) is an intermediate between both LTR variants,
lacking the 8-bp sequence and containing the 23-bp sequence. A
similarly structured solitary LTR can also be found in the HERV-S71
provirus (13, 35). It seems possible that such partially
deleted LTRs are the evolutionary intermediates between the obviously
more ancient longer LTR variants and the shorter LTR variants. However,
the biological consequence of these sequence variations remains to be elucidated.
Two recent reports investigated the phylogenetic relationships of
HERV-K(HML-2) LTR sequences (11, 23), and it was now possible to link these sequences to HERV-K(OLD) proviruses. First, Lavrentieva et al. (11) defined LTR groups I and II; the
LTRI group was considered evolutionarily older. Our phylogenetic
analysis indicates that all HERV-K(OLD) LTRs cluster with the older
LTRI sequences, independent from the presence or absence of the 8- and
23-bp deletions (Fig. 3). Consistently, some of the subgroups defined
for LTRI (I-E, D, S, P, and K) do not display the 8- and 23-bp
deletions; the LTRI-Y group shows only the first deletion of 8 bp; and
all other LTRI and -II groups have both deletions. In concordance with
our data, LTRI-Y has been estimated to be 41 Myr, and the LTRI groups
without the deletions have been estimated to be between 53 and 25 Myr
(12). Second, Medstrand and Mager defined nine
evolutionary clusters of HERV-K(HML-2) LTRs (23). Here, only the oldest cluster contains the longer HERV-K(OLD)-like LTRs. LTRs of the younger clusters show both deletions. The integration time of LTRs in the oldest cluster has been estimated to be 45 to 30 Myr (23).
The various HERV-K families in the genome have been defined by
phylogenetic analysis of a conserved pol region
(21). Our phylogenetic analysis (Fig. 4) groups
HERV-K(OLD) unambiguously in the HML2-family and also confirms the
existence of two subgroups differing in LTR length. Interestingly, the
recently described sequences HML2-4 and HML2-5 (21) proved
to be identical to the pol regions in HERV-K(OLD-AL121932)
and HERV-K(OLD-AC004979), respectively. It is possible that these
pol fragments are derived from the HERV-K(OLD) proviruses.
Both HML-2.4 and HML-2.5 belong to HERV-K(OLD) proviruses with LTRs
carrying the characteristic deletions. It is conceivable that other
HML-2 sequences also belong to not-yet-identified proviruses with or
without these mutations, for example, HML-2.3, -2.2, and -2.1 to such
proviruses with shorter LTRs and HML-2.6 to a more ancient provirus
with longer LTRs.
The dUTPase domain within the prt ORF is inactive in
HERV-K(HML-2) due to mutations in several, usually conserved, amino
acid motifs. Alignment of HERV-K(OLD) prt sequences led to a
consensus sequence with a dUTPase ORF and characteristic amino acid
motifs (Fig. 5) resembling those of an enzymatically active HERV-K
dUTPase construct, which was interpreted as the ancestral wild-type
variant (7). Furthermore, the provirus AL136419 still
shows a prt ORF. We therefore suggest that HERV-K(OLD) once
encoded an active dUTPase enzyme.
In this study we present the apparent predecessor sequences of the
HERV-K(HML-2) family, as they were probably present in the genomes
before the divergence of the lower Old World primate and hominoid
lineages. Based on the data presented here and on previous results
(19), these HERV-K(HML-2) predecessors had a longer
gag gene, a pol-env boundary
containing the 292-bp sequence, and either short or long LTR sequences,
with the long LTR variant conceivably being more ancient. All of these
sequence features were changed in the course of the evolution of the
human lineage when mutants were amplified and eventually ended up in
the human genome. A similar history has been observed for the HERV-H
family (6). As with the HERV-K(HML-2) sequences in the
human genome, it is possible that in each primate species a unique
subset of endogenous retroviruses amplified in copy number after the
species separated from its predecessors. Which factors triggered
selective amplification of certain endogenous retrovirus variants
remains to be seen.
 |
ACKNOWLEDGMENTS |
This work is supported by the Deutsche Forschungsgemeinschaft
(Me917/16-1).
We thank Brenda Glass for critical editing of the manuscript.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institut
für Humangenetik, Bau 60, Universität des Saarlandes, 66421 Homburg/Saar, Germany. Phone: 49-6841-1626038. Fax: 49-6841-1626186. E-mail: hgemee{at}med-rz.uni-sb.de.
 |
REFERENCES |
| 1.
|
Altschul, S. F.,
T. L. Madden,
A. A. Schaffer,
J. Zhang,
Z. Zhang,
W. Miller, and D. J. Lipman.
1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
25:3389-3402[Abstract/Free Full Text].
|
| 2.
|
Andersson, M.,
M. Lindeskog,
P. Medstrand,
B. Westley,
F. May, and J. Blomberg.
1999.
Diversity of human endogenous retrovirus classII-like sequences.
J. Gen. Virol.
80:255-260[Abstract].
|
| 3.
|
Baldo, A. M., and M. A. McClure.
1999.
Evolution and horizontal transfer of dUTPase-encoding genes in viruses and their hosts.
J. Virol.
73:7710-7721[Abstract/Free Full Text].
|
| 4.
|
Britten, R. J.
1994.
Evidence that most human Alu sequences were inserted in a process that ceased about 30 million years ago.
Proc. Natl. Acad. Sci. USA
91:6148-6150[Abstract/Free Full Text].
|
| 5.
|
Dangel, A. W.,
B. J. Baker,
A. R. Mendoza, and C. Y. Yu.
1995.
Complement component C4 gene intron 9 as a phylogenetic marker for primates: long terminal repeats of the endogenous retrovirus ERV-K(C4) are a molecular clock of evolution.
Immunogenetics
42:41-52[CrossRef][Medline].
|
| 6.
|
Goodchild, N. L.,
D. A. Wilkinson, and D. L. Mager.
1993.
Recent evolutionary expansion of a subfamily of RTVL-H human endogenous retrovirus-like elements.
Virology
196:778-788[CrossRef][Medline].
|
| 7.
|
Harris, J. M.,
R. H. Haynes, and E. M. McIntosh.
1997.
A consensus sequence for a functional human endogenous retrovirus K (HERV-K) dUTPase.
Biochem. Cell. Biol.
75:143-151[CrossRef][Medline].
|
| 8.
|
International Human Genome Sequencing Consortium.
2001.
Initial sequencing and analysis of the human genome.
Nature
409:860-921[CrossRef][Medline].
|
| 9.
|
Kapitonov, V., and J. Jurka.
1996.
The age of Alu subfamilies.
J. Mol. Evol.
42:59-65[CrossRef][Medline].
|
| 10.
|
Kimura, M.
1980.
A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences.
J. Mol. Evol.
16:111-120[CrossRef][Medline].
|
| 11.
|
Lavrentieva, I.,
P. Khil,
T. Vinogradova,
A. Akhmedov,
A. Lapuk,
O. Shakhova,
Y. Lebedev,
G. Monastyrskaya, and E. D. Sverdlov.
1998.
Subfamilies and nearest-neighbour dendrogram for the LTRs of human endogenous retrovirus HERV-K mapped on chromosome 19: physical neighbourhood does not correlate with identity level.
Hum. Genet.
102:107-116[CrossRef][Medline].
|
| 12.
|
Lebedev, Y. B.,
O. S. Belonovitch,
N. V. Zybrova,
P. P. Khil,
S. G. Kurdyukov,
T. V. Vinogradova,
G. Hunsmann, and E. D. Sverdlov.
2000.
Differences in HERV-K LTR insertions in orthologous loci of humans and great apes.
Gene
247:265-277[CrossRef][Medline].
|
| 13.
|
Leib-Mosch, C.,
M. Haltmeier,
T. Werner,
E. M. Geigl,
R. Brack-Werner,
U. Francke,
V. Erfle, and R. Hehlmann.
1993.
Genomic distribution and transcription of solitary HERV-K LTRs.
Genomics
18:261-269[CrossRef][Medline].
|
| 14.
|
Li, W.-H., and M. Tanimura.
1987.
The molecular clock runs more slowly in man than in apes and monkeys.
Nature
326:93-96[CrossRef][Medline].
|
| 15.
|
Li, W.-H.
1997.
Molecular evolution.
Sinauer, Sunderland, Mass.
|
| 16.
|
Löwer, R.,
K. Boller,
B. Hasenmaier,
C. Korbmacher,
N. Mueller-Lantzsch,
J. Löwer, and R. Kurth.
1993.
Identification of human endogenous retroviruses with complex mRNA expression and particle formation.
Proc. Natl. Acad. Sci. USA
90:4480-4484[Abstract/Free Full Text].
|
| 17.
|
Löwer, R.,
J. Löwer, and R. Kurth.
1996.
The viruses in all of us: characteristics and biological significance of human endogenous retrovirus sequences.
Proc. Natl. Acad. Sci. USA
93:5177-5184[Abstract/Free Full Text].
|
| 18.
|
Mayer, J.,
E. Meese, and N. Mueller-Lantzsch.
1997.
Chromosomal assignment of human endogenous retrovirus K (HERV-K) env open reading frames.
Cytogenet. Cell. Genet.
79:157-161[Medline].
|
| 19.
|
Mayer, J.,
E. Meese, and N. Mueller-Lantzsch.
1998.
Human endogenous retrovirus K homologous sequences and their coding capacity in old world primates.
J. Virol.
72:1870-1875[Abstract/Free Full Text].
|
| 20.
|
Mayer, J.,
M. Sauter,
A. Rácz,
D. Scherer,
N. Mueller-Lantzsch, and E. Meese.
1999.
An almost-intact human endogenous retrovirus K on human chromosome 7.
Nat. Genet.
21:257-258[CrossRef][Medline].
|
| 21.
|
Medstrand, P., and J. Blomberg.
1993.
Characterization of novel reverse transcriptase encoding human endogenous retroviral sequences similar to type A and type B retroviruses: differential transcription in normal human tissues.
J. Virol.
67:6778-6787[Abstract/Free Full Text].
|
| 22.
|
Medstrand, P.,
D. L. Mager,
H. Yin,
U. Dietrich, and J. Blomberg.
1997.
Structure and genomic organization of a novel human endogenous retrovirus family: HERV-K (HML-6).
J. Gen. Virol.
78:1731-1744[Abstract].
|
| 23.
|
Medstrand, P., and D. L. Mager.
1998.
Human-specific integrations of the HERV-K endogenous retrovirus family.
J. Virol.
72:9782-9787[Abstract/Free Full Text].
|
| 24.
|
Mighell, A. J.,
A. F. Markham, and P. A. Robinson.
1997.
Alu sequences.
FEBS Lett.
417:1-5[CrossRef][Medline].
|
| 25.
|
Mol, C. D.,
J. M. Harris,
E. M. McIntosh, and J. A. Tainer.
1996.
Human dUTP pyrophosphatase: uracil recognition by a beta hairpin and active sites formed by three separate subunits.
Structure
4:1077-1092[Medline].
|
| 26.
|
Nagase, T.,
R. Kikuno,
K. Ishikawa,
M. Hirosawa, and O. Ohara.
2000.
Prediction of the coding sequences of unidentified human genes. XVII. The complete sequence of 100 new cDNA clones from brain which code for large proteins in vitro.
DNA Res.
7:143-150[Abstract/Free Full Text].
|
| 27.
|
Ono, M.,
T. Yasunaga,
T. Miyata, and H. Ushikubo.
1986.
Nucleotide sequence of human endogenous retrovirus genome related to mouse mammary tumor virus genome.
J. Virol.
60:689-698.
|
| 28.
|
Reus, K.,
J. Mayer,
M. Sauter,
D. Scherer,
N. Müller-Lantzsch, and E. Meese.
2001.
Genomic organization of the human endogenous retrovirus HERV-K(HML-2.HOM) (ERVK6) on chromosome 7.
Genomics
72:314-320[CrossRef][Medline].
|
| 29.
|
Seifarth, W.,
C. Baust,
A. Murr,
H. Skladny,
F. Krieg-Schneider,
J. Blusch,
T. Werner,
R. Hehlmann, and C. Leib-Mösch.
1998.
Proviral structure, chromosomal location, and expression of HERV-K-T47D, a novel human endogenous retrovirus derived from T47D particles.
J. Virol.
72:8384-8391[Abstract/Free Full Text].
|
| 30.
|
Sprinzl, M.,
C. Horn,
M. Brown,
A. Ioudovitch, and S. Steinberg.
1998.
Compilation of tRNA sequences and sequences of tRNA genes.
Nucleic Acids Res.
26:148-153[Abstract/Free Full Text].
|
| 31.
|
Takahata, N., and Y. Satta.
1997.
Evolution of the primate lineage leading to modern humans: phylogenetic and demographic inferences from DNA sequences.
Proc. Natl. Acad. Sci. USA
94:4811-4815[Abstract/Free Full Text].
|
| 32.
|
Tatusova, T. A., and T. L. Madden.
1999.
BLAST 2 Sequences, a new tool for comparing protein and nucleotide sequences.
FEMS Microbiol. Lett.
174:247-250[CrossRef][Medline].
|
| 33.
|
Thompson, J. D.,
D. G. Higgins, and T. J. Gibson.
1994.
CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.
Nucleic Acids Res.
22:4673-4680[Abstract/Free Full Text].
|
| 34.
|
Tristem, M.
2000.
Identification and characterization of novel human endogenous retrovirus families by phylogenetic screening of the human genome mapping project database.
J. Virol.
74:3715-3730[Abstract/Free Full Text].
|
| 35.
|
Werner, T.,
R. Brack-Werner,
C. Leib-Mosch,
H. Backhaus,
V. Erfle, and R. Hehlmann.
1990.
S71 is a phylogenetically distinct human endogenous retroviral element with structural and sequence homology to simian sarcoma virus (SSV).
Virology
174:225-238[CrossRef][Medline].
|
| 36.
|
Wilkinson, D. A.,
D. L. Mager, and J. A. Leong.
1994.
Endogenous human retroviruses, p. 465-535.
In
J. A. Levy (ed.), The Retroviridae, vol. 3. Plenum Press, Inc., New York, N.Y.
|
Journal of Virology, October 2001, p. 8917-8926, Vol. 75, No. 19
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.19.8917-8926.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Frank, O., Verbeke, C., Schwarz, N., Mayer, J., Fabarius, A., Hehlmann, R., Leib-Mosch, C., Seifarth, W.
(2008). Variable Transcriptional Activity of Endogenous Retroviruses in Human Breast Cancer. J. Virol.
82: 1808-1818
[Abstract]
[Full Text]
-
Belshaw, R., Watson, J., Katzourakis, A., Howe, A., Woolven-Allen, J., Burt, A., Tristem, M.
(2007). Rate of Recombinational Deletion among Human Endogenous Retroviruses. J. Virol.
81: 9437-9442
[Abstract]
[Full Text]
-
Belshaw, R., Dawson, A. L. A., Woolven-Allen, J., Redding, J., Burt, A., Tristem, M.
(2005). Genomewide Screening Reveals High Levels of Insertional Polymorphism in the Human Endogenous Retrovirus Family HERV-K(HML2): Implications for Present-Day Activity. J. Virol.
79: 12507-12514
[Abstract]
[Full Text]
-
Song, B., Gold, B., O'hUigin, C., Javanbakht, H., Li, X., Stremlau, M., Winkler, C., Dean, M., Sodroski, J.
(2005). The B30.2(SPRY) Domain of the Retroviral Restriction Factor TRIM5{alpha} Exhibits Lineage-Specific Length and Sequence Variation in Primates. J. Virol.
79: 6111-6121
[Abstract]
[Full Text]
-
Lavie, L., Kitova, M., Maldener, E., Meese, E., Mayer, J.
(2005). CpG Methylation Directly Regulates Transcriptional Activity of the Human Endogenous Retrovirus Family HERV-K(HML-2). J. Virol.
79: 876-883
[Abstract]
[Full Text]
-
Lavie, L., Medstrand, P., Schempp, W., Meese, E., Mayer, J.
(2004). Human Endogenous Retrovirus Family HERV-K(HML-5): Status, Evolution, and Reconstruction of an Ancient Betaretrovirus in the Human Genome. J. Virol.
78: 8788-8798
[Abstract]
[Full Text]
-
de Parseval, N., Lazar, V., Casella, J.-F., Benit, L., Heidmann, T.
(2003). Survey of Human Genes of Retroviral Origin: Identification and Transcriptome of the Genes with Coding Capacity for Complete Envelope Proteins. J. Virol.
77: 10414-10422
[Abstract]
[Full Text]