Previous Article | Next Article 
Journal of Virology, September 2001, p. 8712-8723, Vol. 75, No. 18
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.18.8712-8723.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Interactions of the TGB1 Protein during
Cell-to-Cell Movement of Barley Stripe Mosaic
Virus
Diane M.
Lawrence and
A. O.
Jackson*
Department of Plant and Microbial Biology,
University of California, Berkeley, California 94720
Received 1 March 2001/Accepted 12 June 2001
 |
ABSTRACT |
We have recently used a green fluorescent protein (GFP) fusion to
the
b protein of Barley stripe mosaic virus (BSMV) to
monitor cell-to-cell and systemic virus movement. The
b protein is
involved in expression of the triple gene block (TGB) proteins encoded by RNA
but is not essential for cell-to-cell movement. The GFP fusion appears not to compromise replication or movement substantially, and mutagenesis experiments demonstrated that the three most abundant TGB-encoded proteins,
b (TGB1),
c (TGB3), and
d (TGB2), are each required for cell-to-cell movement (D. M. Lawrence and
A. O. Jackson, Mol. Plant Pathol. 2:65-75, 2001). We
have now extended these analyses by engineering a fusion of GFP to TGB1
to examine the expression and interactions of this protein during
infection. BSMV derivatives containing the TGB1 fusion were able to
move from cell to cell and establish local lesions in Chenopodium
amaranticolor and systemic infections of Nicotiana
benthamiana and barley. In these hosts, the GFP-TGB1 fusion
protein exhibited a temporal pattern of expression along the advancing
edge of the infection front. Microscopic examination of the subcellular
localization of the GFP-TGB1 protein indicated an association with the
endoplasmic reticulum and with plasmodesmata. The subcellular
localization of the TGB1 protein was altered in infections in which
site-specific mutations were introduced into the six conserved regions
of the helicase domain and in mutants unable to express the TGB2 and/or TGB3 proteins. These results are compatible with a model suggesting that movement requires associations of the TGB1 protein with
cytoplasmic membranes that are facilitated by the TGB2 and TGB3 proteins.
 |
INTRODUCTION |
The requirements for systemic plant
virus infections differ from those of animal viruses because the plant
cell wall poses a barrier that must be breached to permit initial
infections, cell-to-cell movement, and entry into and exit from the
vasculature. Localized spread from primary infection foci requires that
plant viruses move to adjacent cells through the intercellular channels formed by plasmodesmata (for reviews, see references 11, 35, and
37). Consequently, most plant viruses have evolved dedicated genes that function to mediate cell-to-cell transit. A considerable body of evidence now exists indicating that many of these viruses encode genes that function mechanistically to increase the permeability of the plasmodesmata and to facilitate transport of bound viral nucleoprotein complexes through the plasmodesmata to adjacent cells
(1, 17, 30, 31, 41, 61).
Tobacco mosaic virus (TMV) is the prototype of those viruses
that encode a single cell-to-cell movement protein, and the movement processes described for TMV have provided valuable models for analysis
of the infection processes of other viruses (28, 49). In
many viruses, a single movement protein facilitates cell-to-cell transit by a series of incompletely defined steps during which the
protein encapsidates the viral genome and associates with cytoplasmic
membranes, cytoskeletal elements, and cell wall proteins. These events
alter plasmodesmal permeability sufficiently to permit cell-to-cell
transport of putative viral nucleoprotein complexes (40).
However, numerous other viruses require coordinated activities of more
than one gene for local and long-distance transport. For example, in
the case of the DNA-containing geminiviruses, a dual shuttle gene
system mediates transit of single-stranded (ss) DNA from the nucleus,
through the cytoplasm, and into and across the plasmodesmata (28,
41). Two small proteins, p8 and p9, are required for systemic
infections of the cytoplasmically replicating carmoviruses
(29), and the tombusviruses have two nested genes (p19 and
p22) that function in different aspects of movement (55). The Tomato bushy stunt virus p22 protein appears to be the
functional analog of the TMV 30-kDa movement protein, whereas the p19
protein is dispensable for systemic movement in some host backgrounds but is required in other hosts (55). Additional complexity
and division of labor is observed among a diverse set of RNA viruses differing substantially in genome organization that encode movement proteins organized in a "triple gene block" (TGB). These proteins have homologs in monopartite potexviruses (30, 39) and
carlaviruses (51), bipartite benyviruses (18)
and pecluviruses (22), and tripartite hordeiviruses
(38, 56).
Barley stripe mosaic virus (BSMV) is the type member of the
hordeiviruses. The viral genome is composed of positive-sense ssRNA
divided into three components designated
,
, and
. The
and
RNAs are strictly required for replication, while RNA
is
required for cell-to-cell movement (27, 44). RNA
encodes a replicase protein,
a, that contains methyl transferase and helicase domains. RNA
is bicistronic and encodes a second replicase protein,
a, that is characterized by a polymerase (GDD) motif. The
second protein,
b, is expressed from a subgenomic (sg) RNA (20). This cysteine-rich protein is not required for
replication or cell-to-cell movement per se, but mutations within the
protein affect pathogenicity (12, 43).
RNA
encodes a 5'-proximal coat protein (CP) separated from
the TGB by a short intergenic region (19, 23). The TGB1
protein, formerly designated
b, is expressed from the 2.45-kb
sgRNA
1 (66). This 58-kDa TGB1 protein has been purified
from BSMV-infected barley and shown to bind ssRNA and double-stranded
RNA, to exhibit ATPase activity, and to bind nucleotides in vitro
(13). A helicase motif is also a prominent component of
TGB1, and mutations of conserved amino acids within the motif abrogate
cell-to-cell movement (27); however a variety of assays
have failed to detect helicase activity in vitro (13). The
remaining TGB proteins are expressed from the low-abundance
960-nucleotide sgRNA
2 (66). TGB2, a 14-kDa protein
(formerly designated
d), and its low-abundance 23-kDa translational
read-through protein, TGB2' (formerly designated
d'), are translated
by ribosomes initiating at the first AUG of sgRNA
2. The 17-kDa TGB3
protein (formerly designated
c) is expressed via leaky scanning
through the TGB2 AUG codon of sgRNA
2 (66). Sequence
analyses predict that both the TGB2 and TGB3 proteins are membrane
associated, as they contain two hydrophobic membrane-spanning domains
separated by a hydrophilic region (38, 56). Subcellular
fractionation studies have also shown that TGB2 and its read-through
extension, TGB2', are associated with membrane and cell wall fractions
(14, 66). Infectivity results clearly demonstrate that the
TGB1, TGB2, and TGB3 proteins are each required for cell-to-cell
movement in both monocot and dicot hosts (27). These
results are similar to and extend those obtained with the potexviruses
White clover mosaic virus (2, 30) and Potato virus X (PVX) (60), the benyvirus
Beet necrotic yellow vein virus (BNYVV) (4,
18), and the pecluvirus Peanut clump virus (PCV)
(22).
Only limited information is available to describe long-distance
movement processes whereby viruses enter, navigate and exit the
vascular system, but the mechanisms required for these events appear to
be distinct from those required for cell-to-cell movement processes
(7, 32). For example, efficient long-distance transport of
TMV requires the CP in addition to the 30-kDa protein
(40). However, a limited number of viruses encoding
different classes of movement protein genes can establish efficient
local and systemic infections in the absence of the CP. In the
prototypical case of Tobacco rattle virus (6)
and other tobraviruses encoding a single movement protein (5,
33), the CP is dispensable for long-distance movement. Other
examples where local and long-distance transit do not require the CP
have been reported among members of the tombusviruses (9,
54).
Considerable variation in the requirements for the CP for local and
long-distance movement also exists among those viruses that require the
TGB proteins for movement. In the case of BSMV, the CP is dispensable
for cell-to-cell and systemic movement (27, 44).
Similarly, the CP is dispensable for cell-to-cell movement of BNYVV
(15) and PCV (22) and for systemic movement
of the pomovirus Potato mop top virus (PMTV)
(34). However, unlike BSMV and PMTV, the CP is required
for vascular transport of BNYVV (53) and PCV
(22). In contrast, potexviruses have an absolute requirement for the CP for cell-to-cell movement (30, 52). To begin to define the cellular interactions during the movement of
BSMV, we have constructed green fluorescent protein (GFP) fusions to
the amino terminus of TGB1 and have used these reporter derivatives to
assess expression patterns and subcellular localization during cell-to-cell movement. In addition, protoplast experiments have been
conducted to evaluate the roles of TGB2 and TGB3 in subcellular targeting of TGB1.
 |
MATERIALS AND METHODS |
Recombinant plasmids.
Full-length
,
(
42SpI), and
(
42) cDNA clones derived from the BSMV ND18 strain
(45) were used in this study. GFP was expressed from the
cDNA clone as a
b-GFP fusion (27). Several site-directed mutations (25) described below were
introduced into
42SpI or B7, a mutant of
42SpI that lacks the AUG
of the CP (
a) gene (47).
Additional cDNA clones containing mutations in the RNA
TGB were used
in various experiments. The 
2.0 cDNA clone
contains a 200-amino-acid deletion in TGB1 (47), the
Cla cDNA clone alters two amino acids
(K11
N and Y12
R)
in TGB2 (47), and the
c-stop cDNA clone introduces a
UAA at codon 72 in TGB3 (27). The
cDNA clones that
contained mutations in the helicase domain of
b resulted in the
following amino acid changes: K275
R (M1);
K275
A (M2); D826 and
E827
N and Q (M3);
G848, D849, and
Q852
A, N, and E (M4);
R377
A (M5); Q462 and
G463
E and A (M6); R492
A (M7); and R377 and
R492
A and A (M5/M7) (13).
To generate the GFP-TGB1 fusion protein, NheI sites
(indicated in boldface) were engineered directly after the start codon of TGB1 in
42SpI by site-directed mutagenesis using the primer
b5'NheI (5' CTTTAGCCATGGCTAGCACGAAAACTG
3') to generate
42SpI.NheI. The GFP clone pRSGFP-C1
(Clontech, Palo Alto, Calif.) was modified to incorporate
NheI sites at the 5' and 3' termini by PCR using the primers
GFP5'NheI (5' GGCGCTAGCAGTAAAGGAGAAGA 3') and GFP3'NheI (5'
CCGGCTAGCTTTGTATAGTTCATC 3'). The PCR product was
digested with NheI prior to ligation into
NheI-linearized
42SpI.Nhe. The resulting cDNA
clone,
.GFP:TGB1, contained the GFP sequence fused in frame to
generate a reporter gene for use in expression and cytological
experiments. For some experiments, the TGB1 gene in the CP-deficient
variant B7 was replaced with the GFP-TGB1 gene from
.GFP:TGB1 by
digestion and fragment substitution into the XbaI and
SpeI sites to generate
7.GFP:TGB1. These GFP derivatives
produced fusion proteins exhibiting a red-shifted excitation peak with
increased signal intensity.
Inoculation and treatment of plants and protoplasts.
RNA
,
-
, and -
transcripts prepared as described previously were used
to inoculate barley (Hordeum vulgare), Chenopodium amaranticolor, and Nicotiana benthamiana plants
(46) or to transfect protoplasts from the BY-2
Nicotiana tabacum cell suspension culture (62).
Transfected protoplasts were incubated with cytochalasin D (25 µg/ml)
or subjected to a cold treatment prior to being aldehyde fixed and
visualized by epifluorescence microscopy (36). The protoplasts were also stained at 24 h posttransfection by
incubation in fresh medium containing 10 µM ER-tracker blue-white DPX
(Molecular Probes, Eugene, Oreg.) or 0.1 µM rhodamine B hexyl ester
(Molecular Probes) for 30 min, transferred to fresh medium without the
marker dyes, and visualized under epifluorescence microscopy.
Protein and RNA analyses.
Infected leaves or protoplasts
were harvested, extracted, and separated on sodium dodecyl sulfate
(SDS)-polyacrylamide gels prior to Western blot serological analysis
(14). RNA was extracted, separated on 1% agarose gels,
blotted onto nylon membranes, and hybridized with
32P-labeled
-specific or
-specific probes
as described previously (66).
GFP fusion protein expression and immunofluorescence.
GFP
expression was visualized by excitation at 450 to 490 nm and emission
at 520 nm using a Zeiss Axiophot (Thornwood, N.Y.) microscope. Computer
images were acquired with an Optronics 450 Color charge-coupled device
camera and captured at high resolution by using a Scion CG-7 RGB
framegrabber board or photographed with Kodak color film.
Figures were assembled using Canvas (Deneba Software, Miami, Fla.) and
Adobe Photoshop (Adobe Systems Inc., San Jose, Calif.) software. For
immunofluorescence, protoplasts were fixed with aldehyde prior to
incubation for 1 h at 4°C with a TGB1 polyclonal mouse antibody
(1:500 dilution) (35). Following incubation, the
protoplasts were washed with phosphate-buffered saline (10 mM
phosphate, pH 7.4, 150 mM NaCl) and incubated with a 1:30 dilution of
fluorescein-conjugated goat anti-mouse immunoglobulin G (Calbiochem,
San Diego, Calif.) for 30 min at 4°C. Residual nonspecific
fluorescence was removed by a second phosphate-buffered saline wash
prior to microscopic observation.
 |
RESULTS |
BSMV GFP-TGB1 reporter virus moves efficiently in monocot and dicot
hosts.
To examine the interactions of BSMV TGB1 during infection
of plants and protoplasts, we engineered an amino-terminal fusion of
the GFP reporter gene to TGB1 (Fig. 1A).
Fusions were constructed in both wild-type RNA
(
.GFP:TGB1) and in
the RNA
mutant B7 (B7.GFP:TGB1), in which CP expression had been
eliminated. The
.GFP:TGB1 and B7.GFP:TGB1 derivatives were designed
as alternatives to facilitate comparisons of the movement of BSMV
reporters in different genetic backgrounds and to provide a
high-resolution marker for subcellular localization of GFP-TGB1 during
cell-to-cell movement. When the
.GFP:TGB1 (CP-expressing) and
B7.GFP:TGB1 (inactivated CP) RNAs were cotransfected with wild-type
RNA
and -
into BY-2 tobacco protoplasts, RNA blotting revealed
that the
.GFP:TGB1 and B7.GFP:TGB1 RNA accumulation was reduced by
more than 50% compared to levels of wild-type RNA
or B7 RNA
(Fig. 1B). To determine whether these decreases in abundance were due to a general reduction in total viral RNA replication, the RNA blots
were stripped and reprobed with a
-specific probe (Fig. 1B). Some
batch-to-batch sample variation was observed between electroporated
protoplasts. However, RNA blots hybridized with
- and
-specific
probes revealed that similar levels of variation were observed in
comparisons of RNA
and sgRNA
with the wild-type
or B7 RNAs
and wild-type
or B7 RNAs that contained the GFP-TGB1 sequence (Fig.
1B). These results indicate that the smaller amounts of the
.GFP:TGB1 and B7.GFP:TGB1 RNAs are specifically correlated with
reduced RNA
replication rather than reduced viral replication. However, the GFP fusions were expressed to easily detectable levels in
protoplasts with antisera raised to either TGB1 or GFP (Fig. 1C).

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 1.
GFP-TGB1 fusion protein expression in BY-2 protoplasts.
(A) Diagram of GFP fused to TGB1 in the RNA or the B7 RNA in which
the CP AUG codon was destroyed (*) showing the relative size of the two
sgRNAs. (B) Hybridization patterns of RNA from protoplasts transfected
with BSMV RNAs at 22 h p.i. The RNAs were separated on agarose
gels and blotted onto nylon membranes prior to being hybridized with a
32P-labeled -specific probe or a 32P-labeled
-specific probe. Lane 1, mock transfection (M); lane 2, , (+cp), and RNAs; lane 3, , B7 ( cp), and RNAs; lane 4, ,
.GFP:TGB1 (+cp), and RNAs; lane 5, , B7.GFP:TGB1 ( cp), and
RNAs. Note that the genomic (g) RNA is somewhat obscured by
rRNAs, but the sgRNA is clearly visible. (C) Proteins from
protoplasts transfected with BSMV RNAs at 22 h p.i. Extracts were
separated on an SDS-10% (wt/vol) polyacrylamide gel prior to
immunoblotting with antiserum raised to TGB1 or GFP. Lane 1, mock
inoculation (M); lanes 2 and 4, protoplasts transfected with ,
.GFP:TGB1 (+cp), and RNAs; lanes 3 and 5, protoplasts
transfected with , B7.GFP:TGB1 ( cp), and RNAs; lanes 1, 2, and
3, protoplasts harvested at 19 h posttransfection; lanes 4 and 5, protoplasts harvested at 26 h posttransfection.
|
|
For infectivity comparisons of the GFP-TGB1 fusion and wild-type TGB1,

and

RNAs plus the

.GFP:TGB1 RNA (CP-expressing
background)
or wild-type

RNA were inoculated onto
C. amaranticolor,
barley, or
N. benthamiana. Our previous observations of
systemic
symptom development and lesion formation indicated that the

b-GFP
derivative was not noticeably compromised in movement compared
to wild-type BSMV (
27). However, the GFP-TGB1 derivative
exhibited
a 12- to 24-h delay over the normal 4 to 7 days required for
symptom
appearance in barley,
C. amaranticolor, and
N. benthamiana. In
addition, the disease phenotype was attenuated in
N. benthamiana (not shown). We believe that these minor
effects on symptom development
are a consequence of the reduced
level of viral replication that
was observed in protoplasts (Fig.
1B).
Nevertheless, these results
suggest that the GFP-TGB1 fusion has
relatively minor effects
on the initial infection events and provides a
useful tool for
analysis of a variety of events involved in the early
stages of
BSMV
infection.
CP expression affects the virulence of the TGB1 reporter
derivatives.
We previously observed similar timing of infection in
comparisons of the wild-type BSMV (RNA
) and its RNA
B7
CP
derivative (47). To investigate
whether the TGB1 fusions affected the infection phenotype, comparisons
were carried out with the RNA
(CP-expressing) and the B7
(inactivated CP) GFP-TGB1 derivatives. These comparisons revealed that
the appearance of local lesions in C. amaranticolor was
delayed between 24 and 36 h in the GFP-TGB1 B7 background, and
these lesions were approximately 50% smaller at 6 days postinoculation
(p.i.) (Fig. 2A and B). In addition, the
lesions failed to spread and coalesce, and the infected leaves did not
undergo abscission by 14 days p.i. as normally occurs in wild-type
infections (43). In barley and N. benthamiana, a 36- to 72-h delay in development of systemic symptoms was also observed, but otherwise the infection phenotype appeared to be typical
of GFP-TGB1 in a CP-expressing background and of wild-type virus
infections (data not shown). These results suggest that even though the
GFP-TGB1 derivatives are able to establish systemic infections in the
absence of the CP, subtle interactions requiring the CP promote optimal
efficiency of both cell-to-cell and systemic movement.

View larger version (79K):
[in this window]
[in a new window]
|
FIG. 2.
Symptom phenotype and protein expression in infections
with .GFP:TGB1 or B7.GFP:TGB1. (A and B) C.
amaranticolor leaves inoculated with and .GFP:TGB1 (CP+)
or B7.GFP:TGB1 (CP ) and RNAs at 6 days p.i. (C) Proteins from
infected plants separated on an SDS-10% (wt/vol) polyacrylamide gel
prior to immunoblotting with antiserum raised to TGB1 or GFP. Lane 1, plants infected with , , and RNAs; lanes 2, 4, 6, and
8, plants infected with , .GFP:TGB1, and RNAs (I);
lanes 3, 5, 7, and 9, mock-infected plants (M). Lanes 1, 2, 3, 4, and
5, barley; lanes 6 and 7, N. benthamiana; lanes 8 and 9, C. amaranticolor.
|
|
Dicot and monocot hosts differ in the expression patterns of
GFP-TGB1.
For infectivity comparisons, the wild-type
RNA or
.GFP:TGB1 RNA (CP-expressing background) and the
and
RNAs
were inoculated onto C. amaranticolor, N. benthamiana, and barley. As was previously described in detail
(27), the initial infection events differed markedly
in the monocot host and the dicot hosts. The accumulation of the fusion
proteins was first examined by analysis of protein extracted from
infected leaves. The GFP-TGB1 fusion protein was detected in C. amaranticolor, N. benthamiana, and barley by using antiserum raised against the GFP or TGB1 protein (Fig. 2C).
The localization of TGB1 during the infection of
C. amaranticolor leaves was followed for 7 days after inoculation
with wild-type

and

RNAs and

.GFP:TGB1 RNA. In time course
observations at
24 h p.i., distinct bright-green fluorescence foci
composed of
two to five epidermal cells could be identified (Fig.
3A). By
48 h p.i., the
foci had increased to encompass 8 to 12 epidermal
cells (Fig.
3B), and by 120 h p.i., GFP expression could be
clearly
observed in several hundred epidermal cells (Fig.
3C). At this
time, the first signs of lesion development were detected by
bright-field
microscopy (data not shown), and a small region of
bright-yellow
fluorescence corresponding to the developing water-soaked
regions
appeared in the centers of the lesions (Fig.
3C). Green
fluorescence
could also be observed in the mesophyll cells below the
infected
epidermal cells, but the three-dimensional movement kinetics
were
not carefully monitored. During spread of the infection foci,
GFP-TGB1 exhibited a distinct temporal gradient of intense fluorescence
associated with the outer ring of the developing foci, with a
considerable reduction of intensity towards the centers of the
lesions
(Fig.
3C). These results contrast markedly with

b-GFP
fluorescence
(compare Fig.
3C and D), which, as previously described,
has a uniform
pattern of fluorescence throughout the foci (
27).

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 3.
Localization of GFP-TGB1 fusion protein in
developing infection foci in leaves. (A) Inoculated leaf of C.
amaranticolor at 24 h p.i. Bar = 25 µm. (B)
Inoculated leaf of C. amaranticolor at 48 h p.i.
Bar = 25 µm. (C) Inoculated leaf of C.
amaranticolor at 96 h p.i. Note that the center of the
lesion is necrotic and that GFP fluorescence is intense at the
periphery of the foci some distance away from the necrotic center.
Bar = 50 µm. (D) Inoculated leaf of C.
amaranticolor with , , and b-GFP RNAs at 96 h
p.i. Bar = 50 µm. (E and F) Epidermal C.
amaranticolor cells at the outer edge of the infection ring at
72 h p.i. Bar = 50 µm. Inset, bar = 5 µm. Note the
paired punctate foci appressed along the cell walls. (G) Inoculated
leaf of N. benthamiana at 5 days p.i. Bar = 50 µm. (H) Epidermal N. benthamiana cells at 6 days p.i.
Bar = 50 µm. Inset, bar = 5 µm. (I) Inoculated barley
leaf at 72 h p.i. Bar = 100 µm. (J) Systemically infected
barley leaf at 96 h p.i. Bar = 200 µm.
|
|
Throughout the time course of lesion formation in
C. amaranticolor, GFP-TGB1 exhibited a diffuse fluorescence within
cells
that appeared to be associated with membranes, and intense
punctate
regions of fluorescence occurred at various intervals along
the
cell walls (Fig.
3A, B, E, and F). Towards the leading edge of
the
developing lesions, fluorescence often extended across the
walls into
adjacent cells to produce paired punctate foci (Fig.
3F). To ensure
that the localization patterns of GFP-TGB1 in
C. amaranticolor were not artifacts resulting from damaged cells
undergoing lesion formation, fluorescence was also examined in
the
systemic hosts,
N. benthamiana and barley. In
N. benthamiana,
green fluorescence was readily observed in the
initially infected
cells by 24 h p.i., and this was followed by
radial expansion
into adjacent cells (Fig.
3G). This movement pattern
was noted
previously in
N. benthamiana infections with the

b-GFP reporter
virus (
27). However,

b-GFP exhibited
uniform fluorescence in
the developing foci within 3 to 4 days p.i.,
but with GFP-TGB1,
fluorescence was most intense along the leading
edges of the infections
(Fig.
3G), as was also the case in
C. amaranticolor (Fig.
3C).
GFP-TGB1 fluorescence was also intense at
punctate foci that frequently
appeared to traverse the epidermal cell
walls of
N. benthamiana (Fig.
3H). By 11 days p.i., GFP-TGB1
fluorescence moved into uninoculated
N. benthamiana leaves
and exited from the veins (not shown). However,
the fluorescence of GFP
was erratic and was less intense in leaves
developing systemic symptoms
than in the inoculated leaves. This
indicates that as infection
progresses the GFP-TGB1 fusion becomes
increasingly less stable as the
virus moves into the uninoculated
leaves. In this regard, immunoblot
analysis of protein extracts
from uninoculated
N. benthamiana leaves revealed the presence
of the full-length
GFP-TGB1 fusion protein, but forms with deletions
could be detected in
different samples at various levels (data
not
shown).
In barley, the GFP-TGB1 fluorescence patterns were quite different from
those observed in the dicot hosts. GFP fluorescence
was first detected
between 72 and 96 h p.i. in the inoculated
barley leaves (Fig.
3I), as was previously observed with the

b-GFP
reporter virus
(
27). By 96 h p.i., fluorescence was also observed
as
a diffuse signal in the systemically infected leaves (Fig.
3J).
However, the punctate foci noted along the cell walls of
C. amaranticolor and
N. benthamiana were not detected in
barley,
despite extensive searches for their presence (Fig.
3I and J).
These host-specific patterns occurring between dicot and monocot
hosts
complement and extend those previously noted with

b-GFP
(
27).
Because the experiments described earlier suggest that the CP might
affect the kinetics of cell-to-cell movement, we compared
the
localization of GFP-TGB1 in
C. amaranticolor,
N. benthamiana,
and barley infected with RNA

and -

plus

.GFP:TGB1 (CP-expressing)
RNA with that of RNA

and -

plus
B7.GFP:TGB1 (CP-deficient) RNA.
These comparisons revealed no
discernible differences in the localization
of GFP-TGB1 in the
CP
+ and CP

backgrounds in
any of these hosts (data not shown). However,
the spread of
fluorescence in the GFP-TGB1 CP-deficient foci appeared
to be delayed
by approximately 24 to 72 h in these hosts. In addition,
in
C. amaranticolor, smaller lesions appeared in the
CP-deficient
infections (Fig.
2B). These results suggest that the
reductions
in the appearance of systemic symptoms in the absence of the
CP
(B7 background) when the GFP gene is fused to TGB1 may be a
consequence
of a slightly reduced efficiency of cell-to-cell
movement.
TGB1 is associated with membranes.
The subcellular
compartmentation of GFP-TGB1 was investigated at higher resolution by
inoculating BY-2 protoplasts with wild-type
and
RNAs plus the
.GFP:TGB1 RNA. GFP fluorescence first appeared 19 to 21 h p.i.
and was localized to membranes around the nucleus (Fig.
4A, C, and D) and to discrete foci at the
plasma membrane (Fig. 4B, C, and D). In the subsequent 18 h,
little alteration in the localization of fluorescence was observed. To
confirm that the GFP fusion had no effect on the localization of TGB1,
immunofluorescence of BSMV-infected BY-2 protoplasts was evaluated with
antiserum raised against the TGB1 protein. At 18 h p.i., antibody
fluorescence against the unfused TGB1 protein was primarily localized
to membranes surrounding the nuclei (Fig. 4E), and by 24 h p.i.,
bright spots of antibody fluorescence were also evident at the plasma
membrane (Fig. 4F). The foci present at the plasma membrane were
slightly more diffuse in protoplasts following immunofluorescence than was GFP fluorescence observed in GFP-TGB1-infected protoplasts. This was due to fixation of the protoplasts prior to immunofluorescence in contrast to nonfixed GFP-fluorescing protoplasts. The punctate foci
at the plasma membrane appeared not to be associated with the presence
of remnants of the cell wall or with newly deposited cell wall
components because calcofluor white staining did not reveal any
residual cell wall material (data not shown). From these results, we
conclude that the subcellular localization patterns of the native TGB1
protein and the GFP-TGB1 fusion protein are indistinguishable.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 4.
Subcellular localization of GFP-TGB1 and b-GFP in
BY-2 tobacco protoplasts. The protoplasts were transfected with BSMV
RNAs and examined at 18 to 24 h p.i. (A to D) Protoplasts
transfected with , .GFP:TGB1, and RNAs and examined at
22 h p.i. Protoplasts under bright-field illumination (A) and GFP
fluorescence (B, C, and D) are shown. Note that panel B is focused on
the cell surface and the GFP fluorescence is localized to punctate foci
associated with the plasma membrane, while panels C and D are focused
on the interior of the cell and GFP fluorescence is accentuated at
perinuclear membranes. (E and F) Protoplasts transfected with , ,
and RNAs and fixed at 18 (E) or 24 (F) h p.i. and then subjected to
immunofluorescence with antiserum raised to the TGB1 protein. (G)
Protoplasts transfected with , , and b-GFP RNAs and examined
at 22 h p.i. (H) Protoplasts transfected with PVX KDEL-GFP at
24 h p.i. (I and J) Protoplasts transfected with ,
.GFP:TGB1, and RNAs and treated with rhodamine B hexyl ester
chloride R6 at 22 h p.i. and examined using the fluorescein
isothiocyanate (FITC) channel (I) or the rhodamine channel (J). (K and
L) Protoplasts transfected with , .GFP:TGB1, and RNAs,
treated with ER-tracker blue-white DPX at 22 h p.i., and examined
using the FITC channel (K) or the DAPI (4',6'-diamidino-2-phenylindole)
channel (L). Bar = 30 µm.
|
|
The localization of TGB1 in BY-2 protoplasts differed markedly from the
localization of the

b-GFP fusion protein following
transfection with

- and

b-GFP RNAs. In

b-GFP-infected protoplasts,
GFP
fluorescence was first observed at approximately 16 h p.i.
and
appeared to be generally distributed throughout the cytoplasm
with no
evidence of membrane associations (Fig.
4G). In particular,
the
fluorescence patterns were diffuse and punctate foci were
not observed
at the plasma membrane. Because the symptom phenotype
and the
fluorescence observed in plants infected with B7.GFP:TGB1
(no CP
expression) was delayed, the subcellular localization of
GFP-TGB1 was
also examined in the B7.GFP:TGB1 derivative. Failure
to express the CP
appeared to have no effect on the localization
of GFP-TGB1 to
perinuclear membranes or on the appearance of punctate
foci at the
plasma membranes of BY-2 protoplasts (data not shown),
although the
timing of the fluorescence was delayed between 3
and 4 h. This
delay in fluorescence does not appear to be due
to a decreased level of
replication, because the GFP-TGB1 RNA
abundance was not altered in the
presence or absence of the CP
(Fig.
1B).
The interactions of TGB1 with cytoplasmic structures in infected
protoplasts were assessed by use of cytochalasin D to disrupt
actin
filaments and treatment at 4°C to disassemble microtubules.
At 22 and
26 h p.i., cytochalasin D and cold treatments failed
to affect the
fluorescence patterns observed with untreated protoplasts
(data not
shown). Evidence for localization of GFP-TGB1 to the
endoplasmic
reticulum (ER) in BY-2 protoplasts was provided by
comparisons with the
distribution patterns of three ER markers.
In comparative observations,
the KDEL ER localization sequence
fused to GFP (KDEL-GFP) expressed
from PVX (provided by D. Baulcombe)
overlapped with the GFP-TGB1
signals (Fig.
4C, D, and H). Additional
tests were conducted by
treatment with the dye rhodamine B hexyl
ester chloride R6 or
ER-tracker blue-white DPX, each of which
localizes to ER
membranes. Again, the fluorescence of both the
rhodamine B hexyl ester
chloride R6 and the ER-tracker blue-white
DPX marker dyes coincided
with GFP-TGB1 in the protoplasts (Fig.
4I to L). Taken together, these
results provide substantial evidence
that GFP-TGB1 forms prominent
associations with the ER and that
cytoskeletal interactions, if
present, are relatively
minor.
Subcellular localization of GFP-TGB1 is affected by mutations in
the TGB1 helicase motif.
We previously noted that site-specific
mutations in the helicase domain of TGB1 prohibited cell-to-cell
movement of BSMV in planta (27). To ascertain whether
subcellular localization of GFP-TGB1 containing each of these helicase
mutations is altered, RNA
and -
and the individual
.GFP:TGB1
derivatives containing mutations (M1, M2, M3, M4, M5, M6, M7, and M5/M7
[Fig. 5A]) in each of the six conserved
motifs of the helicase domain were used to transfect BY-2 protoplasts.
Each of these mutants exhibited pronounced alterations in the
subcellular localization of GFP-TGB1. In most cases, fluorescence of
the mutant fusion proteins was associated with the plasma membrane and
ER membranes surrounding the nucleus, but the proportion of
protoplasts exhibiting punctate foci at the plasma membrane declined
precipitously (eightfold or more) compared to wild-type GFP-TGB1 (Table
1; Fig. 5B to D). In each case,
full-length GFP-TGB1 fusion protein was found to be expressed in these
protoplasts by Western blot analyses using antiserum raised against GFP
(Fig. 5E) or TGB1 (data not shown).

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 5.
Effects of mutations in the TGB1 helicase domain and the
TGB2 and TGB3 proteins on subcellular localization of GFP-TGB1 in BY-2
protoplasts. (A) Amino acid sequence of the helicase domain in TGB1.
The overlined amino acids labeled I to VI indicate the conserved
regions that define the helicase motif (24). M1 to M7
indicate the positions of site-specific mutations engineered into these
regions. (B to D) and RNAs and a wild-type or mutant GFP:TGB1
RNA were transfected into BY-2 protoplasts and examined at 21 to
24 h p.i. (B) Wild-type GFP-TGB1 showing punctate foci; (C and D)
shift in fluorescence of GFP-TGB1 helicase mutants M5 (C) or M5/M7 (D)
away from punctate foci at the plasma membrane. Similar shifts were
noted with the M1, -2, -3, -4, -6, and -7 mutants. (E) Immunoblot
analyses of proteins from mock-transfected protoplasts (M) or
protoplasts transfected with and RNAs and a wild-type (wt) or a
mutant GFP-TGB1 RNA (M1, -2, -3, -4, -5, -6, -7, and M5/M7) at 24 h p.i. Immunoblots were probed with antiserum raised to GFP. (F to H)
RNAs and and GFP-TGB1 expressing TGB2 and TGB3 (F and G) or
GFP-TGB1 that did not express the TGB2 and TGB3 proteins (H) were
transfected into BY-2 protoplasts and examined at 21 to 24 h p.i.
Bar = 30 µm.
|
|
TGB2 and TGB3 facilitate localization of TGB1 to the plasma
membrane.
To investigate the effects of the TGB2 and TGB3 proteins
on the subcellular localization of GFP-TGB1, RNA
and -
plus
.GFP:TGB1 RNA unable to express TGB2 and TGB3 were transfected into
BY-2 protoplasts, and the localization of GFP-TGB1 was monitored by fluorescence microscopy at 22 to 24 h. Protoplasts transfected with the TGB2- and TGB3-deficient derivative exhibited a diffuse GFP-TGB1 fluorescence associated with the perinuclear ER and a drastic
shift of fluorescence away from the plasma membrane (Table 2; Fig. 5F, G, and H). Similar results
were obtained with derivatives expressing only TGB2 or TGB3 (data not
shown).
 |
DISCUSSION |
To examine the initial phases of infection of BSMV in
monocots and dicots, we have constructed GFP fusions with TGB1 and
b (27). These fusions each provide reliable indicators of
the early stages of virus movement, and the GFP-TGB1 results verify and
extend the differences shown by
b-GFP during infections of dicot and monocot hosts. In dicot hosts, infections typically spread as
circular-to-oval foci through several parenchyma cells separating
the reticulate vascular tissue. In contrast, in the monocot host,
single cells exhibiting green fluorescence were extremely rare, and
infections quickly reached the vascular system and spread throughout
the plant.
In dicots, GFP-TGB1 fluorescence was observed by 24 h p.i. in the
ER and pronounced punctate foci formed along the cell walls. GFP-TGB1
also exhibited a temporal pattern of expression in dicots, as has been
reported for the 42-kDa BNYVV TGB1 protein (15) and the
TMV 30-kDa protein (42). This differs markedly from the
constitutive cytosolic localization of
b-GFP (27). The temporal expression of the TMV movement protein, P30-GFP, in N. benthamiana has been previously attributed to both enhanced
protein degradation and decreased expression near the centers of the
foci (42, 59). We have no direct evidence to determine
whether TGB1 turns over more rapidly than
b following the initial
burst of synthesis. Previous time course studies of RNA synthesis in barley protoplasts suggest that the temporal
b expression may in
part be a consequence of early expression of sgRNA
1
(67; cf. Fig. 1). In this case, sgRNA
1 appeared to
reach maximum abundance by 12 h p.i., whereas the genomic RNAs and
sgRNA
continued to increase in abundance throughout the 24-h period
of analysis.
Infections in barley differed markedly from those of the dicot hosts in
the timing of GFP-TGB1 fluorescence and in the patterns of expression
in infected cells. GFP-TGB1 fluorescence was not evident until 72 h p.i., and no punctate foci were detected in the mesophyll or
epidermal cells of infected barley leaves. GFP-TGB1 fluorescence also
appeared to be relatively consistent throughout the infected tissue and
could be observed for at least 7 days p.i. This suggests that GFP-TGB1
has different patterns of expression and localization in monocot and
dicot cells during the initial stages of infection. However, additional
experiments are required to determine whether these differences result
from primary adaptations to barriers to cell-to-cell movement presented
by monocots and dicots or whether they represent indirect host-specific
events of little consequence to cell-to-cell movement per se.
Interestingly, the BSMV 58-kDa TGB1 protein and the TGB1 proteins from
BNYVV (42 kDa), PCV (51 kDa), and PMTV (51 kDa) have variable
amino-terminal extensions that are absent in the smaller (24- to
28-kDa) TGB1 proteins of the potexviruses. At present, the roles of
these amino-terminal extensions of the hordeivirus, benyvirus,
pecluvirus, and pomovirus TGB1 proteins is unclear. In particular, our
lack of knowledge of the significance of these regions is highlighted
by findings that in vitro RNA binding by the 42-kDa TGB1 protein of
BNYVV (3) maps to the first 24 amino acids but,
surprisingly, that site-specific mutations of the basic residues in
this region fail to disrupt cell-to-cell movement (15). In
contrast, mutagenesis experiments indicate that several regions of the
BSMV TGB1 protein function in RNA binding. The amino-terminal region of
the TGB1 protein contains elements that contribute to double-stranded
RNA versus ssRNA binding in vitro (13), but the functions
of these regions in RNA binding in vivo have not been evaluated.
However, several deletions affecting RNA binding also compromise
cell-to-cell movement (27). The amino-terminal extensions
of the larger TGB1 proteins may be able to compensate in part for
requirements for the CP for cell-to-cell movement of those viruses
containing a smaller TGB1 protein. Analysis of the TGB1 genes of
benyviruses, carlaviruses, hordeiviruses, pecluviruses, pomoviruses,
and potexviruses suggests that these genes may have evolved from a
common progenitor, based on the conservation of the helicase domain
present in these proteins (63). However, it is also
possible that during the course of evolution, the TGB1 proteins of
BSMV, BNYVV, PCV, and PMTV may have acquired amino-terminal functions
from diverse sources that permitted them to dispense with a CP
requirement for cell-to-cell movement. Alternatively, the larger TGB1
proteins may have retained some functions that the potexvirus TGB1
proteins have lost.
The 42-kDa BNYVV (15) and 51-kDa PCV (16)
TGB1 proteins are similar to the BSMV TGB1 protein in that they form
punctate foci at the cell walls of infected dicot leaf cells.
Specifically, the BNYVV (15) and PCV (16)
TGB1 proteins localize to plasmodesmata, while the BSMV TGB1 foci are
often present as paired foci that appear to traverse the walls of
adjacent cells. This localization pattern contrasts with that of the
smaller TGB1 proteins of the potexviruses Bamboo mosaic
virus (8), Foxtail mosaic virus (50), and PVX (10) that do not localize to
the cell walls in infected cells. In this regard, the potexvirus TGB1
proteins exhibit subcellular localization patterns more typical of BSMV in barley. From these results, it is evident that the TGB1-encoded proteins of hordeiviruses, benyviruses, pecluviruses, and the potexviruses differ substantially in several aspects of their function
and interactions. However, the host-specific differences in cell wall
associations of the BSMV TGB1 protein in monocots versus dicots
complicates straightforward interpretation of results based on
cytological analyses in a single host. Therefore, it is evident that
more detailed analyses of TGB activities in a variety of hosts are
needed to elucidate nuances of the movement processes of these viruses.
The patterns of localization of GFP-TGB1 in cells of infected plants
and in protoplasts were similar in that GFP-TGB1 formed punctate foci
at the cell walls and at the plasma membrane, respectively. These foci
could possibly have been associated with remnants of the cortical ER at
sites where the cell wall was attached. However, the foci apparently do
not colocalize with cell wall fragments because calcofluor white
staining failed to reveal such remnants in the vast preponderance of
infected cells. The protoplast localization studies also revealed an
association of TGB1 with ER membranes located in close proximity to the
nucleus in the absence of TGB2 and TGB3. However, our examination of
the TGB1 sequence failed to reveal known ER signal sequences. Even
though BSMV TGB1 does not form substantial interactions with
cytoskeletal components, its membrane associations appear to be similar
to those of the TMV P30 movement protein, which behaves as an integral
ER membrane protein (21, 48) despite the lack of known ER
retention sequences. Although the exact mechanisms of TMV P30 and BSMV
TGB1 membrane associations have not yet been resolved, it is possible
that TGB1 ER localization may be mediated by interactions with host
proteins that serve to target the movement protein. In this regard, a
host transmembrane protein, TOM1, has been identified in
Arabidopsis thaliana that interacts with the helicase domain
of the TMV replicase, suggesting that this protein may function as an
ER membrane anchor for the replicase (64). Although our
individual helicase mutations argue against direct helicase domain
interactions, multiple host contact sites might exist within the protein.
We have previously demonstrated that site-specific mutations introduced
into each of the six conserved helicase motifs of the TGB1 protein
abrogate cell-to-cell movement (27). Therefore, even
though we were unable to detect helicase activity in vitro using
purified TGB1 protein (13), each conserved element in the
helicase domain is critical for cell-to-cell movement
(27). Moreover, in infected protoplasts, a series of
mutations in the TGB1 helicase motif each shifted the subcellular
localization of GFP-TGB1 away from the plasma membrane. The mutant
GFP-TGB1 proteins showed a much lower proportion of punctate foci at
the plasma membrane than the wild-type protein, but the mutants still exhibited an intense membrane fluorescence. These results suggest that
the helicase motif may also function to facilitate plasmodesmal interactions with TGB2 and TGB3, or with host proteins required for
plasmodesma associations. The fact that both TGB2 and TGB3 are required
for formation of punctate plasma membrane foci favors a model wherein
TGB2, TGB3, or both proteins interact directly with TGB1. Our ongoing
studies of the interactions of these proteins with a ribonucleoprotein
complex formed in planta (D. M. Lawrence, J. Yu, and A. O. Jackson, unpublished data) may provide additional details to
clarify this model.
Several lines of evidence also indicate that interactions of the TGB
proteins of other viruses are required for cell-to-cell movement. For
example, like BSMV, the TGB1 protein of BNYVV fails to form punctate
foci at the cell walls of infected Chenopodium quinoa
leaf cells in the absence of the TGB2 and TGB3 proteins (15). The PCV TGB1 protein is also associated with
plasmodesmata in infected cells, but when TGB1 is expressed in
transgenic plants, it is not localized to plasmodesmata until after
virus infection (16). The TGB1 protein of PVX is able to
move from cell to cell when expressed alone but is restricted to single
cells when expressed in the presence of TGB2 and TGB3 or the CP,
suggesting that the TGB functions may be facilitated by direct
interactions (65). Interestingly, the relative levels of
expression of the TGB2 and TGB3 proteins of BNYVV also appear to be
important for cell-to-cell movement (4), and these results
may provide evidence for interactions of TGB2 and TGB3. However,
transient-expression experiments in epidermal leaf cells with the
hordeivirus Poa semilatent virus-encoded TGB2 and TGB3
proteins have been interpreted to suggest that these two proteins do
not form complexes, even though TGB3 assists in the targeting of TGB2
(58). Irrespective of the mechanistic aspects of movement,
the available results suggest the TGB proteins can function with
heterologous viruses. For example, it has been shown that limited
cell-to-cell movement functions of the BSMV TGB can be replaced by the
Poa semilatent virus TGB (57), and similar
experiments show that the BNYVV TGB can be replaced by the PCV TGB
(26). However, in the case of BNYVV, the individual TGB
proteins could not be replaced by their respective PCV homologs. Currently, we are conducting experiments to determine how interactions among the BSMV TGB1, -2, and -3 proteins function in the formation of
competent cell-to-cell movement complexes.
 |
ACKNOWLEDGMENTS |
We thank Jennifer Bragg, Michael Goodin, Jennifer Johnson, Robin
MacDiarmid, and Teresa Rubio for comments made on the manuscript. We
would also like to thank Steve Ruzin and Denise Schichnes at the CNR
Center for Biological Imaging at UC
Berkeley for assistance with
microscopy and image manipulation and Gail McLean for helpful suggestions about cytological localization experiments. The PVX vector
containing KDEL-GFP was kindly supplied by David C. Baulcombe.
This research was supported by USDA Competitive Grant 97-35303-4572 awarded to A.O.J.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Plant and Microbial Biology, 111 Koshland Hall, University of
California, Berkeley, CA 94720. Phone: (510) 642-3906. Fax: (510)
642-9017. E-mail: andyoj{at}uclink4.berkeley.edu.
 |
REFERENCES |
| 1.
|
Angell, S. M.,
C. Davies, and D. C. Baulcombe.
1996.
Cell-to-cell movement of potato virus X is associated with a change in the size exclusion limit of plasmodesmata in trichome cells of Nicotiana clevelandii.
Virology
216:197-201[CrossRef][Medline].
|
| 2.
|
Beck, D. L.,
P. J. Guilford,
D. M. Voot,
M. T. Andersen, and R. L. S. Forster.
1991.
Triple gene block proteins of white clover mosaic potexvirus are required for transport.
Virology
183:695-702[CrossRef][Medline].
|
| 3.
|
Bleystaken, C.,
D. Gilmer,
H. Guilley,
K. E. Richards, and G. Jonard.
1996.
The beet necrotic yellow vein virus 42 kDa triple gene block protein binds nucleic acids in vitro.
J. Gen. Virol.
77:889-897[Abstract/Free Full Text].
|
| 4.
|
Bleystaken-Grosshans, C.,
H. Guilley,
S. Bouzoubaa,
K. E. Richards, and G. Jonard.
1997.
Independent expression of the first two triple gene block proteins of beet necrotic yellow vein virus complements virus defective in the corresponding gene but expression of the third protein inhibits viral cell-to-cell movement.
Mol. Plant-Microbe Interact.
10:240-246.
|
| 5.
|
Boccara, M.,
W. D. O. Hamilton, and D. C. Baulcombe.
1986.
The organisation and interviral homologies of genes at the 3' end of tobacco rattle virus RNA1.
EMBO J.
5:223-229[Medline].
|
| 6.
|
Cadman, C. H.
1962.
Evidence for association of tobacco rattle virus nucleic acid with a cell component.
Nature
193:49-52[CrossRef][Medline].
|
| 7.
|
Carrington, J. C.
1999.
Reinventing plant virus movement.
Trends Microbiol.
7:312-313[CrossRef][Medline].
|
| 8.
|
Chang, B.-Y.,
N.-S. Lin,
D.-Y. Liou,
J.-P. Chen,
G.-G. Liou, and Y.-H. Hsu.
1997.
Subcellular localization of the 28 kDa protein of the triple gene-block of bamboo mosaic potexvirus.
J. Gen. Virol.
78:1175-1179[Abstract].
|
| 9.
|
Dalmay, T.,
L. Rubino,
J. Burgyan, and M. Russo.
1992.
Replication and movement of a CP mutant of cymbidium ringspot tombusvirus.
Mol. Plant-Microbe Interact.
5:379-383[Medline].
|
| 10.
|
Davies, C.,
G. Hills, and D. C. Baulcombe.
1993.
Sub-cellular localization of the 25 kDa protein encoded in the triple gene block of potato virus X.
Virology
197:166-175[CrossRef][Medline].
|
| 11.
|
Ding, B.
1998.
Intercellular protein trafficking through plasmodesmata.
Plant Mol. Biol.
38:279-310[CrossRef][Medline].
|
| 12.
|
Donald, R. G. K., and A. O. Jackson.
1994.
The barley stripe mosaic virus b gene encodes a multifunctional cysteine-rich protein that affects pathogenesis.
Plant Cell
6:1593-1606[Abstract].
|
| 13.
|
Donald, R. G. K.,
D. M. Lawrence, and A. O. Jackson.
1997.
The BSMV 58 kDa b protein is a multi-functional RNA binding protein.
J. Virol.
71:1538-1546[Abstract].
|
| 14.
|
Donald, R. G. K.,
H. Zhou, and A. O. Jackson.
1993.
Serological analysis of barley stripe mosaic virus-encoded proteins in infected barley.
Virology
195:659-668[CrossRef][Medline].
|
| 15.
|
Erhardt, M.,
M. Morant,
C. Ritzenthaler,
C. Stussi-Garaud,
H. Guilley,
K. E. Richards,
G. Jonard,
S. Bouzoubaa, and D. Gilmer.
2000.
P42 movement protein of beet necrotic yellow vein virus is targeted by the movement proteins P13 and P15 to punctate bodies associated with plasmodesmata.
Mol. Plant-Microbe Interact.
13:520-528[Medline].
|
| 16.
|
Erhardt, M.,
C. Stussi-Garaud,
H. Guilley,
K. E. Richards,
G. Jonard, and S. Bouzoubaa.
1999.
The first triple gene block protein of peanut clump virus localizes to the plasmodesmata during virus infection.
Virology
264:220-229[CrossRef][Medline].
|
| 17.
|
Fujiwara, T.,
D. Giesman-Cookmeyer,
B. Ding,
S. A. Lommel, and W. J. Lucas.
1993.
Cell-to-cell trafficking of macromolecules through plasmodesmata potentiated by the red clover necrotic mosaic virus movement protein.
Plant Cell
5:1783-1794[Abstract].
|
| 18.
|
Gilmer, D.,
S. Bouzoubaa,
A. Hehn,
H. Guilley,
K. Richards, and G. Jonard.
1992.
Efficient cell-to-cell movement of beet necrotic yellow vein virus requires 3' proximal genes located on RNA 2.
Virology
189:40-47[CrossRef][Medline].
|
| 19.
|
Gustafson, G., and S. L. Armour.
1986.
The complete nucleotide sequence of RNA from the type strain of barley stripe mosaic virus.
Nucleic Acids Res.
14:3895-3909[Abstract/Free Full Text].
|
| 20.
|
Gustafson, G.,
B. Hunter,
R. Hanau,
S. L. Armour, and A. O. Jackson.
1987.
Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA .
Virology
158:394-406[CrossRef][Medline].
|
| 21.
|
Heinlein, M.,
H. S. Padgett,
J. S. Gens,
B. G. Pickard,
S. J. Casper,
B. L. Epel, and R. N. Beachy.
1998.
Changing patterns of localization of the tobacco mosaic virus movement protein and replicase to the endoplasmic reticulum and microtubules during infection.
Plant Cell
10:1107-1120[Abstract/Free Full Text].
|
| 22.
|
Herzog, E.,
O. Hemmer,
S. Hauser,
G. Meyer,
S. Bouzoubaa, and C. Fritsch.
1998.
Identification of genes involved in replication and movement of peanut clump virus.
Virology
248:312-322[CrossRef][Medline].
|
| 23.
|
Jackson, A. O.,
B. G. Hunter, and G. D. Gustafson.
1989.
Hordeivirus relationships and genome organization.
Annu. Rev. Phytopathol.
27:95-121[CrossRef].
|
| 24.
|
Koonin, E. V., and V. V. Dolja.
1993.
Evolution and taxonomy of positive-strand RNA viruses: implications of comparative analysis of amino acid sequences.
Crit. Rev. Biochem. Mol. Biol.
28:375-430[Medline].
|
| 25.
|
Kunkel, T. A.
1985.
Rapid and efficient site-specific mutagenesis without phenotypic selection.
Proc. Natl. Acad. Sci. USA
82:488-492[Abstract/Free Full Text].
|
| 26.
|
Lauber, E.,
C. Bleykasten-Grosshans,
M. Erhardt,
S. Bouzoubaa,
G. Jonard,
K. E. Richards, and H. Guilley.
1998.
Cell-to-cell movement of beet necrotic yellow vein virus: I. Heterologous complementation experiments provide evidence for specific interactions among the triple gene block proteins.
Mol. Plant-Microbe Interact.
11:618-625[Medline].
|
| 27.
|
Lawrence, D. M., and A. O. Jackson.
2001.
Requirements for cell-to-cell movement of barley stripe mosaic virus in monocot and dicot hosts.
Mol. Plant Pathol.
2:65-75.
|
| 28.
|
Lazarowitz, S. G., and R. N. Beachy.
1999.
Viral movement proteins as probes for intracellular and intercellular trafficking in plants.
Plant Cell
11:535-548[Free Full Text].
|
| 29.
|
Li, W.-Z.,
F. Qu, and T. J. Morris.
1998.
Cell-to-cell movement of turnip crinkle virus is controlled by two small open reading frames that function in trans.
Virology
244:405-416[CrossRef][Medline].
|
| 30.
|
Lough, T. J.,
N. E. Netzler,
S. J. Emerson,
P. Sutherland,
F. Carr,
D. L. Beck,
W. J. Lucas, and R. L. S. Forster.
2000.
Cell-to-cell movement of potexviruses: evidence for a ribonucleoprotein complex involving the CP and first triple gene block protein.
Mol. Plant-Microbe Interact.
13:962-974[Medline].
|
| 31.
|
Lough, T. J.,
K. Shash,
B. Xoconostle-Cazares,
K. R. Hofstra,
D. L. Beck,
E. Balmori,
R. L. S. Forster, and W. J. Lucas.
1998.
Molecular dissection of the mechanism by which potexvirus triple gene block proteins mediate cell-to-cell transport of infectious RNA.
Mol. Plant-Microbe Interact.
11:801-814.
|
| 32.
|
Lucas, W. J., and S. Wolf.
1999.
Connections between virus movement, macromolecular signaling and assimilate allocation.
Curr. Opin. Plant Biol.
2:192-197[CrossRef][Medline].
|
| 33.
|
MacFarlane, S. A.,
S. C. Taylor,
D. I. King,
G. Hughes, and J. W. Davies.
1989.
Pea early browning virus RNA1 encodes four polypeptides including a putative zinc-finger protein.
Nucleic Acids Res.
17:2245-2260[Abstract/Free Full Text].
|
| 34.
|
McGeachy, K. D., and H. Barker.
2000.
Potato mop-top virus RNA can move long distance in the absence of CP: evidence from resistant, transgenic plants.
Mol. Plant-Microbe Interact.
13:125-128[Medline].
|
| 35.
|
McLean, B. G.,
F. D. Hempel, and P. C. Zambryski.
1997.
Plant intercellular communication via plasmodesmata.
Plant Cell
9:1043-1054[CrossRef][Medline].
|
| 36.
|
McLean, B. G.,
J. Zupan, and P. C. Zambryski.
1995.
Tobacco mosaic virus movement protein associates with the cytoskeleton in tobacco cells.
Plant Cell
7:2101-2114[Abstract].
|
| 37.
|
Mezitt, L. A., and W. J. Lucas.
1996.
Plasmodesmal cell-to-cell transport of proteins and nucleic acids.
Plant Mol. Biol.
32:251-273[CrossRef][Medline].
|
| 38.
|
Morozov, S. Y.,
V. V. Dolja, and J. G. Atabekov.
1989.
Probable reassortment of genomic elements among elongated RNA-containing plant viruses.
J. Mol. Evol.
29:52-62[CrossRef][Medline].
|
| 39.
|
Morozov, S. Y.,
O. N. Fedorkin,
G. Juttner,
J. Schiemann,
D. C. Baulcombe, and J. G. Atabekov.
1997.
Complementation of a potato virus X mutant mediated by bombardment of plant tissues with cloned viral movement protein genes.
J. Gen. Virol.
78:2077-2083[Abstract].
|
| 40.
|
Nelson, R. S., and A. J. E. van Bel.
1998.
The mystery of virus trafficking into, through and out of vascular tissue.
Prog. Bot.
59:476-533.
|
| 41.
|
Noueiry, A. O.,
W. J. Lucas, and R. L. Gilbertson.
1994.
Two proteins of a plant DNA virus coordinate nuclear and plasmodesmal transport.
Cell
76:925-932[CrossRef][Medline].
|
| 42.
|
Padgett, H. S.,
B. L. Epel,
T. W. Kahn,
M. Heinlein,
Y. Watanabe, and R. N. Beachy.
1996.
Distribution of tobamovirus movement protein in infected cells and implications for cell-to-cell spread of infection.
Plant J.
10:1079-1088[CrossRef][Medline].
|
| 43.
|
Petty, I. T. D.,
R. G. K. Donald, and A. O. Jackson.
1994.
Multiple genetic determinants of barley stripe mosaic virus influence lesion phenotype on Chenopodium amaranticolor.
Virology
198:218-226[CrossRef][Medline].
|
| 44.
|
Petty, I. T. D.,
R. French,
R. W. Jones, and A. O. Jackson.
1990.
Identification of barley stripe mosaic virus genes involved in viral RNA replication and movement.
EMBO J.
96:3453-3457.
|
| 45.
|
Petty, I. T. D.,
B. G. Hunter, and A. O. Jackson.
1988.
A novel strategy for one-step cloning of full-length cDNA and its application to the genome of barley stripe mosaic virus.
Gene
74:423-432[CrossRef][Medline].
|
| 46.
|
Petty, I. T. D.,
B. G. Hunter,
N. Wei, and A. O. Jackson.
1989.
Infectious barley stripe mosaic virus RNA transcribed in vitro from full-length genomic cDNA clones.
Virology
171:342-349[CrossRef][Medline].
|
| 47.
|
Petty, I. T. D., and A. O. Jackson.
1990.
Mutational analysis of barley stripe mosaic virus RNA .
Virology
179:712-718[CrossRef][Medline].
|
| 48.
|
Reichel, C., and R. N. Beachy.
1998.
Tobacco mosaic virus infection induces severe morphological changes of the endoplasmic reticulum.
Proc. Natl. Acad. Sci. USA
95:11169-11174[Abstract/Free Full Text].
|
| 49.
|
Rhee, Y.,
T. Tzfira,
M. H. Chen,
E. Waigmann, and V. Citovsky.
2000.
Cell-to-cell movement of tobacco mosaic virus: enigmas and explanations.
Mol. Plant Pathol.
1:33-39[CrossRef].
|
| 50.
|
Rouleau, M.,
R. J. Smith,
J. B. Bancroft, and G. A. Mackie.
1994.
Purification, properties, and subcellular localization of foxtail mosaic potexvirus 26-kDa protein.
Virology
204:254-265[CrossRef][Medline].
|
| 51.
|
Rupasov, V. V.,
S. Y. Morozov,
K. V. Kanyuka, and S. K. Zavriev.
1989.
Partial nucleotide sequence of potato virus M RNA shows similarities to potexviruses in gene arrangement and the encoded amino acid sequences.
J. Gen Virol.
70:1861-1869[Abstract/Free Full Text].
|
| 52.
|
Santa Cruz, S.,
A. G. Roberts,
S. Chapman, and K. J. Oparka.
1998.
Cell-to-cell and phloem-mediated transport of potato virus X: the role of virions.
Plant Cell
10:495-510[Abstract/Free Full Text].
|
| 53.
|
Schmitt, C.,
E. Balmori,
G. Jonard,
K. E. Richards, and H. Guilley.
1992.
In vitro mutagenesis of biologically active transcripts of beet necrotic yellow vein virus RNA 2: evidence that a domain of the 75-kDa readthrough protein is important for efficient virus assembly.
Proc. Natl. Acad. Sci. USA
89:5715-5719[Abstract/Free Full Text].
|
| 54.
|
Scholthof, H. B.,
T. J. Morris, and A. O. Jackson.
1993.
The capsid protein gene of tomato bushy stunt virus is dispensable for systemic movement and can be replaced for localized expression of foreign genes.
Mol. Plant-Microbe Interact.
6:309-322.
|
| 55.
|
Scholthof, H. B.,
K.-B. G. Scholthof,
M. Kikkert, and A. O. Jackson.
1995.
Tomato bushy stunt virus spread is regulated by two nested genes that function in cell-to-cell movement and host-dependent systemic invasion.
Virology
213:425-438[CrossRef][Medline].
|
| 56.
|
Solovyev, A. G.,
E. I. Savenkov,
A. A. Agranovsky, and S. Y. Morozov.
1996.
Comparisons of the genomic cis-elements and coding regions in RNA components of the hordeiviruses barley stripe mosaic virus, lychnis ringspot virus, and poa semilatent virus.
Virology
219:9-18[CrossRef][Medline].
|
| 57.
|
Solovyev, A. G.,
E. I. Savenkov,
V. Z. Grdzelishvili,
N. O. Kalinina,
S. Y. Morozov,
J. Schiemann, and A. A. Agranovsky.
1999.
Movement of hordeivirus hybrids with exchanges in the triple gene block.
Virology
253:278-287[CrossRef][Medline].
|
| 58.
|
Solovyev, A. G.,
T. A. Stroganova,
A. A. Zamyatnin,
O. N. Fedorkin,
J. Schiemann, and S. Y. Morozov.
2000.
Subcellular sorting of small membrane-associated triple gene block proteins: TGBp3-assisted targeting of TGBp2.
Virology
269:113-127[CrossRef][Medline].
|
| 59.
|
Szecsi, J.,
X. S. Ding,
C. O. Lim,
M. Bendahmane,
M. J. Cho,
R. S. Nelson, and R. N. Beachy.
1999.
Development of tobacco mosaic virus infection sites in Nicotiana benthamiana.
Mol. Plant-Microbe Interact.
12:143-152.
|
| 60.
|
Verchot, J.,
S. M. Angell, and D. C. Baulcombe.
1998.
In vivo translation of the triple gene block of potato virus X requires two subgenomic mRNAs.
J. Virol.
72:8316-8320[Abstract/Free Full Text].
|
| 61.
|
Waigmann, E.,
W. J. Lucas,
V. Citovsky, and P. C. Zambryski.
1994.
Direct functional assay for tobacco mosaic virus cell-to-cell movement protein and identification of a domain involved in increasing plasmodesmal permeability.
Proc. Natl. Acad. Sci. USA
91:1433-1437[Abstract/Free Full Text].
|
| 62.
|
Watanabe, Y.,
T. Ohno, and Y. Okada.
1982.
Virus multiplication in tobacco protoplasts inoculated with tobacco mosaic virus RNA encapsulated in large unilamellar vesicular liposomes.
Virology
120:478-480[CrossRef].
|
| 63.
|
Wong, S.-M.,
K.-C. Lee,
H.-H. Yu, and W.-F. Leong.
1998.
Phylogenetic analysis of triple gene block viruses based on the TGB1 homolog gene indicates a convergent evolution.
Virus Genes
16:295-302[CrossRef][Medline].
|
| 64.
|
Yamanaka, T.,
T. Ohta,
M. Takahashi,
T. Meshi,
R. Schmidt,
C. Dean,
S. Naito, and M. Ishikawa.
2000.
TOM1, an Arabidopsis gene required for efficient multiplication of a tobamovirus, encodes a putative transmembrane protein.
Proc. Natl. Acad. Sci. USA
97:10107-10112[Abstract/Free Full Text].
|
| 65.
|
Yang, Y.,
B. Ding,
D. C. Baulcombe, and J. Verchot.
2000.
Cell-to-cell movement of the 25K protein of potato virus X is regulated by three other viral proteins.
Mol. Plant-Microbe Interact.
13:599-605[Medline].
|
| 66.
|
Zhou, H., and A. O. Jackson.
1996.
Expression of the barley stripe mosaic virus RNA "triple gene block."
Virology
216:367-379[CrossRef][Medline].
|
| 67.
|
Zhou, H., and A. O. Jackson.
1996.
Analysis of cis-acting elements required for replication of barley stripe mosaic virus RNAs.
Virology
219:150-160[CrossRef][Medline].
|
Journal of Virology, September 2001, p. 8712-8723, Vol. 75, No. 18
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.18.8712-8723.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Lim, H.-S., Bragg, J. N., Ganesan, U., Ruzin, S., Schichnes, D., Lee, M. Y., Vaira, A. M., Ryu, K. H., Hammond, J., Jackson, A. O.
(2009). Subcellular Localization of the Barley Stripe Mosaic Virus Triple Gene Block Proteins. J. Virol.
83: 9432-9448
[Abstract]
[Full Text]
-
Lim, H.-S., Bragg, J. N., Ganesan, U., Lawrence, D. M., Yu, J., Isogai, M., Hammond, J., Jackson, A. O.
(2008). Triple Gene Block Protein Interactions Involved in Movement of Barley Stripe Mosaic Virus. J. Virol.
82: 4991-5006
[Abstract]
[Full Text]
-
Schepetilnikov, M. V., Solovyev, A. G., Gorshkova, E. N., Schiemann, J., Prokhnevsky, A. I., Dolja, V. V., Morozov, S. Y.
(2008). Intracellular Targeting of a Hordeiviral Membrane-Spanning Movement Protein: Sequence Requirements and Involvement of an Unconventional Mechanism. J. Virol.
82: 1284-1293
[Abstract]
[Full Text]
-
Garcia-Ruiz, H., Ahlquist, P.
(2006). Inducible Yeast System for Viral RNA Recombination Reveals Requirement for an RNA Replication Signal on Both Parental RNAs.. J. Virol.
80: 8316-8328
[Abstract]
[Full Text]
-
Torrance, L., Cowan, G. H., Gillespie, T., Ziegler, A., Lacomme, C.
(2006). Barley stripe mosaic virus-encoded proteins triple-gene block 2 and {gamma}b localize to chloroplasts in virus-infected monocot and dicot plants, revealing hitherto-unknown roles in virus replication.. J. Gen. Virol.
87: 2403-2411
[Abstract]
[Full Text]
-
Lee, J.-Y., Taoka, K.-i., Yoo, B.-C., Ben-Nissan, G., Kim, D.-J., Lucas, W. J.
(2005). Plasmodesmal-Associated Protein Kinase in Tobacco and Arabidopsis Recognizes a Subset of Non-Cell-Autonomous Proteins. Plant Cell
17: 2817-2831
[Abstract]
[Full Text]
-
Schepetilnikov, M. V., Manske, U., Solovyev, A. G., Zamyatnin, A. A. Jr, Schiemann, J., Morozov, S. Yu.
(2005). The hydrophobic segment of Potato virus X TGBp3 is a major determinant of the protein intracellular trafficking. J. Gen. Virol.
86: 2379-2391
[Abstract]
[Full Text]
-
Yelina, N. E., Erokhina, T. N., Lukhovitskaya, N. I., Minina, E. A., Schepetilnikov, M. V., Lesemann, D.-E., Schiemann, J., Solovyev, A. G., Morozov, S. Yu.
(2005). Localization of Poa semilatent virus cysteine-rich protein in peroxisomes is dispensable for its ability to suppress RNA silencing. J. Gen. Virol.
86: 479-489
[Abstract]
[Full Text]
-
Haupt, S., Cowan, G. H., Ziegler, A., Roberts, A. G., Oparka, K. J., Torrance, L.
(2005). Two Plant-Viral Movement Proteins Traffic in the Endocytic Recycling Pathway. Plant Cell
17: 164-181
[Abstract]
[Full Text]
-
Peremyslov, V. V., Pan, Y.-W., Dolja, V. V.
(2004). Movement Protein of a Closterovirus Is a Type III Integral Transmembrane Protein Localized to the Endoplasmic Reticulum. J. Virol.
78: 3704-3709
[Abstract]
[Full Text]
-
Morozov, S. Yu., Solovyev, A. G.
(2003). Triple gene block: modular design of a multifunctional machine for plant virus movement. J. Gen. Virol.
84: 1351-1366
[Abstract]
[Full Text]
-
Gorshkova, E. N., Erokhina, T. N., Stroganova, T. A., Yelina, N. E., Zamyatnin, A. A. Jr, Kalinina, N. O., Schiemann, J., Solovyev, A. G., Morozov, S. Yu.
(2003). Immunodetection and fluorescent microscopy of transgenically expressed hordeivirus TGBp3 movement protein reveals its association with endoplasmic reticulum elements in close proximity to plasmodesmata. J. Gen. Virol.
84: 985-994
[Abstract]
[Full Text]
-
Zamyatnin, A. A. Jr,, Solovyev, A. G., Sablina, A. A., Agranovsky, A. A., Katul, L., Vetten, H. J., Schiemann, J., Hinkkanen, A. E., Lehto, K., Morozov, S. Yu.
(2002). Dual-colour imaging of membrane protein targeting directed by poa semilatent virus movement protein TGBp3 in plant and mammalian cells. J. Gen. Virol.
83: 651-662
[Abstract]
[Full Text]