Previous Article | Next Article 
Journal of Virology, September 2001, p. 8507-8515, Vol. 75, No. 18
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.18.8507-8515.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
A Mutation in the Latency-Related Gene of Bovine Herpesvirus 1 Leads to Impaired Ocular Shedding in Acutely Infected Calves
Melissa
Inman,
Luciane
Lovato,
Alan
Doster, and
Clinton
Jones*
Department of Veterinary and Biomedical
Sciences, University of Nebraska, Lincoln, Nebraska 68583-0905
Received 9 April 2001/Accepted 14 June 2001
 |
ABSTRACT |
Bovine herpesvirus 1 (BHV-1) is an important pathogen of cattle,
and infection is usually initiated in the ocular or nasal cavity. Like
other alphaherpesviruses, BHV-1 establishes latency in sensory neurons
but has the potential of reactivating from latency and spreading. The
only abundant viral transcript expressed during latency is the
latency-related (LR) RNA, which is alternatively spliced in trigeminal
ganglia during acute infection (L. R. Devireddy and C. Jones,
J. Virol. 72:7294-7301, 1998). LR gene products inhibit cell
cycle progression (Y. Jiang, A. Hossain, M. T. Winkler, T. Holt,
A. Doster, and C. Jones, J. Virol. 72:8133-8142, 1998) and
chemically induced apoptosis (J. Ciacci-Zannela, M. Stone, G. Henderson, and C. Jones. J. Virol. 73:9734-9740, 1999). Although these studies suggest that LR gene products play an important role in
the latency/pathogenesis of BHV-1, construction of a mutant is
necessary to test this hypothesis. Because the bICP0 gene overlaps and
is antisense to the LR gene, it was necessary to mutate the LR gene
without altering bICP0 expression. This was accomplished by inserting
three stop codons near the beginning of the LR RNA, thus interfering
with expression of proteins expressed by the LR RNA. The LR mutant
virus grew with wild-type (WT) efficiency in bovine kidney (MDBK) cells
and expressed bICP0 at least as efficiently as WT BHV-1 or the LR
rescued virus. When calves were infected with the LR mutant, we
observed a dramatic decrease (3 to 4 log units) in ocular shedding
during acute infection relative to WT or the LR rescued virus. In
contrast, shedding of the LR mutant from the nasal cavity was not
significantly different from that of the WT or the LR rescued virus.
Calves infected with the LR mutant exhibited mild clinical symptoms,
but they seroconverted. Neutralizing antibody titers were lower in
calves infected with the LR mutant, confirming reduced growth. In
summary, this study suggests that an LR protein promotes ocular
shedding during acute infection of calves.
 |
INTRODUCTION |
Bovine herpesvirus 1 (BHV-1) is an
important viral pathogen of cattle that can cause severe respiratory
infection, conjunctivitis, abortions, vulvovaginitis, balanopostitis,
and generalized systemic infection in neonate calves (40).
BHV-1-induced immunosuppression frequently leads to secondary bacterial
infections, resulting in bronchopneumonia and occasionally death.
Increased susceptibility to secondary infection correlates with
depressed cell-mediated immunity after infection (2,
8-10). CD8+-T-cell recognition of
infected cells is impaired by down regulation of major
histocompatibility complex class I expression and the transporter
associated with antigen presentation (11, 12, 22).
CD4+-T-cell function is impaired during
acute infection of calves because BHV-1 has the ability to infect
CD4+ T cells and induce apoptosis
(34).
BHV-1 belongs to the subfamily Alphaherpesvirinae and shares
a number of biological properties with herpes simplex virus type 1 (HSV-1) and HSV-2 (16). BHV-1 establishes lifelong latency in ganglionic neurons of the peripheral nervous system after initial replication in the mucosal epithelium. Virus reactivation and spread to
other susceptible animals occur after natural or corticosteroid-induced stress (26, 32). Although the primary site of BHV-1
latency is sensory neurons, there is evidence that long-term
persistence and reactivation also occur within germinal centers of the
pharyngeal tonsil (36).
In contrast to the 70 to 80 viral genes expressed during productive
infection, LR RNA is the only abundant viral transcript detected in
latently infected neurons. A small fraction of LR RNA is polyadenylated
and alternatively spliced in trigeminal ganglia, suggesting this RNA is
translated into an LR protein (5, 13). LR gene products
inhibit S-phase entry, and LR protein is associated with
cyclin-dependent kinase 2 (Cdk2)-cyclin complexes (13,
15). LR gene products also promote cell survival following induction of apoptosis in transiently transfected cells
(4). Although these studies imply that the LR gene plays a
role in latency and/or pathogenesis, the effects of LR gene products on growth of the virus in cultured cells or in cattle has not been studied.
In this study, we constructed an LR mutant virus that contains three
stop codons near the beginning of the LR RNA. The LR mutant had growth
properties similar to those of the WT in productively infected
bovine kidney (MDBK) cells. Since HSV-1 latency-associated transcript
(LAT) null mutants have growth properties in tissue culture cells and
infected rabbits or mice similar to those of wild-type (WT) virus
(reviewed in references 16 and 33), this result was expected. Surprisingly, calves infected with the LR mutant consistently exhibited diminished clinical symptoms and ocular
shedding. However, similar levels of the LR mutant, WT BHV-1, and the
LR rescued virus were shed from the nasal cavities of calves
during acute infection. Taken together, these results suggested that LR
gene products promote virus growth in certain cell types in the eye or
optic nerve during acute infection of cattle.
 |
MATERIALS AND METHODS |
Virus and cells.
The designated cells were plated at a
density of 5 × 105 per
100-mm2 plastic dish in Earle's modified medium
supplemented with 5 to 10% fetal bovine serum (FBS), penicillin (10 U/ml), and streptomycin (100 µg/ml). Bovine kidney (MDBK) cells
(CCL-22; American Type Culture Collection [ATCC]) were grown in 5%
FBS, split 1:6 every 4 to 5 days, and used to propagate BHV-1. Primary
bovine epidermal cells were grown in 10% FBS and were used to generate
the mutant and rescued viruses because they can be transfected with
high efficiency. These cells are immortalized with the simian virus 40 large T antigen and have fibroblastlike characteristics
(11a).
The Cooper strain of BHV-1 (WT virus) was obtained from the National
Veterinary Services Laboratory, Animal and Plant Health Inspection
Services, Ames, Iowa. Viral stocks were prepared by infecting MBDK
cells at a multiplicity of infection (MOI) of 0.001 from a
plaque-purified virus and were subsequently titrated on MDBK cells.
Animal experiments.
BHV-1-free crossbred calves (
250 kg)
were randomly assigned and housed in isolation rooms to prevent cross
contamination. The calves were anesthetized with Rompun (approximately
50 mg/50 kg of body weight; Bayer Corp., Shawnee Mission, Kans.). The
calves were then inoculated in each nostril and eye with 1 ml of a
solution containing 1 × 107 PFU of the
indicated virus/ml, without scarification, for a total of 4 × 107 PFU per animal, as described previously
(30, 34-36). Experiments using animals were performed in
accordance with the American Association of Laboratory Animal Care
guidelines. Calves were housed under strict isolation containment and
were given antibiotics before and after BHV-1 infection to prevent
secondary bacterial infection. Nasal swabs, ocular swabs, and serum
samples were taken at the designated times.
Plasmids.
The plasmid used for generating the LR mutant
(pBlueL/mLAT) was constructed as follows: 825 bp of the
HindIII L fragment that is directly upstream of the LR
promoter (D fragment) was cloned into pBlueBacHisA (Invitrogen,
Carlsbad, Calif.). pBR322-HindIII L fragment contains
the HindIII L fragment of BHV-1 (Cooper strain), and
this plasmid was digested with NheI. The resulting products were treated with mung bean exonuclease (New England BioLabs) to blunt
the ends for ligation of BamHI linkers. After
phenol-chloroform extraction, the DNA was digested with
HindIII and then BamHI. The products were
electrophoresed on an agarose gel, and the 825-bp product was isolated.
The 825-bp product, containing a 5' BamHI site and a 3'
HindIII site, was ligated into the pBlueBacHis vector digested with BamHI plus HindIII, and the
resulting plasmid was designated pBlueL. A fragment containing the
entire LR promoter and coding region (1,940 bp) was cloned into the
HindIII and SalI sites of pBlueL, and the
resulting plasmid was designated pBlueL/LAT. The PstI
fragment (1 to 981 nucleotides [nt]) was excised from pBlueL/LAT and
cloned into the pBlueBacHis vector. This subcloning was performed
because there are three SphI sites in the coding region of
the LR gene (781, 812, and 1,777 nt). The SphI fragment (781 to 812 nt) was excised, and the mutant oligonucleotide was inserted
(Fig. 1C). The mutated PstI
fragment was then cloned back into the original
PstI-digested pBlueL/LAT, and the resulting construct was
designated pBlueL/mLAT. Restriction enzyme mapping and DNA sequencing
determined the proper orientation of the PstI fragment. All
cloning procedures (restriction digests, ligations, calf intestinal
phosphatase treatment, etc.) were performed by standard
procedures described previously (4, 13, 29).

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic of the LR gene and the targeted site for
mutagenesis. (A) Positions of IE transcripts (7, 37-39)
and the LR transcript (27, 28) are presented. IE/4.2 is
the IE transcript that encodes bICP4. IE/2.9 is the IE transcript that
encodes bICP0. One IE promoter activates expression of IE/4.2 and
IE/2.9, and this IE transcription unit is designated IEtu1. E/2.6 is
the early transcript that encodes bICP0. Exon 2 (e2) of bICP0 contains
all of the protein coding sequences of bICP0. The origin of replication
(ORI) separates IEtu1 from IEtu2. IEtu2 encodes a protein, bICP22. The
solid lines in the transcript position map represent exons (e1, e2, and
e3). The arrows indicate the direction of the respective transcripts.
(B) Partial restriction map, location of LR RNA, organization of LR
ORF, and 3' terminus of bICP0. The start sites for LR transcription
during latency and productive infection were previously described
(5, 13). Reading frame C contains an ORF but lacks an
initiating Met. The asterisks denote the positions of stop codons that
are in frame with the respective ORFs. A region of the
HindIII L fragment was cloned upstream of the LR gene,
as described in Materials and Methods, to facilitate homologous
recombination. The positions of the primers that were used to amplify
the mutated region of the LR gene were designated p4 and p5. The
approximate location of the 3' end of bICP22 is shown by the arrow. (C)
DNA sequence of the SphI fragment and the mutant
oligonucleotide (oligo). The first ATG in the WT sequence is the first
in-frame ATG for ORF2 and is underlined. Stop codons in the mutant
oligonucleotide are in all three reading frames (boldface and
underlined). The EcoRI restriction enzyme site (GAATTC)
was incorporated into the mutant oligonucleotide to facilitate
screening.
|
|
The HSV-1 ICP0 (infected cell protein 0)-expressing plasmid was a gift
from S. Silverstein (Columbia University, Columbia,
N.Y.).
Extraction of viral DNA.
Isolation of intact BHV-1 viral DNA
has been previously described (1). Briefly, MDBK cells
were infected with either BHV-1 Cooper or the LR mutant at an MOI of
approximately 10. The clarified lysate was pelleted using a 30%
sucrose-Tris-EDTA cushion (25,000 rpm for 2 h in a Beckman
Lt-65 using an SW28 rotor at 4°C). Virions were disrupted with sodium
dodecyl sulfate (SDS) and RNase treatment, followed by proteinase K
treatment and extraction with phenol-chloroform-isoamyl alcohol
(50:48:2). The integrity and quantity of viral DNA were determined by
1% agarose gel electrophoresis.
Transfection and identification of the LR mutant.
Bovine
epidermal cells were cotransfected with 6 µg of pBlueL/mLAT, 2 µg
of a plasmid encoding HSV-1 ICP0, and 2 µg of viral DNA (Cooper or LR
mutant) by using Superfect (Qiagen) as previously described
(14).
Sixteen hours after transfection, the cells were split 1:2, incubated
for 16 additional hours, and then overlaid with 0.7%
SeaPlaque
agarose. When visible plaques appeared (3 to 4 days
postinfection
[p.i.]), each plaque was isolated, propagated in
MDBK cells, and
screened by PCR for the mutant oligonucleotide
insert. PCR was
performed on the extracted DNA using the p4 (nt
873;
5'CGTGTATTTGCGACCCCCAGCCT3') and p5 (nt 596;
5'GCCAGACCAAACCCCCCGCA3')
primers (Fig.
1). After a hot
start, each cycle consisted of 95°C
for 1 min, 60°C for 1 min, and
72°C for 2 min (30 cycles total).
To ensure complete elongation of
the amplified products, the reaction
mixture was incubated at 72°C
for an additional 10 min. The products
were digested with
EcoRI and electrophoresed on a 2% agarose gel,
and the DNA
was visualized by staining it with ethidium
bromide.
Growth characteristics of the LR mutant, detection of virus
shedding, and virus-specific neutralizing antibodies.
MDBK cells
were infected with various MOIs of BHV-1 for 1 h at 37°C. The
monolayers were then rinsed two times with phosphate-buffered saline
containing 0.5× trypsin to inactivate any surface-bound virus.
Complete medium was then added to the cultures to inactivate the
trypsin. At various times, total cell lysate or the supernatant from
infected cultures was subjected to three freeze-thaw cycles, clarified,
and titrated on MDBK cells.
Nasal and ocular swabs were stored at

80°C in 2 ml of tissue
culture medium supplemented with 10 µg of amphotericin B
(Fungizone)/ml
and 45 µg of gentamicin/ml. Samples were thawed
quickly in a 37°C
water bath, vortexed, and centrifuged (1,500 ×
g for 10 min).
All titrations were performed using
10-fold serial dilution and
were plated in
quadruplicate.
The Veterinary Diagnostic Service, University of Nebraska, Lincoln,
performed neutralizing-antibody titrations utilizing the
Cooper strain
as the stock
virus.
Western blot analysis of bICP0.
After infection of the
cells with the different viruses, whole-cell lysate was
collected at various times (13). Proteins (50 µg) were
separated by SDS-polyacrylamide gel electrophoresis (10% acrylamide)
and then transferred to Immobilon-P membranes (Millipore, Bedford,
Mass.). The membranes were rinsed for 5 min in TBS (0.02 M Tris base,
0.13 M NaCl, pH 7.6) and then blocked in a buffer (TBS, 0.1% Tween 20, 5% nonfat dry milk) for 1 h at room temperature. The membrane was
then incubated with rabbit anti-bICP0 (M. Schwyzer, Zurich,
Switzerland) that was diluted 1:1,000 in primary antibody buffer (TBS,
0.1% Tween 20, 5% bovine serum albumin) for 16 h at 4°C. The
membrane was washed three times for 5 min each time with TBS-0.1%
Tween 20. Detection of bound primary antibody was performed using the
ECL detection system (Amersham Pharmacia, Piscataway, N.J.) (using goat
anti-rabbit antibody) as previously described (13). The
only change made to this protocol was to use the blocking buffer
mentioned above as the secondary antibody dilution buffer. For loading
controls, the membrane was stripped as previously described (ECL
Western blotting Protocols Manual; Amersham Pharmacia) and reprobed
with goat anti-actin antibody (Santa Cruz Biotechnology, Santa Cruz, Calif.) as the primary antibody. A horse anti-goat
peroxidase-conjugated antibody (Santa Cruz Biotechnology) was used for
detection as described above.
 |
RESULTS |
Construction of a BHV-1 LR mutant virus.
Our previous studies
have focused on performing functional studies of the LR gene and
putative proteins encoded by this gene. These studies have demonstrated
that LR gene products interfere with cell cycle progression
(29) and chemical induction of apoptosis (4).
To test whether BHV-1 LR gene products play a role in virus growth
and/or latency, we constructed a BHV-1 LR mutant virus that contains
stop codons near the 5' terminus of the LR transcript and tested this
mutant in cultured cells or calves.
The LR gene is transcribed antisense with respect to the
immediate-early (IE) and early (E) gene transcript (IE/2.9 and
E/2.6)
that encodes bICP0 (Fig.
1A and B). The lytic start site
for the
LR RNA is at nt 724 (
1,
13), and the first
in-frame ATG for
LR open reading frame 2 (ORF2) is at nt 783 to 785 (Fig.
1C),
whereas the stop site for bICP0 is at nt 956 (LR numbers)
(
7,
37-39), which complicates construction of an LR
mutant virus. The
cis-acting sequences that regulate poly(A)
addition for the transcript
that encodes bICP0 are also near sequences
that contain the LR
gene TATA box. This prevented insertion of a
reporter gene near
the start site of LR gene expression or an extensive
deletion
of LR gene sequences. Consequently, we inserted three stop
codons
that should prevent LR protein expression in all three reading
frames (Fig.
1C). This mutation was also designed to allow for
WT
levels of bICP0 expression. The entire promoter and coding
region of
the LR gene was cloned into the pBlueBacHisA vector
as described in
Materials and Methods. A total of 825 bases from
the adjacent
HindIII L fragment (
18) were cloned
upstream of
the LR promoter to ensure that efficient homologous
recombination
occurred. The LR sequences between the two
SphI sites (nt 781
to 812) were replaced with the mutant
oligonucleotide (Fig.
1C).
The mutant oligonucleotide contains the
first in-frame ATG of
ORF2, a unique
EcoRI restriction site
to facilitate screening,
and three stop codons that are in each reading
frame. In transiently
transfected cells, this LR mutant gene construct
expresses the
LR RNA, but the protein detected by a peptide antibody
directed
against the N terminus of LR ORF2 (P2) is not detected
(
4,
13). Since alternative splicing of LR RNA occurs in
trigeminal
ganglia of calves during acute infection (
5),
it is possible
that a protein encoded by the LR gene could be
expressed, even
if this mutation is
present.
BHV-1 DNA was extracted from infected cells, and its integrity was
examined by agarose gel electrophoresis. BHV-1 DNA is not
very
infectious when transfected into cultured bovine epithelial
cells.
Efficient plaque formation was not observed at 14 days
posttransfection, a time when cells were lifting off the plates.
When
BHV-1 DNA and plasmids encoding bICP0 (
14) or HSV-1 ICP0
(data not shown) were cotransfected into bovine cells, efficient
plaque
formation was consistently observed 48 h after transfection.
A
plasmid expressing HSV-1 ICP0 was used for these studies because
bICP0
sequences overlapped the LR mutant region, and thus we were
concerned
this might reduce the efficiency of homologous
recombination.
The viral genome was cotransfected into bovine epithelial cells with
HSV-1 ICP0 and the plasmid containing the mutant oligonucleotide
(pBlueL/mLAT). Plaques were isolated and screened for insertion
of the
mutant oligonucleotide sequence by PCR using the p4 and
p5 primers
(Fig.
1C). The amplified products were then digested
with
EcoRI. If homologous recombination between the LR mutant
plasmid and the viral genome occurred, two bands (105 and 193
bp) would
be observed following digestion with
EcoRI (Fig.
2A
lane 3). WT virus yielded a single
band (298 bp) as expected (Fig.
2A, lanes 1, 2, and 4). After the
potential LR mutants were subjected
to three rounds of plaque
purification, the same banding pattern
was observed, demonstrating that
the mutant virus from a plaque
was not contaminated with WT virus and
was stable. (Fig.
2A, lanes
5 to 9). Occasionally, the WT band was
detected in some samples
(Fig.
2A, lane 10, for example), indicating
that the
EcoRI digestion
was not complete or there was
slight contamination with WT virus.
Several plaques containing the
mutant were selected and plaque
purified two more times to ensure they
were not contaminated with
WT virus.

View larger version (95K):
[in this window]
[in a new window]
|
FIG. 2.
PCR of plaque-purified recombinant viruses. (A) Bovine
epidermal cells were cotransfected with a plasmid encoding HSV-1 ICP0
(2 µg), BHV-1 DNA (2 µg), and pBlueL/mLAT (6 µg). Plaques were
isolated, and PCR was performed on extracted viral DNA using the p4 and
p5 primers (see Fig. 1C and Materials and Methods for the locations and
sequences of these primers). Amplified products were digested with
EcoRI and visualized by ethidium bromide staining on 2%
agarose gel electrophoresis. WT virus yields a single band migrating at
298 bp (oval), while mutant oligonucleotide insertion yields two bands
migrating at 105 and 193 bp (arrows). Lanes 1 and 2, WT virus plaques.
Lane 3 pBlueL/mLAT plasmid DNA. Lane 4, pBlueL/LAT plasmid DNA. Lanes 5 to 9, viral DNA extracted from single plaques after the third round of
plaque purification of the LR mutant virus. Lane 10, example of a
mixed-population virus stock. Lane 11, 100-bp ladder (New England
BioLabs). Lane 12, PCR positive control (WT Cooper strain viral DNA).
(B) Bovine epidermal cells were cotransfected with a plasmid encoding
HSV-1 ICP0 (2 µg), LR mutant viral DNA (2 µg), and pBlueL/LAT (6 µg). Viral DNA was prepared from individual plaques, and PCR was
performed using the p4 and p5 primers. Lane 1, 100-bp ladder. Lanes 2 to 6, individual plaques from the third round of plaque purification of
the LR rescued virus. Lane 7, WT virus DNA. Lane 8, LR mutant DNA,
which served as a PCR control.
|
|
To ensure that a resulting phenotype was not due to secondary site
mutations, a rescued virus was constructed (LR rescued
virus). The LR
mutant viral genome was cotransfected with the
WT LR gene cloned into
pBlueBacHisA (pBlueL/LAT) and a plasmid
encoding HSV-1 ICP0 into bovine
cells. The p4 and p5 primers were
used to identify amplified products
that were not digested by
EcoRI, which was indicative of the
LR WT gene. Figure
2B (lanes
2 to 6) shows five individual plaques that
were rescued back to
the WT sequence. Viral sequences encompassing the
manipulated
regions of the LR gene in the LR mutant and LR rescued
virus were
sequenced and contained the expected sequences (data not
shown).
Analysis of the BHV-1 LR mutant virus in MDBK cells.
Infection
of MDBK cells with BHV-1 Cooper strain produces visible cytopathic
effects by 7 to 10 h p.i. followed by efficient plaque formation.
IE gene expression can be detected within 1 to 2 h p.i. (6,
14, 30, 38, 39). Although not statistically significant, growth
curves suggested that the mutant released virus slightly faster from
MDBK cells early in infection at an MOI of 1 (Fig.
3A). However, the end point titers were
consistently the same. At an MOI of 5, there were no differences in the
titers of cell-associated (data not shown) and released (Fig. 3B)
virus. The differences in the virus titers between Fig. 3A and B were a
result of the cells used to titer the virus in Fig. 3B being more
confluent. We have consistently observed that resting cells or cells
that are too confluent do not yield as much virus as actively growing
cells. However, this difference did not alter our conclusion that the
LR mutant and WT virus had similar growth properties in MDBK cells. LR
mutant, LR rescued, and WT viruses also had similar growth properties
in rabbit epidermal (CCL-68; ATCC), rabbit lung (CCL-193; ATCC), rabbit
skin fibroblasts (CRL-1414; ATCC), and bovine epidermal cells (data not
shown).

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 3.
Growth properties of WT and LR mutant viruses in MDBK
cells. Growth curves were performed as described in Materials and
Methods. (A) Cells were infected at an MOI of 1. LR mutant virus is
denoted by open symbols, and WT virus is denoted by solid symbols.
Released virus is denoted by ovals, and cell-associated virus is
denoted by rectangles. There were no significant differences between
the growth curves or final titers of WT and the LR mutant virus. (B)
Cells were infected at an MOI of 5. Solid ovals denote WT virus titers,
and open ovals denote LR mutant virus titers. The results are
representative of four different experiments.
|
|
The LR RNA is antisense to the IE and E transcript that is translated
into bICP0 (
20), suggesting bICP0 expression could
be
altered by the mutation within the LR gene. Since bICP0 is
essential
for productive viral replication (
7,
14,
19),
we compared
expression of bICP0 in the WT, LR rescued, and LR
mutant viruses
following infection of MDBK cells. These studies
demonstrated that
expression of bICP0 in MDBK cells infected with
the LR mutant was at
least as high as in those infected with the
WT or the LR rescued virus
(Fig.
4). In several experiments, it
appeared that the LR mutant expressed slightly higher levels of
bICP0.

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 4.
Western blot of bICP0 expression of WT, LR rescued, and
LR mutant viruses during infection of MDBK cells. MDBK cells were
infected with the indicated viruses (MOI, 5), and whole-cell lysates
were assayed for bICP0 expression at the indicated times. The membrane
was probed with a polyclonal rabbit serum directed against bICP0
(1:1,000 dilution), and bICP0 was detected with the ECL detection kit.
The predicted molecular mass of bICP0 is 97 kDa
(7). We find that on an SDS-10% polyacrylamide gel
electrophoresis gel, bICP0 routinely runs just below the 97-kDa protein
marker. The membrane was stripped and reprobed for -actin expression
as a loading control.
|
|
Analysis of the LR mutant in calves.
Calves were infected with
a total of 4 × 107 PFU of the WT, LR
rescued, or LR mutant virus/ml via the intranasal and intraocular routes as described previously (30, 34, 36). Acute BHV-1 infection in cattle lasts approximately 10 days. Significant amounts of
ocular and nasal discharge were readily observed in all calves infected
with the WT or LR rescued virus (Table
1). Inflammation, herpetic lesions in the
nostrils, and severe conjunctivitis were routinely detected on days 4 to 8 p.i. As a result of these clinical symptoms, the calves go
off feed for several days and are listless (depressed) (Table 1). In
contrast, the calves infected with the LR mutant virus showed little
discharge from the nose or eyes and consequently did not exhibit severe
clinical symptoms (Table 1).
Infectious virus was collected from ocular and nasal swabs in 2 ml of
medium (Becton Dickinson, Franklin Lakes, N.J.). Samples
were
subjected to two freeze-thaw cycles and clarified by centrifugation,
and then titers were determined on MDBK cells. WT and LR rescued
virus
groups are considered one group because there were no differences
in
the titers. At 1 day p.i., similar titers of virus were detected
in
ocular swabs of calves infected with the LR mutant or WT-LR
rescued
virus group (Fig.
5). At all other time
points, calves
infected with the LR mutant had 2 to 4 log units less
virus in
ocular swabs than calves infected with the WT-LR rescued
virus.
At 6 days p.i., only 2 out of 10 calves infected with the LR
mutant
were shedding measurable virus in ocular swabs. In contrast, the
WT-LR rescued virus group shed an average of 10
5
50% tissue culture infective doses of virus at 6 days p.i.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 5.
Titer of ocular virus shedding. Ocular swabs were
obtained at the indicated times p.i. and stored at 80°C. Titers of
the clarified lysate were determined on MDBK cells in quadruplicate.
The cells were stained with formalin and crystal violet to determine
the 50% endpoint. The solid symbols represent calves infected with WT
or LR rescued virus, and the open symbols represent calves infected
with LR mutant virus. Shown are the average means from each group at
each time indicated. n = 10 for the LR mutant, and
n = 12 for the WT-LR rescued group. Calves infected
with WT and LR rescued viruses showed no observable differences, either
in virus shedding or clinical signs. From this point on, calves in the
WT and LR rescued groups were considered one group. Note that at 6 days
p.i., only two calves infected with the LR mutant shed virus, and at
very low titers. Days 2, 4, 6, and 8 p.i. are statistically
significant: P < 0.005. Statistical analysis was
performed using Microsoft Excel's descriptive statistics.
P values represent the probability that the result
occurred by chance, using 95% confidence (a P value of
<0.05 is statistically significant). The error bars represent the
standard errors of the mean.
|
|
From nasal swabs, the highest titer was obtained at 2 days p.i. for all
groups (9.0 tissue culture infective doses/ml) (Fig.
6). Although we consistently detected
0.5- to 1-log-unit-lower
titers in nasal swabs obtained from the LR
mutant group, the differences
in titers between the WT-LR rescued virus
group and the LR mutant
group were not significant. Considering there
was reduced nasal
discharge from the LR mutant group, it was somewhat
surprising
to find that viral titers in nasal swabs collected from
these
calves were similar to those in swabs from the WT-rescued virus
group. Necropsy of the calves infected with WT showed herpetic
lesions
and mucous secretions in the turbinate at 6 and 10 days
p.i. However,
the LR mutant group exhibited reduced lesions and
secretions (Table
1).
In summary, these results demonstrated
that the LR mutant virus was not
shed efficiently from the eyes
of infected calves but was shed
efficiently from the nose.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 6.
Titer of nasal virus shedding. Nasal swabs were obtained
at the indicated times p.i. and were stored at 80°C. Titers of the
clarified lysate were determined on MDBK cells in quadruplicate. The
cells were stained with formalin and crystal violet to determine the
50% endpoint. The solid symbols represent calves infected with the
Cooper virus strain, and the open symbols represent calves infected
with the LR mutant virus. Shown are the average means from each group
at each time indicated (n = 10 for the LR mutant,
and n = 12 for the Cooper-rescued group). All time
points are not statistically significant: P > 0.05. See the legend to Fig. 5 for an explanation of the statistical
methods used for this study.
|
|
To confirm that the LR mutant was secreted from infected calves, DNA
was extracted from ocular swabs prepared from LR mutant-
or WT
virus-infected calves. Using primers p4 and p5, PCR was
performed, and
the resulting products were digested with
EcoRI.
Prior to
infection (0 days p.i.), viral DNA was not detected for
either group
(Fig.
7). Virus was detected in ocular
swabs from
1 through 4 days p.i. from animals infected with the WT or
LR
mutant virus. After 4 days p.i., viral DNA was not consistently
detected in calves infected with the LR mutant. In contrast, viral
DNA
was consistently detected at days 6, 8, and 14 p.i. in calves
infected with the WT virus. Although data for only one animal
are shown
in Fig.
7, these results are representative of several
animals from
each of the groups.

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 7.
PCR of total DNA prepared from MDBK cells infected with
ocular swabs. Clarified lysate from ocular swabs was obtained at the
indicated times p.i. and then used to infect MDBK cells. DNA was
extracted, and PCR was performed using the primers p4 and p5 (described
in Materials and Methods). The amplified products were digested with
EcoRI and visualized by ethidium bromide staining on a
2% agarose gel. The positions of the WT sequence (not digested by
EcoRI) and the LR mutant sequence (digested by
EcoRI) are shown. Calves infected with the LR mutant
virus only shed virus on days 1 and 4 p.i. Calves infected
with the WT virus shed only the WT virus, which was detected at 1, 4, 8, and 14 days p.i. The mutant and WT lanes contained plaque-purified
viruses prior to infection of the calves. the molecular size ladder was
the 100-bp ladder from New England BioLabs.
|
|
Neutralizing-antibody titers are used to determine if animals were
vaccinated or previously infected with BHV-1 (
17). This
suggests that an increase in the amount of virus replication and
shedding correlated with an increase of neutralizing-antibody
titers.
At 10 and 14 days p.i., calves infected with the WT-LR
rescued virus
produced higher titers of neutralizing antibodies
than calves infected
with the LR mutant (Fig.
8). At 14 days
p.i.,
the WT-LR rescued group had an average titer of 78, but that of
the LR mutant group was 20. In summary, this study demonstrated
that
there was a correlation between reduced ocular shedding of
the LR
mutant virus and neutralizing-antibody titers.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 8.
BHV-1 neutralizing-antibody titers. Serum was collected
from calves at the indicated times and stored at 20°C until it was
tested. Standard testing was performed using constant amounts of virus
(Cooper strain) and twofold dilutions of the serum. The Veterinary
Diagnostic Services, University of Nebraska, Lincoln, performed the
assay. Solid symbols represent calves infected with WT or LR rescued
virus. Open symbols represent calves infected with LR mutant virus.
Each time point represents at least 10 calves for each virus. Days 10 and 14 p.i. are statistically different (P < 0.005). See the legend to Fig. 5 for an explanation of the statistical
methods used for this study.
|
|
 |
DISCUSSION |
This report describes the construction, growth properties, and
gross pathogenesis of a BHV-1 LR mutant that contains stop codons near
the start site of LR transcription. This mutation should interfere with
expression of proteins encoded by the LR gene (Fig. 1) (13,
20). An earlier study demonstrated that a peptide antibody
directed against the amino terminus of LR ORF2 recognized a 35- to
40-kDa protein in transiently transfected cells, but insertion of this
mutant oligonucleotide interfered with its expression (4).
The LR RNA has the potential to produce a family of proteins that may
include functionally distinct proteins because alternative
splicing occurs after infection of calves or cultured cells (5,
13). Because of the complicated nature of LR ORF organization
and splicing of the LR transcript, it is conceivable that the mutation
we generated may not block expression of all proteins encoded by the LR
gene. We are currently developing additional antibodies that will
recognize these putative proteins to identify which ones are expressed
following infection of calves and how this mutation disrupts protein expression.
Shedding of the LR mutant from the eye was reduced 3 to 4 log units
compared to that of WT or rescued virus (Fig. 5), suggesting virus
replication in the eye or optic nerve was inhibited. Curiously, the LR
mutant virus produced slightly larger plaques that lacked a distinct
border compared to the Cooper (WT) virus or the LR rescued virus in
MDBK cells (data not shown). However, the LR mutation had little effect
on virus growth (Fig. 3) following infection of MDBK cells.
Furthermore, similar levels of virus shedding were detected in nasal
swabs of calves infected with the different viruses (Fig. 6). We have
previously demonstrated that LR gene products interfere with cell cycle
progression (29) and apoptosis in transiently transfected
cells (4). It will be interesting to determine if these
activities are necessary for reduced virus shedding in the eyes of
infected calves. It is also possible that the LR mutant does not play a
direct role in virus replication. In productively infected MDBK cells,
the LR mutant virus appeared to be released slightly faster than WT or
rescued virus when the cells were infected at an MOI of 1 (Fig. 3A). If
premature shedding occurred in ocular tissue, the released virus would
likely be an easier target for immune recognition and thus viral titers
would be lower.
This study suggested that a mutation designed to interfere with
expression of LR proteins mediated the phenotype of the LR mutant. The
LR mutant appeared to produce slightly higher levels of bICP0
expression in productively infected cells (Fig. 4). If higher levels of
bICP0 were expressed in certain cell types during acute infection of
calves, this could also have an effect on virus growth because bICP0 is
toxic to cells and activates productive infection (14).
Finally, it is possible that this small mutation has subtle effects on
LR RNA expression in certain cell types. Although the data presented in
this study strongly suggested that LR protein expression plays an
important role in virus shedding in the eye, we cannot rule out the
possibility that increased bICP0 expression in certain cell types
contributed to the observed phenotype of the LR mutant.
The BHV-1 LR gene is considered by some to be a functional homologue of
the HSV-1 gene encoding LAT. This analogy can be made because LR RNA
and LAT are abundantly expressed during latency, their RNA is localized
in the nuclei of latently infected neurons, and the respective RNAs
overlap and are antisense to a potent transcriptional activator (bICP0
or ICP0) (16, 33). A number of studies have described the
growth properties of HSV-1 LAT mutants during infection of rabbits or
mice (16, 33). None of the published HSV-1 LAT mutants
exhibit reduced growth in the eyes of acutely infected animals,
suggesting that the LR gene has novel functions or this phenotype is
only observed in the natural host. In addition to reduced ocular
shedding, we predict that the LR mutant will have reduced establishment
and reactivation from latency because LAT sequences regulate
establishment of latency (24) and spontaneous reactivation
(23) in rabbits. Studies designed to address this
hypothesis are in progress.
BHV-1 lacks several genes contained in the HSV-1 genome which mediate
pathogenesis and/or latency, for example, 34.5 (31). The
34.5 gene plays a crucial role in neurovirulence by inhibiting antiviral functions of the interferon-inducible
double-stranded-RNA-dependent protein kinase R (PKR) (3,
21). 34.5 null mutants have reduced pathogenesis in rabbits and
mice, in large part because of poor growth properties in the eyes and
trigeminal ganglia (25). Although there does not appear to
be a high amino acid similarity between 34.5 and the LR ORFs, it is
tempting to speculate that the LR gene contains certain LAT-like and
34.5-like functions. A better understanding of LR gene function will
help to clarify its role in latency or pathogenesis in cattle and may
help us understand the differences in the genomes of alphaherpesviruses.
 |
ACKNOWLEDGMENTS |
This research was supported by grants from the USDA (9802064 and
2000-02060), the UNL Center for Biotechnology (Comparative Pathobiology
Area of Concentration), and NIH (P20RR15635). L.L. was supported in
part by funds from CAPES, Brazil.
We thank B. Clowser for assistance with cattle experiments, S. Silverstein for the ICP0 construct, and M. Schwyzer for the bICP0
serum. We also thank L. Bello and S. Wechsler for helpful discussion
related to construction of the LR mutant.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Dept. of
Veterinary and Biomedical Sciences, University of Nebraska, Lincoln
Fair St. at East Campus Loop, Lincoln, NE 68583-0905. Phone: (402)
472-1890. Fax: (402) 472-9690. E-mail:
cjones{at}unlinfo.unl.edu.
 |
REFERENCES |
| 1.
|
Bratanich, A. C.,
N. D. Hanson, and C. J. Jones.
1992.
The latency-related gene of bovine herpesvirus 1 inhibits the activity of immediate-early transcription unit 1.
Virology
191:988-991[CrossRef][Medline].
|
| 2.
|
Carter, J. J.,
A. D. Weinberg,
A. Pollard,
R. Reeves,
J. A. Magnuson, and N. S. Magnuson.
1989.
Inhibition of T-lymphocyte mitogenic responses and effects on cell functions by bovine herpesvirus 1.
J. Virol.
63:1525-1530[Abstract/Free Full Text].
|
| 3.
|
Chou, J.,
J. J. Chen,
M. Gross, and B. Roizman.
1995.
Association of a M(r) 90,000 phosphoprotein with protein kinase PKR in cells exhibiting enhanced phosphorylation of translation initiation factor eIF-2 alpha and premature shutoff of protein synthesis after infection with gamma 134.5 mutants of herpes simplex virus 1.
Proc. Natl. Acad. Sci. USA
92:10516-10520[Abstract/Free Full Text].
|
| 4.
|
Ciacci-Zanella, J.,
M. Stone,
G. Henderson, and C. Jones.
1999.
The latency-related gene of bovine herpesvirus 1 inhibits programmed cell death.
J. Virol.
73:9734-9740[Abstract/Free Full Text].
|
| 5.
|
Devireddy, L. R., and C. Jones.
1998.
Alternative splicing of the latency-related transcript of bovine herpesvirus 1 yields RNAs containing unique open reading frames.
J. Virol.
72:7294-7301[Abstract/Free Full Text].
|
| 6.
|
Fraefel, C.,
U. V. Wirth,
B. Vogt, and M. Schwyzer.
1993.
Immediate-early transcription over covalently joined genome ends of bovine herpesvirus 1: the circ gene.
J. Virol.
67:1328-1333[Abstract/Free Full Text].
|
| 7.
|
Fraefel, C.,
J. Zeng,
Y. Choffat,
M. Engels,
M. Schwyzer, and M. Ackermann.
1994.
Identification and zinc dependence of the bovine herpesvirus 1 transactivator protein BICP0.
J. Virol.
68:3154-3162[Abstract/Free Full Text].
|
| 8.
|
Griebel, P. J.,
H. B. Ohmann,
M. J. Lawman, and L. A. Babiuk.
1990.
The interaction between bovine herpesvirus type 1 and activated bovine T lymphocytes.
J. Gen. Virol.
71:369-377[Abstract/Free Full Text].
|
| 9.
|
Griebel, P. J.,
L. Qualtiere,
W. C. Davis,
A. Gee,
H. Bielefeldt Ohmann,
M. J. Lawman, and L. A. Babiuk.
1987.
T lymphocyte population dynamics and function following a primary bovine herpesvirus type-1 infection.
Viral Immunol.
1:287-304[Medline].
|
| 10.
|
Griebel, P. J.,
L. Qualtiere,
W. C. Davis,
M. J. Lawman, and L. A. Babiuk.
1987.
Bovine peripheral blood leukocyte subpopulation dynamics following a primary bovine herpesvirus-1 infection.
Viral Immunol.
1:267-286[Medline].
|
| 11.
|
Hariharan, M. J.,
C. Nataraj, and S. Srikumaran.
1993.
Down regulation of murine MHC class I expression by bovine herpesvirus 1.
Viral Immunol.
6:273-284[Medline].
|
| 11a.
|
Hegde, N. R.,
H. A. Lewin,
M. J. Duggan,
J. R. Stabel, and S. Srikumaran.
1998.
Development of a syngeneic bovine fibroblast cell line: implications for the study of bovine cytotoxic T lymphocytes.
Viral Immunol.
11:37-48[Medline].
|
| 12.
|
Hinkley, S.,
A. B. Hill, and S. Srikumaran.
1998.
Bovine herpesvirus-1 infection affects the peptide transport activity in bovine cells.
Virus Res.
53:91-96[CrossRef][Medline].
|
| 13.
|
Hossain, A.,
L. M. Schang, and C. Jones.
1995.
Identification of gene products encoded by the latency-related gene of bovine herpesvirus 1.
J. Virol.
69:5345-5352[Abstract].
|
| 14.
|
Inman, M.,
Y. Zhang,
V. Geiser, and C. Jones.
2001.
The zinc ring finger in the bICP0 protein encoded by bovine herpes virus-1 mediates toxicity and activates productive infection.
J. Gen. Virol.
82:483-492[Abstract/Free Full Text].
|
| 15.
|
Jiang, Y.,
A. Hossain,
M. T. Winkler,
T. Holt,
A. Doster, and C. Jones.
1998.
A protein encoded by the latency-related gene of bovine herpesvirus 1 is expressed in trigeminal ganglionic neurons of latently infected cattle and interacts with cyclin-dependent kinase 2 during productive infection.
J. Virol.
72:8133-8142[Abstract/Free Full Text].
|
| 16.
|
Jones, C.
1998.
Alphaherpesvirus latency: its role in disease and survival of the virus in nature.
Adv. Virus Res.
51:81-133[Medline].
|
| 17.
|
Jones, C.,
T. J. Newby,
T. Holt,
A. Doster,
M. Stone,
J. Ciacci-Zanella,
C. J. Webster, and M. W. Jackwood.
2000.
Analysis of latency in cattle after inoculation with a temperature sensitive mutant of bovine herpesvirus 1 (RLB106).
Vaccine
18:3185-3195[CrossRef][Medline].
|
| 18.
|
Khattar, S. K.,
S. van Drunen Littel-van den Hurk,
L. A. Babiuk, and S. K. Tikoo.
1995.
Identification and transcriptional analysis of a 3'-coterminal gene cluster containing UL1, UL2, UL3, and UL3.5 open reading frames of bovine herpesvirus-1.
Virology
213:28-37[CrossRef][Medline].
|
| 19.
|
Koppel, R.,
C. Fraefel,
B. Vogt,
L. J. Bello,
W. C. Lawrence, and M. Schwyzer.
1996.
Recombinant bovine herpesvirus-1 (BHV-1) lacking transactivator protein BICPO entails lack of glycoprotein C and severely reduced infectivity.
Biol. Chem.
377:787-795.
|
| 20.
|
Kutish, G.,
T. Mainprize, and D. Rock.
1990.
Characterization of the latency-related transcriptionally active region of the bovine herpesvirus 1 genome.
J. Virol.
64:5730-5737[Abstract/Free Full Text].
|
| 21.
|
Leib, D. A.,
M. A. Machalek,
B. R. Williams,
R. H. Silverman, and H. W. Virgin.
2000.
Specific phenotypic restoration of an attenuated virus by knockout of a host resistance gene.
Proc. Natl. Acad. Sci. USA
97:6097-6101[Abstract/Free Full Text].
|
| 22.
|
Nataraj, C.,
S. Eidmann,
M. J. Hariharan,
J. H. Sur,
G. A. Perry, and S. Srikumaran.
1997.
Bovine herpesvirus 1 downregulates the expression of bovine MHC class I molecules.
Viral Immunol.
10:21-34[Medline].
|
| 23.
|
Perng, G. C.,
H. Ghiasi,
S. M. Slanina,
A. B. Nesburn, and S. L. Wechsler.
1996.
The spontaneous reactivation function of the herpes simplex virus type 1 LAT gene resides completely within the first 1.5 kilobases of the 8.3-kilobase primary transcript.
J. Virol.
70:976-984[Abstract].
|
| 24.
|
Perng, G. C.,
S. M. Slanina,
A. Yukht,
H. Ghiasi,
A. B. Nesburn, and S. L. Wechsler.
2000.
The latency-associated transcript gene enhances establishment of herpes simplex virus type 1 latency in rabbits.
J. Virol.
74:1885-1891[Abstract/Free Full Text].
|
| 25.
|
Perng, G. C.,
R. L. Thompson,
N. M. Sawtell,
W. E. Taylor,
S. M. Slanina,
H. Ghiasi,
R. Kaiwar,
A. B. Nesburn, and S. L. Wechsler.
1995.
An avirulent ICP34.5 deletion mutant of herpes simplex virus type 1 is capable of in vivo spontaneous reactivation.
J. Virol.
69:3033-3041[Abstract].
|
| 26.
|
Rock, D.,
J. Lokensgard,
T. Lewis, and G. Kutish.
1992.
Characterization of dexamethasone-induced reactivation of latent bovine herpesvirus 1.
J. Virol.
66:2484-2490[Abstract/Free Full Text].
|
| 27.
|
Rock, D. L.,
S. L. Beam, and J. E. Mayfield.
1987.
Mapping bovine herpesvirus type 1 latency-related RNA in trigeminal ganglia of latently infected rabbits.
J. Virol.
61:3827-3831[Abstract/Free Full Text].
|
| 28.
|
Rock, D. L.,
A. B. Nesburn,
H. Ghiasi,
J. Ong,
T. L. Lewis,
J. R. Lokensgard, and S. L. Wechsler.
1987.
Detection of latency-related viral RNAs in trigeminal ganglia of rabbits latently infected with herpes simplex virus type 1.
J. Virol.
61:3820-3826[Abstract/Free Full Text].
|
| 29.
|
Schang, L. M.,
A. Hossain, and C. Jones.
1996.
The latency-related gene of bovine herpesvirus 1 encodes a product which inhibits cell cycle progression.
J. Virol.
70:3807-3814[Abstract].
|
| 30.
|
Schang, L. M., and C. Jones.
1997.
Analysis of bovine herpesvirus 1 transcripts during a primary infection of trigeminal ganglia of cattle.
J. Virol.
71:6786-6795[Abstract].
|
| 31.
|
Schwyzer, M., and M. Ackermann.
1996.
Molecular virology of ruminant herpesviruses.
Vet. Microbiol.
53:17-29[CrossRef][Medline].
|
| 32.
|
Sheffy, B. E., and D. H. Davies.
1972.
Reactivation of a bovine herpesvirus after corticosteroid treatment.
Proc. Soc. Exp. Biol. Med.
140:974-976[CrossRef][Medline].
|
| 33.
|
Wagner, E. K., and D. C. Bloom.
1997.
Experimental investigation of herpes simplex virus latency.
Clin. Microbiol. Rev.
10:419-443[Abstract].
|
| 34.
|
Winkler, M. T.,
A. Doster, and C. Jones.
1999.
Bovine herpesvirus 1 can infect CD4(+) T lymphocytes and induce programmed cell death during acute infection of cattle.
J. Virol.
73:8657-8668[Abstract/Free Full Text].
|
| 35.
|
Winkler, M. T.,
L. S. Schang,
A. Doster,
T. Holt, and C. Jones.
2000.
Analysis of cyclins in trigeminal ganglia of calves infected with bovine herpesvirus-1.
J. Gen. Virol.
81:2993-2998[Abstract/Free Full Text].
|
| 36.
|
Winkler, M. T. C.,
A. Doster, and C. Jones.
2000.
Persistence and reactivation of bovine herpesvirus 1 in the tonsils of latently infected calves.
J. Virol.
74:5337-5346[Abstract/Free Full Text].
|
| 37.
|
Wirth, U. V.,
C. Fraefel,
B. Vogt,
C. Vlcek,
V. Paces, and M. Schwyzer.
1992.
Immediate-early RNA 2.9 and early RNA 2.6 of bovine herpesvirus 1 are 3' coterminal and encode a putative zinc finger transactivator protein.
J. Virol.
66:2763-2772[Abstract/Free Full Text].
|
| 38.
|
Wirth, U. V.,
K. Gunkel,
M. Engels, and M. Schwyzer.
1989.
Spatial and temporal distribution of bovine herpesvirus 1 transcripts.
J. Virol.
63:4882-4889[Abstract/Free Full Text].
|
| 39.
|
Wirth, U. V.,
B. Vogt, and M. Schwyzer.
1991.
The three major immediate-early transcripts of bovine herpesvirus 1 arise from two divergent and spliced transcription units.
J. Virol.
65:195-205[Abstract/Free Full Text].
|
| 40.
|
Wyler, R.,
M. Engels, and M. Schwyzer.
1989.
Infectious bovine rhinotracheitis/vulvovaginitis (BHV-1), p. 1-72.
In
G. Witman (ed.), Herpesvirus diseases of cattle, horses, and pigs. Kluwer Academic Publishers, Boston, Mass.
|
Journal of Virology, September 2001, p. 8507-8515, Vol. 75, No. 18
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.18.8507-8515.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Saira, K., Chowdhury, S., Gaudreault, N., da Silva, L., Henderson, G., Doster, A., Jones, C.
(2008). The Zinc RING Finger of Bovine Herpesvirus 1-Encoded bICP0 Protein Is Crucial for Viral Replication and Virulence. J. Virol.
82: 12060-12068
[Abstract]
[Full Text]
-
Perez, S., Meyer, F., Saira, K., Doster, A., Jones, C.
(2008). Premature expression of the latency-related RNA encoded by bovine herpesvirus type 1 correlates with higher levels of beta interferon RNA expression in productively infected cells. J. Gen. Virol.
89: 1338-1345
[Abstract]
[Full Text]
-
Meyer, F., Perez, S., Geiser, V., Sintek, M., Inman, M., Jones, C.
(2007). A Protein Encoded by the Bovine Herpesvirus 1 Latency-Related Gene Interacts with Specific Cellular Regulatory Proteins, Including CCAAT Enhancer Binding Protein Alpha. J. Virol.
81: 59-67
[Abstract]
[Full Text]
-
Zhang, Y., Jiang, Y., Geiser, V., Zhou, J., Jones, C.
(2006). Bovine herpesvirus 1 immediate-early protein (bICP0) interacts with the histone acetyltransferase p300, which stimulates productive infection and gC promoter activity. J. Gen. Virol.
87: 1843-1851
[Abstract]
[Full Text]
-
Geiser, V., Zhang, Y., Jones, C.
(2005). Analysis of a bovine herpesvirus 1 recombinant virus that does not express the bICP0 protein. J. Gen. Virol.
86: 1987-1996
[Abstract]
[Full Text]
-
Perez, S., Inman, M., Doster, A., Jones, C.
(2005). Latency-Related Gene Encoded by Bovine Herpesvirus 1 Promotes Virus Growth and Reactivation from Latency in Tonsils of Infected Calves. J. Clin. Microbiol.
43: 393-401
[Abstract]
[Full Text]
-
Inman, M., Zhou, J., Webb, H., Jones, C.
(2004). Identification of a Novel Bovine Herpesvirus 1 Transcript Containing a Small Open Reading Frame That Is Expressed in Trigeminal Ganglia of Latently Infected Cattle. J. Virol.
78: 5438-5447
[Abstract]
[Full Text]
-
Jiang, Y., Inman, M., Zhang, Y., Posadas, N. A., Jones, C.
(2004). A Mutation in the Latency-Related Gene of Bovine Herpesvirus 1 Inhibits Protein Expression from Open Reading Frame 2 and an Adjacent Reading Frame during Productive Infection. J. Virol.
78: 3184-3189
[Abstract]
[Full Text]
-
Nath, M., Woolliams, J. A., Bishop, S. C.
(2004). Identifying critical parameters in the dynamics and control of microparasite infection using a stochastic epidemiological model. J ANIM SCI
82: 384-396
[Abstract]
[Full Text]
-
Mott, K. R., Osorio, N., Jin, L., Brick, D. J., Naito, J., Cooper, J., Henderson, G., Inman, M., Jones, C., Wechsler, S. L., Perng, G.-C.
(2003). The bovine herpesvirus-1 LR ORF2 is critical for this gene's ability to restore the high wild-type reactivation phenotype to a herpes simplex virus-1 LAT null mutant. J. Gen. Virol.
84: 2975-2985
[Abstract]
[Full Text]
-
Delhon, G., Moraes, M. P., Lu, Z., Afonso, C. L., Flores, E. F., Weiblen, R., Kutish, G. F., Rock, D. L.
(2003). Genome of Bovine Herpesvirus 5. J. Virol.
77: 10339-10347
[Abstract]
[Full Text]
-
Lovato, L., Inman, M., Henderson, G., Doster, A., Jones, C.
(2003). Infection of Cattle with a Bovine Herpesvirus 1 Strain That Contains a Mutation in the Latency-Related Gene Leads to Increased Apoptosis in Trigeminal Ganglia during the Transition from Acute Infection to Latency. J. Virol.
77: 4848-4857
[Abstract]
[Full Text]
-
Geiser, V., Jones, C.
(2003). Stimulation of bovine herpesvirus-1 productive infection by the adenovirus E1A gene and a cell cycle regulatory gene, E2F-4. J. Gen. Virol.
84: 929-938
[Abstract]
[Full Text]
-
Jones, C.
(2003). Herpes Simplex Virus Type 1 and Bovine Herpesvirus 1 Latency. Clin. Microbiol. Rev.
16: 79-95
[Abstract]
[Full Text]
-
Geiser, V., Inman, M., Zhang, Y., Jones, C.
(2002). The latency-related gene of bovine herpesvirus-1 can inhibit the ability of bICP0 to activate productive infection. J. Gen. Virol.
83: 2965-2971
[Abstract]
[Full Text]
-
Inman, M., Lovato, L., Doster, A., Jones, C.
(2002). A Mutation in the Latency-Related Gene of Bovine Herpesvirus 1 Disrupts the Latency Reactivation Cycle in Calves. J. Virol.
76: 6771-6779
[Abstract]
[Full Text]