Previous Article | Next Article 
Journal of Virology, September 2001, p. 8837-8841, Vol. 75, No. 18
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.18.8837-8841.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
A Replication-Competent Feline Leukemia
Virus, Subgroup A (FeLV-A), Tagged with Green Fluorescent
Protein Reporter Exhibits In Vitro Biological Properties Similar to
Those of the Parental FeLV-A
Zongli
Chang,1
Judong
Pan,1
Christopher
Logg,1,2
Noriyuki
Kasahara,1,2,3 and
Pradip
Roy-Burman1,3,*
Department of
Pathology,1 Department of Biochemistry
and Molecular Biology,3 and Institute
for Genetic Medicine,2 University of Southern
California School of Medicine, Los Angeles, California 90033
Received 8 January 2001/Accepted 19 June 2001
 |
ABSTRACT |
We previously established that lymphoid tumors could be
induced in cats by intradermal injection of ecotropic feline
leukemia virus (FeLV), subgroup A, plasmid DNA. In preparation for in
vivo experiments to study the cell-to-cell pathway for
the spread of the virus from the site of inoculation, the green
fluorescent protein (GFP) transgene fused to an internal ribosome entry
site (IRES) was inserted after the last nucleotide of the
env gene in the ecotropic FeLV-A Rickard (FRA) provirus.
The engineered plasmid was transfected into feline fibroblast cells for
production of viruses and determination of GFP expression. The virions
produced were highly infectious, and the infected cells could continue to mediate strong expression of GFP after long-term propagation in
culture. Similar to parental virus, the transgene-containing ecotropic
virus demonstrated recombinogenic activity with endogenous FeLV
sequences in feline cells to produce polytropic recombinant FeLV
subgroup B-like viruses which also contained the IRES-GFP transgene in
the majority of recombinants. To date, the engineered virus has been
propagated in cell culture for up to 8 months without diminished GFP
expression. This is the first report of a replication-competent FeLV
vector with high-level and stable expression of a transgene.
| |
TEXT |
Feline leukemia virus (FeLV) has
been categorized into three subgroups (A, B, and C) by viral
interference assays that identify genetic sequence variation in the
viral surface glycoprotein (SU) moiety of the envelope
(env) gene (17, 18). Evidence suggests that
FeLV-B, and perhaps FeLV-C, species are formed by recombination in SU
gene sequences between FeLV-A and endogenous FeLV (enFeLV) elements
inherited in the domestic cat genome (2, 3, 6, 10, 13, 14, 16,
20-22). The pathogenicity of FeLV-A Rickard strain (FRA) was
demonstrated by direct intradermal inoculation of plasmid DNA (pFRA) in
neonatal cats (3, 14). The pFRA-inoculated cats developed
lymphoid tumors within a period of 28 to 55 weeks postinfection (p.i.),
and FeLV-B species that evolved from recombination of FRA with enFeLV
could be detected as early as 1 to 2 weeks p.i. We undertook a study to
design a replication-competent FRA containing the green fluorescent
protein (GFP) gene so that infected tissues and cells might be followed
by fluorescence technologies, particularly during early stages of
infection. In this report we describe such a replicating FeLV vector
containing a 1.3-kb insert positioned immediately downstream of the
env gene that stably expresses the GFP gene. Several
previous reports described replication-competent vectors which
were derived from various retroviruses, including murine leukemia virus
(4, 5, 11, 15, 23), avian leukemia virus
(12), simian immunodeficiency virus (7),
human immunodeficiency virus (24), and human foamy virus
(19). The transgenes as incorporated, however, were not genetically stable, since they were lost after a few passages (7,
12, 15).
Generation of FRA-GFP construct.
A 550-bp internal ribosomal
entry site (IRES) sequence of encephalomyocarditis virus attached to a
multiple cloning site (MCS) was fused to the env gene
by overlap extension PCR (8) (Fig. 1A). The env fragment,
spanning a region from the NarI site to the end of
env, was amplified from pFRA. Subsequently, in a
three-partite ligation (Fig. 1B), the NarI-SpeI
fragment of pFRA was replaced with the fragments designated
env-IRES-MCS and LTR, deleting the 3' cellular sequence in the original
pFRA and giving rise to pFRA-IRES. The Emerald-green (emd) GFP gene was
then cloned in the MCS of pFRA-IRES, resulting in pFRA-GFP. The LTR
fragment encompassed the sequence from immediately downstream of
env to the 3' end of LTR. The emd GFP sequence was amplified
from pGFPemd-CMV vector (Packard BioScience Company, Meriden, Conn.). A
GCC triplet, reported to improve translation from the IRES
(9), was introduced into the GFP sequence after the first
ATG codon by PCR as indicated in Fig. 1C.
View larger version (24K):
[in this window]
[in a new window]
|
FIG. 1.
Construction of FRA-GFP. (A) Schematic representation of
the overlap extension PCR for fusing the env fragment
with the IRES-MCS fragment. The two primers used for the overlap
extension PCR are indicated by the arrows. (B) The steps in conversion
from pFRA to pFRA-IRES and then to pFRA-GFP. (C) Nucleotide sequences
of FRA-GFP at junctions between the env gene and IRES
and IRES-GFP. The start codon for the GFP gene is in bold. The
restriction sites, except for that of NarI, were
introduced by the primers used.
|
|
Replication properties of FRA-GFP in vitro.
When the feline
H927 fibroblasts were transfected with FRA or FRA-GFP plasmid,
infectious virions were produced for which similar peak titers were
reached by 5 days after transfection (data not shown). In the case of
pFRA-GFP, 2 days after transfection a small proportion of cells
exhibited faint green fluorescence, indicating that the vector did
mediate expression of the GFP transgene. Subsequently, the proportion
of cells exhibiting GFP expression continued to rise, and by the fifth
day almost all passage 1 (P1) cells expressed GFP (Fig.
2A). This observation verified the
cell-to-cell spread of the virus. To examine the continued ability of
the FRA-GFP virus to express GFP, pFRA-GFP-transfected H927 cells were
passaged in culture for up to 8 months. Almost 100% of the cells were
found to continuously express GFP throughout the passages.
Similarly, flow cytometric analyses showed that practically all of the
cells were positive for GFP expression. This is illustrated with P20 and P40 cells in Fig. 2B. Thus, the viruses produced were not only
replication-competent but also were capable of cotransporting a
functional GFP gene for a long time, suggesting that the IRES-GFP transgene persisted in the proviral genome of FRA-GFP. The viral stocks
obtained at P8 and P16 of pFRA-GFP-transfected cells were 10-fold
serially diluted and titrated by measuring the percentage of
GFP-expressing cells by flow cytometry. These viral titer stocks, showing values of 8 × 107 and 1.6 × 108 infectious units/ml, respectively, were used
to infect H927 cells at a multiplicity of infection of 10. A fivefold
dilution of the culture supernatant was then filtered and used to
infect a fresh plate of H927 cells. This cycle of infection was
repeated for a total of seven rounds, and the cells were examined for
GFP expression on the fourth day during each round by flow cytometry.
The GFP-expressing cells remained at almost 100% for the first five
rounds of infections, with evidence of only a minor decline of
GFP-positive cells from the sixth passage (data not shown).
View larger version (64K):
[in this window]
[in a new window]
|
FIG. 2.
GFP expression after prolonged propagation.
pFRA-GFP-transfected cells were split 1 to 6 twice a week and
replenished with fresh medium for more than 8 months. The expression of
GFP was monitored microscopically and by flow cytometry. (A) GFP
expression in P1 of FRA-GFP-transfected cells at the fifth day
posttransfection. Cells in the same field under bright field (left) and
UV (right) illumination are shown. (B) Flow cytometry analysis of cells
collected from P20 and P40 showing the percentages of cells expressing
GFP.
|
|
Generation of envelope recombinants.
The genomic DNA extracted
from different passages (P7, 14, 22, and 33) of pFRA-GFP-transfected
H927 cells was examined for the presence of recombinant env
proviruses by PCR. The primers used for this purpose consisted of one
specific for an enFeLV clone, CFE-6, located at nucleotide (nt) 601 downstream of the SU start site, and another specific for the exogenous
FeLV-A LTR U3 region. These primers encompassed the majority of the 3'
recombination sites in the env gene described previously
(3, 20, 21) as well as the IRES and GFP sequences. A
predominant band of 3 kb that would also include the IRES and GFP
sequences in the recombinant species was readily detected in the DNA of
all passages up to the tested time period of 6 months (lanes 3 to 6).
The intactness of the IRES and GFP transgene and the relevant portion
of the env gene after recombination were confirmed by PCR
amplification of regions of this 3-kb fragment as well as by sequencing
of the PCR products. The viral species that gave rise to bands of about 2.5 and 2.6 kb were detected at P7 (lane 3) but not in subsequent passages (lanes 4 to 6). The 1.8-kb species, seen at P14, 22, and 30 and faintly at P7 (lanes 3 to 6), corresponded to the size of a product
without the IRES and GFP transgene, such as the FeLV-B/GA plasmid (lane
8). After human HT1080 fibrosarcoma cells were infected with viral
stocks obtained from P20 of the supernatant of FRA-GFP-transfected H927
cells, the genomic DNA was extracted at P7 and amplified with
the primers specific for recombinant viral species. Like the
recombinant FeLV (rFeLV) species in transfected H927, the 3- and 1.8-kb
species were also prominent in the infected HT1080 cells (data not shown).
Clones of 1.8- and 3-kb PCR products representing
env gene
recombinants, named according to the passage number of
FRA-GFP-transfected
cells and the length of fragments detected in PCR,
were sequenced
and compared with the sequence of enFeLV or exogenous
FeLV (Fig.
3B and C). In the 3-kb
species, the 3' crossover site was located
at nt 1672 in the
mid-transmembrane protein (TM) region. The 1.8-kb
species had
its 3' crossover site at approximately nt 2079 in
the 3' untranslated
region (3' UTR) of
env. While full-length
IRES and GFP were
retained in P22 3-kb clones, they were deleted
completely in the P22
1.8-kb clones. Because the 3' recombination
site for the P22 1.8-kb
clones was located in the 3' UTR, it was
not surprising to find a
deletion of a continuous stretch of sequence
spanning the IRES-GFP
transgene upstream of the crossover site.
This implied that during
recombination a strand switching occurred
that resulted in a jump over
the deleted region.
View larger version (55K):
[in this window]
[in a new window]
|
FIG. 3.
Analysis of recombinant viral species. (A) The
genomic DNA samples, isolated as described previously
(1) from P7, 14, 22, and 33 (lanes 3, 4, 5, and 6, respectively) FRA-GFP-transfected feline H927 cells as well as
untransfected H927 cells (lane 2), were amplified by PCR with primers
NuRB53 and NuH20. NuRB53 is specific for endogenous FeLV sequence and
corresponds to the CFE-6 sequence ACTCCTCGACAACGGGAGCTAGTG AAG
(10). NuH20 is complementary to the sequence
GAAGGTCGAACCCTGGTCAACTGG on LTR of FRA. The cloned
FeLV-B/GA plasmid DNA (lane 8) was used as a positive control, with an
expected size of the amplified fragment of 1.8 kb. Lanes 1 and 7 are
negative controls, without template or with pFRA-GFP DNA as template,
respectively. M indicates molecular size markers. (B) The PCR bands
were purified and cloned into the TA cloning vector. Two clones derived
from each band were sequenced and compared with enFeLV and FRA
sequences. 3' recombination crossover sites and the presence or absence
of the IRES-GFP transgene in these recombinants are indicated. (C)
Representation of the identified 3' crossover sites for the recombinant
species relative to the regions on the viral genome and relative to
previously reported A-G crossover sites (2, 3, 21). The
arrow indicates the 3' UTR of env.
|
|
In previous in vivo studies, we described scattered nucleotide and
amino acid changes in the enFeLV-derived
env sequence of
the
rFeLV species. Interestingly, many of those changes were conserved
in
the natural FeLV-B isolates. Previously, 19 such nucleotide
changes
were identified, and 13 of them led to amino acid changes
(
2,
3). Due to the design of the PCR primers employed in
those
earlier studies, all changes uncovered were restricted to
the SU
region. The primers employed in this study, however, allowed
us to
identify changes in the entire
env gene, including the 3'
UTR. Previously identified sites, sites 14 to 19 (
2), were
also detected in the present study, suggesting the consistency
of these
changes. In addition, 13 more downstream nucleotide changes
(sites 20 to 32) were found, and 9 of them led to amino acid changes.
The
location of changes in relation to CFE-6
env is summarized
in Fig.
4A, and the findings from
individual clones are presented
for comparison with each other as well
as with natural FeLV-B
clones (Fig.
4B). Besides the several consistent
changes noted
in different independent experiments, such as conversion
of Pro
to Leu at site 15 to restore a major neutralizing epitope
(
2)
conserved in all naturally occurring exogenous FeLV
clones sequenced
so far, a surprising finding was the three C
insertions at nt
1515, 1517, and 1541. These three insertions resulted
in an extra
amino acid as well as changes in a contiguous stretch of
amino
acids surrounding sites 27 to 29 (Fig.
4B). Previously, that
variable
stretch of sequence was described as region VIII
(
10).
View larger version (28K):
[in this window]
[in a new window]
|
FIG. 4.
Deduced amino acid differences between the rFeLV species
and the endogenous CFE-6 sequence. (A) Diagram showing the locations of
the observed amino acid changes. Sites 1 to 19 were previously reported
(2), and sites which are new are in boldface (sites 22 to
32). (B) Amino acids conserved in all rFeLVs and exogenous FeLV-B
clones but different from enFeLV are marked by boxes. Three C
insertions at nt 1515, 1517, and 1541 lead to an extra amino acid as
well as a stretch of amino acid changes at sites 27 to 29. Nucleotide
and amino acid numbering is based on the sequence of CFE-6
env (10) with the start point of SU as 1. ~~, gaps between sequences; \\, the end of the acquired
endogenous sequences; *, the end of the sequence of the truncated
FeLV-B/ST clone.
|
|
Our studies clearly demonstrate that a small foreign gene can be
incorporated into an FeLV provirus and can be efficiently
expressed in
cells without disrupting functions critical for virus
replication.
Moreover, it is demonstrated that the FRA-GFP virus
undergoes the types
of recombinational and mutational processes
similar to those of the FRA
virus in feline cells to produce polytropic
FeLV-B-like viruses, most
of which still carry the GFP reporter
gene. The FRA-GFP virus has a
proviral genome size of 9.7 kb,
and the inserted sequence of 1.3 kb can
be maintained in prolonged
culture with no observable reduction of gene
expression, as demonstrated
by the intensity of fluorescence and
infectivity of the viruses
produced. Despite the presence of
recombinants with deletions,
the complete virus with the full-length
transgene remains the
major species in P14, 22, and 33. This
predominance of virus containing
the transgene indicates that the
9.7-kb viral genome can sustain
the genome size selection during viral
encapsidation over prolonged
propagation and that the virions can
package genomic RNA of this
size and remain stable. Thus,
insertion of exogenous sequences
at the immediate 3' end of
env seems to allow for a high degree
of stability of the
transgene during viral
replication.
Another point to note is that it would now be possible to insert other
genes, such as a suicide gene or a proapoptosis gene,
at the polyclonal
site immediately 3' of the IRES sequence in
place of GFP of the
designed vector. Such incorporations could
potentially have a novel
utility, i.e., to follow a natural FeLV
infection with engineered
viruses to eliminate the infected cells.
Additionally, similar designs
may also apply to the control of
devastating diseases induced by other
retroviruses, such as feline
immunodeficiency virus and human
immunodeficiency
virus.
| |
ACKNOWLEDGMENTS |
Zongli Chang and Judong Pan contributed equally to this work.
This work was supported by Public Health Service grant CA51485 from the
National Cancer Institute.
We thank William Powell for assistance in the implementation of some of
the experiments.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Pathology, University of Southern California School of Medicine, 2011 Zonal Ave., Los Angeles, CA 90089. Phone: (323) 442-1184. Fax: (323)
442-3049. E-mail: royburma{at}usc.edu.
| |
REFERENCES |
| 1.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl (ed.).
1994.
Current protocols in molecular biology, vol. 1. , p. 2.2.1-2.2.3.
John Wiley and Sons, New York, N.Y.
|
| 2.
|
Bechtel, M. K.,
L. E. Mathes,
K. A. Hayes,
A. J. Phipps, and P. Roy-Burman.
1998.
In vivo evolution and selection of recombinant feline leukemia virus species.
Virus Res.
54:71-86[CrossRef][Medline].
|
| 3.
|
Chen, H.,
M. K. Bechtel,
Y. Shi,
A. Phipps,
L. E. Mathes,
K. A. Hayes, and P. Roy-Burman.
1998.
Pathogenicity induced by feline leukemia virus, Rickard strain, subgroup A plasmid DNA (pFRA).
J. Virol.
72:7048-7056[Abstract/Free Full Text].
|
| 4.
|
Coulombe, J.,
Y. Avis, and D. A. Gray.
1996.
A replication-competent promoter-trap retrovirus.
J. Virol.
70:6810-6815[Abstract/Free Full Text].
|
| 5.
|
Dillon, P. J.,
J. Lenz, and C. A. Rosen.
1991.
Construction of a replication-competent murine retrovirus vector expressing the human immunodeficiency virus type 1 tat transactivator protein.
J. Virol.
65:4490-4493[Abstract/Free Full Text].
|
| 6.
|
Elder, J. H., and J. I. Mullins.
1983.
Nucleotide sequence of the envelope gene of Gardner-Arnstein feline leukemia virus B reveals unique sequence homologies with a murine mink cell focus-forming virus.
J. Virol.
46:871-880[Abstract/Free Full Text].
|
| 7.
|
Giavedoni, L. D., and T. Yilma.
1996.
Construction and characterization of replication-competent simian immunodeficiency virus vectors that express gamma interferon.
J. Virol.
70:2247-2251[Abstract].
|
| 8.
|
Horton, R. M.,
H. D. Hunt,
S. N. Ho,
J. K. Pullen, and L. R. Pease.
1989.
Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension.
Gene
77:61-68[CrossRef][Medline].
|
| 9.
|
Hunt, S. L.,
A. Kaminski, and R. J. Jackson.
1993.
The influence of viral coding sequences on the efficiency of internal initiation of translation of cardiovirus RNAs.
Virology
197:801-807[CrossRef][Medline].
|
| 10.
|
Kumar, D. V.,
B. T. Berry, and P. Roy-Burman.
1989.
Nucleotide sequence and distinctive characteristics of the env gene of endogenous feline leukemia provirus.
J. Virol.
63:2379-2384[Abstract/Free Full Text].
|
| 11.
|
Lobel, L. I.,
M. Patel,
W. King,
M. C. Nguyen-Huu, and S. P. Goff.
1985.
Construction and recovery of viable retroviral genomes carrying a bacterial suppressor transfer RNA gene.
Science
228:329-332[Abstract/Free Full Text].
|
| 12.
|
Murakami, M.,
H. Watanabe,
Y. Niikura,
T. Kameda,
K. Saitoh,
M. Yamamoto,
Y. Yokouchi,
A. Kuroiwa,
K. Mizumoto, and H. Iba.
1997.
High-level expression of exogenous genes by replication-competent retrovirus vectors with an internal ribosomal entry site.
Gene
202:23-29[CrossRef][Medline].
|
| 13.
|
Overbaugh, J.,
N. Reidel,
E. A. Hoover, and J. I. Mullins.
1988.
Transduction of endogenous envelope genes by feline leukemia virus in vitro.
Nature
332:731-734[CrossRef][Medline].
|
| 14.
|
Phipps, A. J.,
H. Chen,
K. A. Hayes,
P. Roy-Burman, and L. E. Mathes.
2000.
Differential pathogenicity of two feline leukemia virus subgroup A molecular clones, pFRA and pF6A.
J. Virol.
74:5796-5801[Abstract/Free Full Text].
|
| 15.
|
Reik, W.,
H. Weiher, and R. Jaenisch.
1985.
Replication-competent Moloney murine leukemia virus carrying a bacterial suppressor tRNA gene: selective cloning of proviral and flanking host sequences.
Proc. Natl. Acad. Sci. USA
82:1141-1145[Abstract/Free Full Text].
|
| 16.
|
Rohn, J. L.,
M. L. Linenberger,
E. A. Hoover, and J. Overbaugh.
1994.
Evolution of feline leukemia virus variant genomes with insertions, deletions, and defective envelope genes in infected cats with tumors.
J. Virol.
68:2458-2467[Abstract/Free Full Text].
|
| 17.
|
Sarma, P. S., and T. Log.
1973.
Subgroup classification of feline leukemia and sarcoma viruses by viral interference and neutralization tests.
Virology
54:160-169[CrossRef][Medline].
|
| 18.
|
Sarma, P. S., and T. Log.
1971.
Viral interference in feline leukemia-sarcoma complex.
Virology
44:352-358.
|
| 19.
|
Schmidt, M., and A. Rethwilm.
1995.
Replicating foamy virus-based vectors directing high level expression of foreign genes.
Virology
210:167-178[CrossRef][Medline].
|
| 20.
|
Sheets, R. L.,
R. Pandey,
W.-C. Jen, and P. Roy-Burman.
1993.
Recombinant feline leukemia virus genes detected in naturally occurring feline lymphosarcomas.
J. Virol.
67:3118-3125[Abstract/Free Full Text].
|
| 21.
|
Sheets, R. L.,
R. Pandey,
V. Klement,
C. K. Grant, and P. Roy-Burman.
1992.
Biologically selected recombinants between feline leukemia virus (FeLV) subgroup A and an endogenous FeLV element.
Virology
190:849-855[CrossRef][Medline].
|
| 22.
|
Stewart, M. A.,
M. Warnock,
A. Wheeler,
N. Wilkie,
J. I. Mullins,
D. E. Onions, and J. C. Neil.
1986.
Nucleotide sequences of a feline leukemia virus subgroup A envelope gene and long terminal repeat and evidence for the recombinational origin of subgroup B viruses.
J. Virol.
58:825-834[Abstract/Free Full Text].
|
| 23.
|
Stuhlmann, H.,
R. Jaenisch, and R. C. Mulligan.
1989.
Construction and properties of replication-competent murine retroviral vectors encoding methotrexate resistance.
Mol. Cell. Biol.
9:100-108[Abstract/Free Full Text].
|
| 24.
|
Terwilliger, E. F.,
B. Godin,
J. G. Sodroski, and W. A. Haseltine.
1989.
Construction and use of a replication-competent human immunodeficiency virus (HIV-1) that expresses the chloramphenicol acetyltransferase enzyme.
Proc. Natl. Acad. Sci. USA
86:3857-3861[Abstract/Free Full Text].
|
Journal of Virology, September 2001, p. 8837-8841, Vol. 75, No. 18
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.18.8837-8841.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kusser, K. L., Randall, T. D.
(2003). Simultaneous Detection of EGFP and Cell Surface Markers by Fluorescence Microscopy in Lymphoid Tissues. J. Histochem. Cytochem.
51: 5-14
[Abstract]
[Full Text]
Top
Abstract
Text
