This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chang, Z.
Right arrow Articles by Roy-Burman, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chang, Z.
Right arrow Articles by Roy-Burman, P.

 Previous Article  |  Next Article 

Journal of Virology, September 2001, p. 8837-8841, Vol. 75, No. 18
0022-538X/01/$04.00+0   DOI: 10.1128/JVI.75.18.8837-8841.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.

A Replication-Competent Feline Leukemia Virus, Subgroup A (FeLV-A), Tagged with Green Fluorescent Protein Reporter Exhibits In Vitro Biological Properties Similar to Those of the Parental FeLV-A

Zongli Chang,1 Judong Pan,1 Christopher Logg,1,2 Noriyuki Kasahara,1,2,3 and Pradip Roy-Burman1,3,*

Department of Pathology,1 Department of Biochemistry and Molecular Biology,3 and Institute for Genetic Medicine,2 University of Southern California School of Medicine, Los Angeles, California 90033

Received 8 January 2001/Accepted 19 June 2001


    ABSTRACT
Top
Abstract
Text
References

We previously established that lymphoid tumors could be induced in cats by intradermal injection of ecotropic feline leukemia virus (FeLV), subgroup A, plasmid DNA. In preparation for in vivo experiments to study the cell-to-cell pathway for the spread of the virus from the site of inoculation, the green fluorescent protein (GFP) transgene fused to an internal ribosome entry site (IRES) was inserted after the last nucleotide of the env gene in the ecotropic FeLV-A Rickard (FRA) provirus. The engineered plasmid was transfected into feline fibroblast cells for production of viruses and determination of GFP expression. The virions produced were highly infectious, and the infected cells could continue to mediate strong expression of GFP after long-term propagation in culture. Similar to parental virus, the transgene-containing ecotropic virus demonstrated recombinogenic activity with endogenous FeLV sequences in feline cells to produce polytropic recombinant FeLV subgroup B-like viruses which also contained the IRES-GFP transgene in the majority of recombinants. To date, the engineered virus has been propagated in cell culture for up to 8 months without diminished GFP expression. This is the first report of a replication-competent FeLV vector with high-level and stable expression of a transgene.


    TEXT
Top
Abstract
Text
References

Feline leukemia virus (FeLV) has been categorized into three subgroups (A, B, and C) by viral interference assays that identify genetic sequence variation in the viral surface glycoprotein (SU) moiety of the envelope (env) gene (17, 18). Evidence suggests that FeLV-B, and perhaps FeLV-C, species are formed by recombination in SU gene sequences between FeLV-A and endogenous FeLV (enFeLV) elements inherited in the domestic cat genome (2, 3, 6, 10, 13, 14, 16, 20-22). The pathogenicity of FeLV-A Rickard strain (FRA) was demonstrated by direct intradermal inoculation of plasmid DNA (pFRA) in neonatal cats (3, 14). The pFRA-inoculated cats developed lymphoid tumors within a period of 28 to 55 weeks postinfection (p.i.), and FeLV-B species that evolved from recombination of FRA with enFeLV could be detected as early as 1 to 2 weeks p.i. We undertook a study to design a replication-competent FRA containing the green fluorescent protein (GFP) gene so that infected tissues and cells might be followed by fluorescence technologies, particularly during early stages of infection. In this report we describe such a replicating FeLV vector containing a 1.3-kb insert positioned immediately downstream of the env gene that stably expresses the GFP gene. Several previous reports described replication-competent vectors which were derived from various retroviruses, including murine leukemia virus (4, 5, 11, 15, 23), avian leukemia virus (12), simian immunodeficiency virus (7), human immunodeficiency virus (24), and human foamy virus (19). The transgenes as incorporated, however, were not genetically stable, since they were lost after a few passages (7, 12, 15).

Generation of FRA-GFP construct. A 550-bp internal ribosomal entry site (IRES) sequence of encephalomyocarditis virus attached to a multiple cloning site (MCS) was fused to the env gene by overlap extension PCR (8) (Fig. 1A). The env fragment, spanning a region from the NarI site to the end of env, was amplified from pFRA. Subsequently, in a three-partite ligation (Fig. 1B), the NarI-SpeI fragment of pFRA was replaced with the fragments designated env-IRES-MCS and LTR, deleting the 3' cellular sequence in the original pFRA and giving rise to pFRA-IRES. The Emerald-green (emd) GFP gene was then cloned in the MCS of pFRA-IRES, resulting in pFRA-GFP. The LTR fragment encompassed the sequence from immediately downstream of env to the 3' end of LTR. The emd GFP sequence was amplified from pGFPemd-CMV vector (Packard BioScience Company, Meriden, Conn.). A GCC triplet, reported to improve translation from the IRES (9), was introduced into the GFP sequence after the first ATG codon by PCR as indicated in Fig. 1C.


View larger version (24K):
[in this window]
[in a new window]
 
FIG. 1.   Construction of FRA-GFP. (A) Schematic representation of the overlap extension PCR for fusing the env fragment with the IRES-MCS fragment. The two primers used for the overlap extension PCR are indicated by the arrows. (B) The steps in conversion from pFRA to pFRA-IRES and then to pFRA-GFP. (C) Nucleotide sequences of FRA-GFP at junctions between the env gene and IRES and IRES-GFP. The start codon for the GFP gene is in bold. The restriction sites, except for that of NarI, were introduced by the primers used.

Replication properties of FRA-GFP in vitro. When the feline H927 fibroblasts were transfected with FRA or FRA-GFP plasmid, infectious virions were produced for which similar peak titers were reached by 5 days after transfection (data not shown). In the case of pFRA-GFP, 2 days after transfection a small proportion of cells exhibited faint green fluorescence, indicating that the vector did mediate expression of the GFP transgene. Subsequently, the proportion of cells exhibiting GFP expression continued to rise, and by the fifth day almost all passage 1 (P1) cells expressed GFP (Fig. 2A). This observation verified the cell-to-cell spread of the virus. To examine the continued ability of the FRA-GFP virus to express GFP, pFRA-GFP-transfected H927 cells were passaged in culture for up to 8 months. Almost 100% of the cells were found to continuously express GFP throughout the passages. Similarly, flow cytometric analyses showed that practically all of the cells were positive for GFP expression. This is illustrated with P20 and P40 cells in Fig. 2B. Thus, the viruses produced were not only replication-competent but also were capable of cotransporting a functional GFP gene for a long time, suggesting that the IRES-GFP transgene persisted in the proviral genome of FRA-GFP. The viral stocks obtained at P8 and P16 of pFRA-GFP-transfected cells were 10-fold serially diluted and titrated by measuring the percentage of GFP-expressing cells by flow cytometry. These viral titer stocks, showing values of 8 × 107 and 1.6 × 108 infectious units/ml, respectively, were used to infect H927 cells at a multiplicity of infection of 10. A fivefold dilution of the culture supernatant was then filtered and used to infect a fresh plate of H927 cells. This cycle of infection was repeated for a total of seven rounds, and the cells were examined for GFP expression on the fourth day during each round by flow cytometry. The GFP-expressing cells remained at almost 100% for the first five rounds of infections, with evidence of only a minor decline of GFP-positive cells from the sixth passage (data not shown).


View larger version (64K):
[in this window]
[in a new window]
 
FIG. 2.   GFP expression after prolonged propagation. pFRA-GFP-transfected cells were split 1 to 6 twice a week and replenished with fresh medium for more than 8 months. The expression of GFP was monitored microscopically and by flow cytometry. (A) GFP expression in P1 of FRA-GFP-transfected cells at the fifth day posttransfection. Cells in the same field under bright field (left) and UV (right) illumination are shown. (B) Flow cytometry analysis of cells collected from P20 and P40 showing the percentages of cells expressing GFP.

Generation of envelope recombinants. The genomic DNA extracted from different passages (P7, 14, 22, and 33) of pFRA-GFP-transfected H927 cells was examined for the presence of recombinant env proviruses by PCR. The primers used for this purpose consisted of one specific for an enFeLV clone, CFE-6, located at nucleotide (nt) 601 downstream of the SU start site, and another specific for the exogenous FeLV-A LTR U3 region. These primers encompassed the majority of the 3' recombination sites in the env gene described previously (3, 20, 21) as well as the IRES and GFP sequences. A predominant band of 3 kb that would also include the IRES and GFP sequences in the recombinant species was readily detected in the DNA of all passages up to the tested time period of 6 months (lanes 3 to 6). The intactness of the IRES and GFP transgene and the relevant portion of the env gene after recombination were confirmed by PCR amplification of regions of this 3-kb fragment as well as by sequencing of the PCR products. The viral species that gave rise to bands of about 2.5 and 2.6 kb were detected at P7 (lane 3) but not in subsequent passages (lanes 4 to 6). The 1.8-kb species, seen at P14, 22, and 30 and faintly at P7 (lanes 3 to 6), corresponded to the size of a product without the IRES and GFP transgene, such as the FeLV-B/GA plasmid (lane 8). After human HT1080 fibrosarcoma cells were infected with viral stocks obtained from P20 of the supernatant of FRA-GFP-transfected H927 cells, the genomic DNA was extracted at P7 and amplified with the primers specific for recombinant viral species. Like the recombinant FeLV (rFeLV) species in transfected H927, the 3- and 1.8-kb species were also prominent in the infected HT1080 cells (data not shown).

Clones of 1.8- and 3-kb PCR products representing env gene recombinants, named according to the passage number of FRA-GFP-transfected cells and the length of fragments detected in PCR, were sequenced and compared with the sequence of enFeLV or exogenous FeLV (Fig. 3B and C). In the 3-kb species, the 3' crossover site was located at nt 1672 in the mid-transmembrane protein (TM) region. The 1.8-kb species had its 3' crossover site at approximately nt 2079 in the 3' untranslated region (3' UTR) of env. While full-length IRES and GFP were retained in P22 3-kb clones, they were deleted completely in the P22 1.8-kb clones. Because the 3' recombination site for the P22 1.8-kb clones was located in the 3' UTR, it was not surprising to find a deletion of a continuous stretch of sequence spanning the IRES-GFP transgene upstream of the crossover site. This implied that during recombination a strand switching occurred that resulted in a jump over the deleted region.


View larger version (55K):
[in this window]
[in a new window]
 
FIG. 3.   Analysis of recombinant viral species. (A) The genomic DNA samples, isolated as described previously (1) from P7, 14, 22, and 33 (lanes 3, 4, 5, and 6, respectively) FRA-GFP-transfected feline H927 cells as well as untransfected H927 cells (lane 2), were amplified by PCR with primers NuRB53 and NuH20. NuRB53 is specific for endogenous FeLV sequence and corresponds to the CFE-6 sequence ACTCCTCGACAACGGGAGCTAGTG AAG (10). NuH20 is complementary to the sequence GAAGGTCGAACCCTGGTCAACTGG on LTR of FRA. The cloned FeLV-B/GA plasmid DNA (lane 8) was used as a positive control, with an expected size of the amplified fragment of 1.8 kb. Lanes 1 and 7 are negative controls, without template or with pFRA-GFP DNA as template, respectively. M indicates molecular size markers. (B) The PCR bands were purified and cloned into the TA cloning vector. Two clones derived from each band were sequenced and compared with enFeLV and FRA sequences. 3' recombination crossover sites and the presence or absence of the IRES-GFP transgene in these recombinants are indicated. (C) Representation of the identified 3' crossover sites for the recombinant species relative to the regions on the viral genome and relative to previously reported A-G crossover sites (2, 3, 21). The arrow indicates the 3' UTR of env.

In previous in vivo studies, we described scattered nucleotide and amino acid changes in the enFeLV-derived env sequence of the rFeLV species. Interestingly, many of those changes were conserved in the natural FeLV-B isolates. Previously, 19 such nucleotide changes were identified, and 13 of them led to amino acid changes (2, 3). Due to the design of the PCR primers employed in those earlier studies, all changes uncovered were restricted to the SU region. The primers employed in this study, however, allowed us to identify changes in the entire env gene, including the 3' UTR. Previously identified sites, sites 14 to 19 (2), were also detected in the present study, suggesting the consistency of these changes. In addition, 13 more downstream nucleotide changes (sites 20 to 32) were found, and 9 of them led to amino acid changes. The location of changes in relation to CFE-6 env is summarized in Fig. 4A, and the findings from individual clones are presented for comparison with each other as well as with natural FeLV-B clones (Fig. 4B). Besides the several consistent changes noted in different independent experiments, such as conversion of Pro to Leu at site 15 to restore a major neutralizing epitope (2) conserved in all naturally occurring exogenous FeLV clones sequenced so far, a surprising finding was the three C insertions at nt 1515, 1517, and 1541. These three insertions resulted in an extra amino acid as well as changes in a contiguous stretch of amino acids surrounding sites 27 to 29 (Fig. 4B). Previously, that variable stretch of sequence was described as region VIII (10).


View larger version (28K):
[in this window]
[in a new window]
 
FIG. 4.   Deduced amino acid differences between the rFeLV species and the endogenous CFE-6 sequence. (A) Diagram showing the locations of the observed amino acid changes. Sites 1 to 19 were previously reported (2), and sites which are new are in boldface (sites 22 to 32). (B) Amino acids conserved in all rFeLVs and exogenous FeLV-B clones but different from enFeLV are marked by boxes. Three C insertions at nt 1515, 1517, and 1541 lead to an extra amino acid as well as a stretch of amino acid changes at sites 27 to 29. Nucleotide and amino acid numbering is based on the sequence of CFE-6 env (10) with the start point of SU as 1. ~~, gaps between sequences; \\, the end of the acquired endogenous sequences; *, the end of the sequence of the truncated FeLV-B/ST clone.

Our studies clearly demonstrate that a small foreign gene can be incorporated into an FeLV provirus and can be efficiently expressed in cells without disrupting functions critical for virus replication. Moreover, it is demonstrated that the FRA-GFP virus undergoes the types of recombinational and mutational processes similar to those of the FRA virus in feline cells to produce polytropic FeLV-B-like viruses, most of which still carry the GFP reporter gene. The FRA-GFP virus has a proviral genome size of 9.7 kb, and the inserted sequence of 1.3 kb can be maintained in prolonged culture with no observable reduction of gene expression, as demonstrated by the intensity of fluorescence and infectivity of the viruses produced. Despite the presence of recombinants with deletions, the complete virus with the full-length transgene remains the major species in P14, 22, and 33. This predominance of virus containing the transgene indicates that the 9.7-kb viral genome can sustain the genome size selection during viral encapsidation over prolonged propagation and that the virions can package genomic RNA of this size and remain stable. Thus, insertion of exogenous sequences at the immediate 3' end of env seems to allow for a high degree of stability of the transgene during viral replication.

Another point to note is that it would now be possible to insert other genes, such as a suicide gene or a proapoptosis gene, at the polyclonal site immediately 3' of the IRES sequence in place of GFP of the designed vector. Such incorporations could potentially have a novel utility, i.e., to follow a natural FeLV infection with engineered viruses to eliminate the infected cells. Additionally, similar designs may also apply to the control of devastating diseases induced by other retroviruses, such as feline immunodeficiency virus and human immunodeficiency virus.


    ACKNOWLEDGMENTS

Zongli Chang and Judong Pan contributed equally to this work.

This work was supported by Public Health Service grant CA51485 from the National Cancer Institute.

We thank William Powell for assistance in the implementation of some of the experiments.


    FOOTNOTES

* Corresponding author. Mailing address: Department of Pathology, University of Southern California School of Medicine, 2011 Zonal Ave., Los Angeles, CA 90089. Phone: (323) 442-1184. Fax: (323) 442-3049. E-mail: royburma{at}usc.edu.


    REFERENCES
Top
Abstract
Text
References

1. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.). 1994. Current protocols in molecular biology, vol. 1. , p. 2.2.1-2.2.3. John Wiley and Sons, New York, N.Y.
2. Bechtel, M. K., L. E. Mathes, K. A. Hayes, A. J. Phipps, and P. Roy-Burman. 1998. In vivo evolution and selection of recombinant feline leukemia virus species. Virus Res. 54:71-86[CrossRef][Medline].
3. Chen, H., M. K. Bechtel, Y. Shi, A. Phipps, L. E. Mathes, K. A. Hayes, and P. Roy-Burman. 1998. Pathogenicity induced by feline leukemia virus, Rickard strain, subgroup A plasmid DNA (pFRA). J. Virol. 72:7048-7056[Abstract/Free Full Text].
4. Coulombe, J., Y. Avis, and D. A. Gray. 1996. A replication-competent promoter-trap retrovirus. J. Virol. 70:6810-6815[Abstract/Free Full Text].
5. Dillon, P. J., J. Lenz, and C. A. Rosen. 1991. Construction of a replication-competent murine retrovirus vector expressing the human immunodeficiency virus type 1 tat transactivator protein. J. Virol. 65:4490-4493[Abstract/Free Full Text].
6. Elder, J. H., and J. I. Mullins. 1983. Nucleotide sequence of the envelope gene of Gardner-Arnstein feline leukemia virus B reveals unique sequence homologies with a murine mink cell focus-forming virus. J. Virol. 46:871-880[Abstract/Free Full Text].
7. Giavedoni, L. D., and T. Yilma. 1996. Construction and characterization of replication-competent simian immunodeficiency virus vectors that express gamma interferon. J. Virol. 70:2247-2251[Abstract].
8. Horton, R. M., H. D. Hunt, S. N. Ho, J. K. Pullen, and L. R. Pease. 1989. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77:61-68[CrossRef][Medline].
9. Hunt, S. L., A. Kaminski, and R. J. Jackson. 1993. The influence of viral coding sequences on the efficiency of internal initiation of translation of cardiovirus RNAs. Virology 197:801-807[CrossRef][Medline].
10. Kumar, D. V., B. T. Berry, and P. Roy-Burman. 1989. Nucleotide sequence and distinctive characteristics of the env gene of endogenous feline leukemia provirus. J. Virol. 63:2379-2384[Abstract/Free Full Text].
11. Lobel, L. I., M. Patel, W. King, M. C. Nguyen-Huu, and S. P. Goff. 1985. Construction and recovery of viable retroviral genomes carrying a bacterial suppressor transfer RNA gene. Science 228:329-332[Abstract/Free Full Text].
12. Murakami, M., H. Watanabe, Y. Niikura, T. Kameda, K. Saitoh, M. Yamamoto, Y. Yokouchi, A. Kuroiwa, K. Mizumoto, and H. Iba. 1997. High-level expression of exogenous genes by replication-competent retrovirus vectors with an internal ribosomal entry site. Gene 202:23-29[CrossRef][Medline].
13. Overbaugh, J., N. Reidel, E. A. Hoover, and J. I. Mullins. 1988. Transduction of endogenous envelope genes by feline leukemia virus in vitro. Nature 332:731-734[CrossRef][Medline].
14. Phipps, A. J., H. Chen, K. A. Hayes, P. Roy-Burman, and L. E. Mathes. 2000. Differential pathogenicity of two feline leukemia virus subgroup A molecular clones, pFRA and pF6A. J. Virol. 74:5796-5801[Abstract/Free Full Text].
15. Reik, W., H. Weiher, and R. Jaenisch. 1985. Replication-competent Moloney murine leukemia virus carrying a bacterial suppressor tRNA gene: selective cloning of proviral and flanking host sequences. Proc. Natl. Acad. Sci. USA 82:1141-1145[Abstract/Free Full Text].
16. Rohn, J. L., M. L. Linenberger, E. A. Hoover, and J. Overbaugh. 1994. Evolution of feline leukemia virus variant genomes with insertions, deletions, and defective envelope genes in infected cats with tumors. J. Virol. 68:2458-2467[Abstract/Free Full Text].
17. Sarma, P. S., and T. Log. 1973. Subgroup classification of feline leukemia and sarcoma viruses by viral interference and neutralization tests. Virology 54:160-169[CrossRef][Medline].
18. Sarma, P. S., and T. Log. 1971. Viral interference in feline leukemia-sarcoma complex. Virology 44:352-358.
19. Schmidt, M., and A. Rethwilm. 1995. Replicating foamy virus-based vectors directing high level expression of foreign genes. Virology 210:167-178[CrossRef][Medline].
20. Sheets, R. L., R. Pandey, W.-C. Jen, and P. Roy-Burman. 1993. Recombinant feline leukemia virus genes detected in naturally occurring feline lymphosarcomas. J. Virol. 67:3118-3125[Abstract/Free Full Text].
21. Sheets, R. L., R. Pandey, V. Klement, C. K. Grant, and P. Roy-Burman. 1992. Biologically selected recombinants between feline leukemia virus (FeLV) subgroup A and an endogenous FeLV element. Virology 190:849-855[CrossRef][Medline].
22. Stewart, M. A., M. Warnock, A. Wheeler, N. Wilkie, J. I. Mullins, D. E. Onions, and J. C. Neil. 1986. Nucleotide sequences of a feline leukemia virus subgroup A envelope gene and long terminal repeat and evidence for the recombinational origin of subgroup B viruses. J. Virol. 58:825-834[Abstract/Free Full Text].
23. Stuhlmann, H., R. Jaenisch, and R. C. Mulligan. 1989. Construction and properties of replication-competent murine retroviral vectors encoding methotrexate resistance. Mol. Cell. Biol. 9:100-108[Abstract/Free Full Text].
24. Terwilliger, E. F., B. Godin, J. G. Sodroski, and W. A. Haseltine. 1989. Construction and use of a replication-competent human immunodeficiency virus (HIV-1) that expresses the chloramphenicol acetyltransferase enzyme. Proc. Natl. Acad. Sci. USA 86:3857-3861[Abstract/Free Full Text].


Journal of Virology, September 2001, p. 8837-8841, Vol. 75, No. 18
0022-538X/01/$04.00+0   DOI: 10.1128/JVI.75.18.8837-8841.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Kusser, K. L., Randall, T. D. (2003). Simultaneous Detection of EGFP and Cell Surface Markers by Fluorescence Microscopy in Lymphoid Tissues. J. Histochem. Cytochem. 51: 5-14 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chang, Z.
Right arrow Articles by Roy-Burman, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chang, Z.
Right arrow Articles by Roy-Burman, P.