Previous Article | Next Article ![]()
Journal of Virology, September 2001, p. 8487-8497, Vol. 75, No. 18
Department of
Microbiology1 and Program in Molecular
Biology,2 University of Iowa, Iowa City, Iowa
52242; Department of Biochemistry and Molecular Biology,
University of Miami School of Medicine, Miami, Florida
331363; and Cold Spring Harbor
Laboratory, Cold Spring Harbor, New York
11724-22084
Received 22 February 2001/Accepted 8 June 2001
The synthesis of human immunodeficiency virus type 1 (HIV-1) mRNAs
is a complex process by which more than 30 different mRNA species are
produced by alternative splicing of a single primary RNA transcript.
HIV-1 splice sites are used with significantly different efficiencies,
resulting in different levels of mRNA species in infected cells.
Splicing of Tat mRNA, which is present at relatively low levels in
infected cells, is repressed by the presence of exonic splicing
silencers (ESS) within the two tat coding exons (ESS2
and ESS3). These ESS elements contain the consensus sequence PyUAG.
Here we show that the efficiency of splicing at 3' splice site A2,
which is used to generate Vpr mRNA, is also regulated by the presence
of an ESS (ESSV), which has sequence homology to ESS2 and ESS3.
Mutagenesis of the three PyUAG motifs within ESSV increases splicing at
splice site A2, resulting in increased Vpr mRNA levels and reduced
skipping of the noncoding exon flanked by A2 and D3. The increase in
Vpr mRNA levels and the reduced skipping also occur when splice site D3
is mutated toward the consensus sequence. By in vitro splicing assays,
we show that ESSV represses splicing when placed downstream of a heterologous splice site. A1, A1B, A2, and B1 hnRNPs
preferentially bind to ESSV RNA compared to ESSV mutant RNA. Each of
these proteins, when added back to HeLa cell nuclear extracts depleted
of ESSV-binding factors, is able to restore splicing repression. The
results suggest that coordinate repression of HIV-1 RNA splicing is
mediated by members of the hnRNP A/B protein family.
Both simple and complex retroviruses
require splicing of a single primary RNA transcript in order to
generate mRNA for the viral envelope protein (Env). Complex
retroviruses, such as human immunodeficiency virus type 1 (HIV-1),
require the production of additional mRNAs for regulatory and accessory
proteins. For HIV-1 these include mRNAs for Tat, Rev, Vif, Vpr, and Nef
(6, 19, 35, 37, 39). The Rev protein binds to RNAs
containing the Rev-responsive element in the env gene
sequence. This interaction facilitates nuclear export of unspliced and
partially spliced RNAs required for translation and for packaging into
progeny virions (16, 17, 20, 21, 30; for a recent review,
see reference 12). Early in infection of cells with HIV-1
and prior to the accumulation of Rev, multiply spliced mRNAs
predominate in the cytoplasm. Later in infection, the production of Rev
allows the cytoplasmic accumulation of unspliced and partially spliced
RNAs (24, 25)
In order to generate mRNAs required for the synthesis of viral
proteins, HIV-1 primary RNA transcripts undergo a complex splicing process (Fig. 1). The viral RNA contains
both constitutive and alternative 5' and 3' splice sites. All spliced
mRNAs contain 5'-terminal noncoding exon 1, which is flanked by
consensus 5' splice site D1. Selection of the alternative 3' splice
sites near the middle of the genome determines which proteins are
encoded by the mRNAs. Two size classes of spliced RNAs are produced,
depending on the removal of the intron spanning D4 to A7 (~1.8 kb for
the small size class and ~4 kb for the intermediate size class). For instance, splicing at A3 coupled with splicing at D4 to A7 generates ~1.8-kb Tat mRNA. Similarly, splicing at A4a, A4b, or A4c coupled with splicing at D4 to A7 generates ~1.8-kb Rev mRNA; splicing at A5
coupled with splicing at D4 to A7 generates ~1.8-kb Nef mRNA.
Splicing at A3 generates an ~4-kb mRNA encoding a single-exon form of
Tat. Splicing of mRNAs at A4a, A4b, A4c, and A5 generates ~4-kb mRNAs
encoding Env. Splicing at A1 and A2 generates ~4-kb mRNAs encoding
Vif and Vpr, respectively. As a further complexity, some mRNAs of both
size classes include one or both of two alternative noncoding exons
(Fig. 1B): exon 2, which is flanked by A1 and D2, and exon 3, which is flanked by A2 and D3 (18, 35, 39). Finally, some
virus strains contain within the env gene cryptic splice
sites (D5 and A6) whose usage results in the synthesis of an mRNA
encoding a hybrid protein, Tev (8, 38).
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.18.8487-8497.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
RNA Splicing at Human Immunodeficiency Virus Type
1 3' Splice Site A2 Is Regulated by Binding of hnRNP A/B Proteins
to an Exonic Splicing Silencer Element
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

View larger version (20K):
[in a new window]
FIG. 1.
(A) Structure of the HIV-1 NL4-3 genome. Boxes indicate
open reading frames. Hash marks represent endpoints of
gag-pol deletion in p
PSP. ESS sequences are shown by
shaded boxes. Oligonucleotide primers used are indicated by arrows
designating position and orientation. LTR, long terminal repeat. (B)
Structures of the small (~1.8-kb) and intermediate (~4.0-kb) size
classes of HIV-1 transcripts. Exons are indicated as black bars. The
exons within the different RNA species are designated by numbers (and
sometimes letters) within the boxes according to the nomenclature of
Purcell and Martin (35). The exon designations with the
letter I indicate exons present only in the intermediate-size HIV-1
mRNA species. The alternative noncoding exons 2 and 3 are indicated
with asterisks. Locations of 5' (D) and 3' (A) splice sites are
shown.
Different spliced HIV-1 mRNAs are generated with very different efficiencies. For example, ~1.8-kb mRNAs encoding Tat are present at low levels compared to mRNAs encoding Rev or Nef. Similarly, ~4-kb mRNAs encoding single-exon Tat are present at low levels compared to mRNAs encoding Env (35). It was previously shown that splice site A3 is repressed by ESS2, an exonic splicing silencer (ESS) within the first tat coding exon (exon 4 in Fig. 1). Mutations within the ESS2 element result in a selective increase in splicing at A3 (3, 4). A second ESS (ESS3) was identified within the second tat/rev coding exon downstream of A7 (exon 7 in Fig. 1). In this case, an adjacent upstream exonic splicing enhancer is juxtaposed to the ESS (4, 43). Both ESS2 and ESS3 appear to bind to a common cellular factor or factors that act to repress splicing (42). It has been reported that ESS2 selectively binds to members of the A/B hnRNP family (hnRNPs A1, A1B, A2, and B1) (11, 14). The addition of hnRNP A1 and other members of the hnRNP A/B protein family restores specific splicing repression in HeLa cell nuclear extracts depleted of ESS2-binding proteins (11). A third potential ESS is present in the env gene, where it may prevent the activation of cryptic exon 6D, which is bordered by splice sites A6 and D5 (46).
The levels of Vpr mRNA singly spliced at 3' splice site A2 also have been shown to be low in cells infected with HIV-1, indicating that splicing at A2 is inefficient. Furthermore, noncoding exon 3 (Fig. 1) is skipped in the majority of the mRNAs (35). This exon skipping also suggests that splice site A2 or D3 or both of these splice sites are used inefficiently. It has been shown that the branch point used for splicing at splice site A2 is a G rather than the consensus A that is used for most 3' splice sites. However, replacing the nonconsensus wild-type branch-point sequence with a consensus sequence did not significantly affect splicing efficiency in an in vitro splicing system (13). In this report, we describe additional elements downstream of 3' splice site A2 that act to repress splicing at this splice site.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmids.
Infectious HIV-1 plasmid pNL4-3 (GenBank accession
no. M19921) was constructed by Adachi et al. (1) and was
obtained from the National Institutes of Health AIDS Research and
Reference Reagent Program. Plasmid p
PSP is a derivative of pNL4-3
with a deletion between the SpeI site at nucleotide (nt)
1511 and the BalI site at nt 4551 (23). Mutant
plasmid pSPRS, with base changes within noncoding exon 3, was
constructed by PCR mutagenesis using a Quickchange mutagenesis kit
(Stratagene, La Jolla, Calif.). The mutagenic primers were NL43PSMTF
(5'GAAATACCATATTCTGACGTATAGTTCTTCCTCTGTGTGAATATCAAGC) and NL43PSMTR
(5'GCTTGATATTCACACAGAGGAAGAACTATACGTCAGAATATGGTATTTC); the changed nucleotides are underlined. Mutant plasmid pSPD3up, with an A-to-T change at position +6 of the D3 splice site, was generated by PCR mutagenesis using the Quickchange mutagenesis kit. The
mutagenic primers were D3ATF
(5'GGACATAACAAGGTAGGTTCTCTACAGTACTTGG3') and
D3ATR (5'CCAAGTACTGTAGAGAACCTACCTTGTTATGTCC3').
Plasmid pHS1-X, used as a template to synthesize substrates for the
splicing assays, has been described previously (3).
Plasmid pHS3-ESSV was constructed by replacing the
EcoRI-ScaI fragment of pHS1-X with nt 5322 to nt
5479 of pNL4-3. Mutant plasmid pHS3-ESSVx was created by replacing the
region between the EcoRI and XhoI sites of
pHS3-ESSV with mutated PCR products. The mutated PCR products were
synthesized by using a modified megaprimer technique (2).
The mutagenic primers were PSALLF
(5'CCATATTCTGACGTATAGTTCTTCCTCTGTGTGAA) and PSALLR
(5'TTCACACAGAGGAAGAACTATACGTCAGAATATGG). pHS1-ESSV and pHS1-ESSVx are derivatives of pHS1-X which have wild-type and mutant
noncoding exon 3 silencers inserted in place of the tat exon
2 ESS2, respectively. pHS1-ESSV and pHS1-ESSVx were generated by PCR
mutagenesis using the primers PSWTS
(5'TTAGGACGTATAGTTAGTCCTAGGGGAAGCATCCAGGAAGTC) and PSWTA
(5'CCTAGGACTAACTATACGTCCTAAACTGGCTCCATTTCTTGC) for
pHS1-ESSV and the primers PSMTS
(5'TTCTGACGTATAGTTCTTCCTCTGGGAAGCATCCAGGAAGTC) and PSMTA
(5'CAGAGGAAGAACTATACGTCAGAAACTGGCTCCATTTCTTGC) for
pHS1-ESSVx. The resulting PCR products were used as primers for the
synthesis of a larger product by a modified megaprimer technique
(2). This PCR product was ligated into pHS1-X cleaved with
EcoRI and KpnI. The competitor RNAs used for
depleting nuclear extracts were transcribed from linearized plasmids
pESS2, pESS2x, pESSV, and pESSVx. pESS2 and pESS2x were created by
insertion of 109-bp AccI-RsaI fragments from pHS1
and p
ESS10 (4) into pBluescript SK(+) (Stratagene)
cleaved with AccI and EcoRI, respectively. pESSV
and pESSVx were created similarly using AccI-RsaI
fragments from pHS1-ESSV and pHS1-ESSVx, respectively.
RNA isolation, reverse transcription, and PCR. Total cellular RNA was isolated from transfected HeLa cells 48 h posttransfection by extraction with Tri-Reagent (Molecular Research Center, Inc.) according to procedures supplied by the manufacturer. Three micrograms of RNA was reverse transcribed for 1 h in a 30-µl total volume containing 20 mM each deoxynucleoside triphosphate, 20 U of RNasin (Promega, Madison, Wis.), 100 pmol of random hexamer (Pharmacia, Piscataway, N.J.), 6 µg of bovine serum albumin, and 200 U of Moloney murine leukemia virus reverse transcriptase (RT) (Life Technologies/Gibco/BRL, Rockville, Md.).
For the semiquantitative analysis of ~1.8-kb HIV-1 mRNAs, PCR of cDNA was performed with forward oligonucleotide primer BSS (5'GGCTTGCTGAAGCGCGCACGGCAAGAGG; nt 700 to nt 727) and reverse primer SJ4.7A, which spans splice sites D5 and A7 (5'TTGGGAGGTGGGTTGCTTTGATAGAG; nt 8381 to nt 8369 and nt 6044 to nt 6032). Reverse primer KPNA (5'AGAGTGGTGGTTGCTTCCTTCCACACAG) was used with forward primer BSS for the analysis of ~4.0-kb HIV-1 mRNAs (34). PCR amplification was performed essentially as previously described (10). Thirty cycles of PCR (94°C for 30 s, 60°C for 1 min, and 72°C for 2 min) were completed with a total reaction volume of 50 µl containing 75 mM MgCl2, 10 mM each deoxynucleoside triphosphate, 25 pmol of each primer, and 0.1 U of Perkin-Elmer Amplitaq Gold polymerase. Prior to PCR, the reaction mixture was denatured for 5 min at 94°C. After confirmation of the amplified spliced product by polyacrylamide gel electrophoresis (PAGE) and ethidium bromide staining, products (100 ng) were radiolabeled by performing a single round of PCR with the addition of 10 µCi of [32P]dCTP. Radiolabeled products were analyzed by denaturing electrophoresis on 6% polyacrylamide-7 M urea gels.RNA substrate synthesis. To prepare transcription templates, all DNA constructs were linearized with XhoI. In vitro transcription of runoff RNA transcripts labeled with [32P]UTP (NEN, Boston, Mass.) was carried out as previously described (3).
Immobilization of RNA and depletion of HeLa cell nuclear extracts. Substrate RNAs for bead immobilization were synthesized by in vitro transcription using T7 RNA polymerase (Ambion, Austin, Tex.) and biotin-14 CTP (Life Technologies/Gibco/BRL) with a ratio of modified nucleotide to standard nucleotide of 1:2. RNAs were noncovalently linked to Dynabeads M-280-streptavidin (6.7 × 108 beads/ml) (Dynal, Lake Success, N.Y.) as suggested by the manufacturer. Two micrograms of RNA was incubated with 40 µl of Dynabeads in 1 M NaCl-10 mM Tris HCl (pH 7.5)-1 mM EDTA at room temperature for 15 min with gentle agitation. The Dynabeads with immobilized RNA were washed two times with Dignam's buffer D (15) and then incubated with 15 µl of HeLa cell nuclear extract for 15 min at 30°C with gentle agitation. Nuclear extract depleted of bound factors was separated from the Dynabeads-RNA complex by collecting the complex with a Dynal magnetic particle concentrator for 1 min.
In vitro splicing. Splicing reactions were carried out essentially as previously described (3). In brief, approximately 8 fmol of 32P-labeled RNA was incubated for 2 h at 30°C in a solution containing 60% (vol/vol) nuclear extract in Dignam's buffer D, 20 mM creatine phosphate, 3 mM MgCl2, 0.8 mM ATP, and 2.6% (wt/vol) polyvinyl alcohol. The final volume of the splicing reaction mixture was 25 µl.
Protein analysis. Proteins were separated by sodium dodecyl sulfate (SDS)-10% PAGE and visualized by Coomassie blue staining or transferred by electroblotting to nitrocellulose for immunoblot analysis. Monoclonal antibody 4B10 against hnRNP A1, which also detects hnRNP A1B, was provided by G. Dreyfuss (University of Pennsylvania) and used at a concentration of 1:3,000. Monoclonal antibody 2B2 against hnRNP B1 was provided by H. Kamma (University of Tsukuba, Ibaraki, Japan) and used at a concentration of 1:3,000. Rabbit polyclonal anti-A2 antiserum, which also cross-reacts with hnRNP A1, was provided by S. Riva (Istituto di Genetica Biochimica and Evoluzionistica, Pavia, Italy). It was used at a concentration of 1:1,000. Immunoblots were developed using an alkaline phosphatase staining kit (Vector Labs, Burlingame, Calif.).
Preparation of A/B hnRNPs and adding back to depleted extracts. Recombinant hnRNPs A1, A1B, A2, and B1 were expressed in Escherichia coli and purified as described previously (32, 33). Glutathione S-transferase (GST)-UP1 and GST plasmids (obtained from X. Zhang, University of Arkansas) were expressed in E. coli and lysed by sonication, and the proteins were purified by binding to and elution with glutathione-Sepharose beads (Pharmacia). Proteins were added to depleted nuclear extracts, and splicing was carried out for 2 h at 30°C.
| |
RESULTS |
|---|
|
|
|---|
Mutagenesis of 5' splice site D3 toward the consensus 5' splice
site sequence increases splicing at 3' splice site A2.
We first
investigated elements affecting the efficiency of splicing at HIV-1
splice site A2 in HeLa cell cultures transfected with an HIV-1 genomic
deletion construct (p
PSP; Fig. 1). It has been shown that the
splicing of p
PSP RNA transcripts does not differ significantly from
that of wild-type HIV-1 (23). Also, it has been shown that
HIV-1 RNAs are spliced identically in transfected HeLa cells and
infected peripheral blood mononuclear cells (35). Splice
site D3 (AG/GUAGGA) differs at positions +4 and +6 from the
mammalian consensus 5' splice site sequence.
PSP) and mutant (pSPD3up) constructs, and total RNA
was isolated from the cells at 48 h after transfection. Using appropriate oligonucleotide primers, RNA was analyzed by RT-PCR for the
relative levels of individual mRNAs of both intermediate (~4.0 kb)
and small (~1.8 kb) sizes (Fig. 2). The
nomenclature for the mRNAs denotes which exons are present in the
particular mRNA species (Fig. 1B). The results for the ~4.0-kb RNA
size class indicated that there was a significant increase in the level
of singly spliced Vpr mRNA (1.3I) when 5' splice site D3 was improved (compare lanes 2 and 3 of Fig. 2A). In addition, there were dramatic increases in the levels of ~4.0-kb Env mRNA species that include noncoding exon 3 (1.3.5I, 1.3.4aI/1.3.4bI, and 1.2.3.5I) and a relative
decrease in the major singly spliced species, 1.5I, as well as species
1.2.5I, which includes only noncoding exon 2.
|
Mutations within a putative ESS element in exon 3 increase splicing at 3' splice site A2. Since it appeared from the above data that the optimization of 5' splice site D3 resulted in only partial relief of exon 3 skipping, we investigated whether there were other cis elements repressing splicing at A2. Inspection of noncoding exon 3 revealed that there were three motifs with the general consensus sequence PyUAG. These motifs have sequence homology with previously described ESS elements in the two tat coding exons (42). Previous data indicated that mutations of the AG within this consensus sequence inhibited ESS activity in the tat coding exons (41, 42). To test for a similar effect in noncoding exon 3, we mutated all three of the AGs within the PyUAG motifs to CU. The wild-type and mutated plasmids were transfected into HeLa cells, and the singly and multiply spliced mRNA species were analyzed by RT-PCR as described above (Fig. 2C and D). For the ~4-kb mRNA class, there was an increase in the level of Vpr mRNA (1.3I) in the mutant-transfected cells, and almost all of the ~4.0-kb env mRNA species contained noncoding exon 3, indicating that exon inclusion was almost complete (Fig. 2C, lane 3). As shown in Fig. 2D, lane 3, similar results were obtained with the ~1.8-kb spliced mRNA species; almost all of these mRNAs in mutant-transfected cells contained noncoding exon 3. These results strongly suggested that, in addition to the flanking nonconsensus 5' splice site D3, exon 3 contains an ESS element whose repressive effect on splice site A2 is relieved by mutagenesis.
HIV-1 noncoding exon 3 contains an ESS element.
To further
establish that the element in noncoding exon 3 was indeed an ESS, we
performed additional experiments using in vitro splicing assays with
HeLa cell nuclear extracts. We first created wild-type and mutant
minigene constructs containing exon 3 (pHS3-ESSV and pHS3-ESSVx,
respectively) (Fig 3A). These minigene templates were transcribed with phage T3 polymerase, and the RNA transcripts were used as substrates for in vitro splicing assays. Mutagenesis of all three of the exon 3 AG sequences, as in the p
PSRS
construct used in the in vivo transfection experiments described above,
resulted in two- to threefold increases in the ratio of spliced to
unspliced RNAs (Fig. 3B and C). These results were consistent with the
hypothesis that exon 3 contains an ESS and that mutagenesis of the
element results in increased splicing at 3' splice site A2.
|
|
Evidence that ESSV and ESS2 bind to common cellular factors. If ESSV is an authentic splicing silencer, then it would be expected to bind to cellular factors, as do other ESS elements. We have previously shown that preincubation with excess competitor RNA containing ESS2 increases splicing at the tat 3' splice site (A3) of RNA splicing substrates containing this element (4). In data not shown, we found that preincubation with RNA containing wild-type ESSV caused relief of splicing inhibition of substrate HS1-ESSV, whereas preincubation with the same amount of mutant ESSV-containing RNA did not significantly affect splicing. Interestingly, preincubation with competitor RNA containing ESS2 also resulted in increased splicing of HS1-ESSV RNA. These results supported the hypothesis that ESSV binds a cellular factor(s) and that ESS2 and ESSV share this factor(s), necessary for this inhibition.
To further test this hypothesis, we performed experiments in which we depleted nuclear extracts of the putative factors by binding to RNAs containing splicing silencers. Competitor ESS RNAs were biotinylated and coupled to streptavidin-coated paramagnetic beads. HeLa cell nuclear extracts were incubated with the RNA-beads, the beads containing bound factors were removed, and the treated extracts were used for splicing reactions. We first compared the splicing of RNA substrates containing ESSV (HS1-ESSV) in nuclear extracts which had been preincubated with wild-type and mutant ESSV RNAs coupled to beads. As shown in Fig. 4B, there was little splicing of HS1-ESSV in untreated extracts (Fig. 5A, lane 1). In extracts preincubated with wild-type ESSV RNA coupled to beads, there was a striking increase in the amount of splicing of HS1-ESSV, indicating that a factor or factors inhibiting splicing at 3' splice site A3 had been removed (Fig. 5A, lane 2). In contrast, there was only a small increase in the amount of splicing when extracts were preincubated with mutant RNA coupled to beads (Fig. 5A, lane 3). As expected, the mutagenesis of ESSV (substrate HS1-ESSVx) relieved the inhibition of splicing in untreated extracts (Fig. 5A, lane 4), and splicing of this substrate was similar in extracts preincubated with either wild-type or mutant ESSV RNA coupled to beads (Fig. 5A, lanes 5 and 6).
|
Specific depletion of cellular hnRNP A/B proteins by ESSV
RNA-beads.
Previous studies have indicated that members of the
hnRNP A/B protein family mediate splicing inhibition of HIV-1
substrates containing ESS2 (11). We examined proteins in
untreated extracts and in extracts treated with wild-type or mutated
ESSV RNA-beads to test for selective depletion of proteins
in the size range of the hnRNP A/B
proteins. As shown in Fig. 6A, several differences in the 30- to 40-kDa
molecular mass range between the ESSV and ESSVx lanes were seen
in the Coomassie blue-stained SDS-PAGE patterns. Extracts treated with
either wild-type or mutant RNA-beads were depleted of these proteins,
but the effect was selectively greater when the wild-type RNA was used.
|
Addition of A/B hnRNPs to depleted extracts restores specific
splicing inhibition.
To confirm the hypothesis that splicing
inhibition by ESSV is mediated by preferential binding of hnRNP A/B
proteins, we added back exogenous hnRNP A/B proteins to extracts
depleted with wild-type ESSV RNA and tested these extracts for the
restoration of splicing inhibition (Fig.
7). The amounts of hnRNPs added back to
the wild-type ESSV RNA-depleted nuclear extracts restored the final
concentration in the splicing reactions to approximately the level of
the protein in extracts treated with mutant ESSV RNA-beads. As
expected, substrates containing either wild-type or mutant ESSV
silencers were spliced similarly in the depleted extracts (compare
lanes 1 and 2 of Fig. 7). When hnRNP A/B proteins (A1,
A1B, A2, and B1) were individually added back to
the depleted extracts, repression of splicing was restored to the
substrates with the wild-type but not the mutant silencer. The addition
of control proteins GST-UP1 (hnRNP A1 containing its two RNA
recognition motifs but lacking the C-terminal glycine-rich domain) and
GST alone did not affect splicing. We also added back untagged UP1 and
showed that this protein also has no effect on the splicing of
substrates with the wild-type or the mutant silencers (data not shown).
These results indicated that hnRNP A/B proteins are necessary and
sufficient to restore the specific splicing inhibition by ESSV.
These data also indicate that this inhibition occurs at physiological
protein concentrations.
|
| |
DISCUSSION |
|---|
|
|
|---|
Two elements act in concert to regulate splicing at HIV-1 3' splice site A2, which defines the 5' border of noncoding exon 3. The first element is 5' splice site D3, which defines the 3' boundary of the exon and is a weak splice site. The second element consists of silencer sequences within the exon. When we mutated splice site D3 to change it to a consensus 5' splice site, there were increases in both inclusion of noncoding exon 3 in multiply spliced mRNAs and usage of 3' splice site A2 in singly spliced mRNAs. These results can be explained by the exon bridging hypothesis, which proposes that U1 snRNP binding to the downstream 5' splice site acts to increase splicing efficiency at the upstream flanking 3' splice site (9, 22, 36). According to this hypothesis, changing splice site D3 to a consensus 5' splice site would increase the affinity of U1 snRNP for this splice site and thus increase the efficiency of splicing at 3' splice site A2. This prediction is consistent with what our data showed. The weak effect of nonconsensus 5' splice site D3 on splicing at 3' splice site A2 may contribute to the relatively low singly spliced Vpr mRNA levels and to skipping of exon 3. Alternatively, skipping of exon 3 may result from cis competition, in which consensus 5' splice site D1 is normally favored over nonconsensus 5' splice site D3 for the alternative 3' splice sites A3, A4a, A4b, A4c, and A5 (Fig. 1A). Consistent with the importance of this nonconsensus 5' splice site, the sequence of splice site D3 is conserved in all sequenced strains of HIV-1 (27). A similar mechanism may contribute to the low efficiency of splicing at 3' splice site A1, which flanks noncoding exon 2. Consistent with this hypothesis, we have found that improvement of nonconsensus 5' splice site D2 immediately downstream of noncoding exon 2 to a consensus splice site (AG/GUGAAG to AG/GUGAGU) results in increased inclusion of this exon (P. Bilodeau and C. M. Stoltzfus, unpublished data).
Splicing efficiency at 3' splice site A2 is also regulated by ESS elements. We showed that mutagenesis of the three PyUAG motifs within noncoding exon 3 abrogated the silencing activity of ESSV. Using in vitro splicing assays, we found that mutagenesis of each motif individually resulted in only small increases in splicing that were not significantly different from the results seen with the wild type (Bilodeau and Stoltzfus, unpublished). Significant differences were seen only when all three AGs within the 24-nt ESSV element were mutated. In this regard, it is of interest that the three PyUAG sequences in noncoding exon 3 are conserved in most sequenced HIV-1 strains belonging to the major HIV group (group M) (27).
Other HIV-1 ESS elements also contain the consensus sequence UAG or PyUAG. We have previously shown that HIV-1 tat exon 2 contains ESS2, whose core sequence is CUAGACUAGA, and tat exon 3 contains ESS3, which contains the sequence UUAG. In each case, mutagenesis of the AG dinucleotides results in abrogation of the silencing effect (41, 42). HIV-1 cryptic exon 6D inclusion has been shown to be activated by a U-to-C mutation at the underlined base in the sequence CAAUAGUAGUAG (46). This latter sequence may also be an ESS element.
The evidence presented here also indicates that the ESS elements downstream of both the Vpr and the Tat splice sites compete for the same cellular factors. We have shown above that these shared factors are members of the A/B hnRNP family. Thus, our data agree with previous reports implicating A/B hnRNP family members as mediators of splicing inhibition by the ESS in tat exon 2 (ESS2) (11, 14). hnRNP A1 has also been shown to bind to UAGG in the K-SAM exon of fibroblast growth factor receptor 2 and to mediate splicing silencing of this alternative exon (14). Recent data have indicated that the binding of A/B hnRNPs to a splicing silencer within alternative exon 16 of protein 4.1R pre-mRNA is necessary for splicing repression of the 3' splice site bordering exon 16 (J. Conboy, personal communication).
These previous results and the results reported here suggest that members of the hnRNP A/B protein family binding to ESS elements coordinately repress HIV-1 splicing. Thus, HIV-1 exploits these proteins as a means to limit the amount of splicing at both Tat 3' splice sites and Vpr 3' splice sites. hnRNP A/B proteins are ubiquitous, and this fact may allow the repression of HIV-1 splicing in a variety of cell types. Our data and those of Caputi et al. (11) indicate that, as determined by in vitro splicing assays, all members of the hnRNP A/B protein family, i.e., hnRNPs A1, A1B, A2, and B1, are able to mediate HIV-1 ESS splicing inhibition. It is of interest that hnRNP A1B, which is an alternatively spliced isoform of hnRNP A1, has equivalent silencer activity in the alternative splicing of HIV-1 pre-mRNAs (11; this study), whereas it has very limited activity for 5' splice site switching (33). In preliminary experiments, we have found that the splicing of HIV-1 Tat mRNA is repressed in the mouse erythroleukemia cell line CB3 despite the lack of detectable hnRNP A1 and A1B expression in these cells (7, 47). Mutagenesis of ESS2 relieved this repression (J. Domsic and C. M. Stoltzfus, unpublished data). These data suggest that other members of the hnRNP A/B protein family (i.e., hnRNPs A2 and B1) are able to substitute for hnRNPs A1 and A1B in vivo as well as in vitro.
Recent data have indicated that hnRNP A1 binds to splicing silencer elements within human CD44 exon v6 and downregulates the splicing of this exon (26, 31). Interestingly, this repression was relieved by the expression of either oncogenic Ras or oncogenic proteins that are in the Ras effector pathway (31). Thus, in this case, oncogenic signaling appears to interfere with hnRNP A1-mediated silencing. Inclusion of variant exons in CD44 mRNAs is also increased upon activation of normal lymphocytic and dendritic cells (5, 29, 45). It is possible that interference with hnRNP A/B protein silencing upon cell activation is a potential mechanism for increasing the efficiency of HIV-1 splicing, resulting in increased Tat and Vpr mRNA levels in some cell types and at different times after infection. However, CD44 exon v5 does not contain consensus PyUAG sequences, and the splicing silencing activity appears to be spread throughout the 118-nt exon rather than localized, as in the HIV-1 genome (26, 31). Thus, the mechanism by which hnRNP A1 inhibits CD44 splicing may differ from that used in HIV-1 splicing.
ESS elements and members of the hnRNP A/B protein family also play important roles in the replication of other RNA viruses. Borna disease virus is a nonsegmented negative-strand RNA virus which replicates in the nucleus and whose RNA undergoes splicing. It has been shown that the utilization of one of the Borna disease virus 3' splice sites (SA3) is regulated by an ESS element downstream of this splice site. This ESS contains two PyUAG motifs, and deletion of these motifs abrogates the silencer activity (44). Thus, this ESS is also likely to bind to members of the hnRNP A/B protein family. hnRNP A1 has been shown to specifically bind to UUAG sequences within the RNA of the coronavirus mouse hepatitis virus, the replication of which occurs in the cytoplasm. This binding is required for the regulation of viral RNA transcription and replication (28, 40). The various roles played by hnRNP A/B proteins in cells and during the replication of viruses suggest that these proteins are components of several different complexes that act in a regulatory fashion at different steps of viral and cellular RNA processing as well as viral RNA synthesis.
| |
ACKNOWLEDGMENTS |
|---|
We thank G. Dreyfuss, H. Kamma, and S. Riva for generously providing the hnRNP antibodies used in this study. We also thank X. Zhang for GST-UP1 and GST plasmids. For review of the manuscript, we thank S. Perlman and W. Maury. We thank Sandrine Jacquenet and Christiane Branlant for helpful discussions and sharing unpublished data early in this study.
This research was supported by PHS grant AI36073 from the National Institute of Allergy and Infectious Diseases to C.M.S. A.R.K. and A.M. were supported by PHS grant CA13106 from the National Cancer Institute. A.M. is a member of the Sylvester Comprehensive Cancer Center and was also supported by funds awarded by the Lucille P. Markey Trust. HeLa cells were obtained from the Cell Culture Center, which is sponsored by the National Center for Research Resources of the NIH.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology and Program in Molecular Biology, University of Iowa, Iowa City, IA 52242. Phone: (319) 335-7793. Fax: (319) 335-9006. E-mail: marty-stoltzfus{at}uiowa.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Adachi, A.,
H. E. Gendelman,
S. Koenig,
T. Folks,
R. Willey,
A. Rabson, and M. A. Martin.
1986.
Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone.
J. Virol.
59:284-291 |
| 2. | Aiyar, A., and J. Leis. 1993. Modification of the megaprimer method of PCR mutagenesis: improved amplification of the final product. BioTechniques 14:366-369[Medline]. |
| 3. |
Amendt, B. A.,
D. Hesslein,
L.-J. Chang, and C. M. Stoltzfus.
1994.
Presence of negative and positive cis-acting RNA splicing elements within and flanking the first tat coding exon of the human immunodeficiency virus type 1.
Mol. Cell. Biol.
14:3960-3970 |
| 4. | Amendt, B. A., Z.-H. Si, and C. M. Stoltzfus. 1995. Presence of exon splicing silencers within HIV-1 tat exon 2 and tat/rev exon 3: evidence for inhibition mediated by cellular factors. Mol. Cell. Biol. 15:4606-4615[Abstract]. |
| 5. |
Arch, R.,
K. Wirth,
M. Hoffman,
H. Ponta,
S. Matzku,
P. Herrlich, and M. Zoller.
1992.
Participation in normal immune response of a splice variant of CD44 that encodes a metastasis-inducing domain.
Science
257:682-685 |
| 6. |
Arrigo, S.,
S. Weitsman,
J. A. Zack, and I. S. Chen.
1990.
Characterization and expression of novel singly spliced RNA species of human immunodeficiency virus type 1.
J. Virol.
64:4585-4588 |
| 7. |
Ben-David, Y.,
M. R. Bani,
B. Chabot,
A. De Koven, and A. Bernstein.
1992.
Retroviral insertions downstream of the heterogeneous nuclear ribonucleoprotein A1 gene in erythroleukemia cells: evidence that A1 is not essential for cell growth.
Mol. Cell. Biol.
12:4449-4455 |
| 8. |
Benko, D. M.,
S. Schwartz,
G. N. Pavlakis, and B. K. Felber.
1990.
A novel human immunodeficiency virus type 1 protein, tev, shares sequences with tat, env, and rev proteins.
J. Virol.
64:2505-2518 |
| 9. |
Berget, S. M.
1995.
Exon recognition in vertebrate splicing.
J. Biol. Chem.
270:2411-2414 |
| 10. |
Bilodeau, P. S.,
J. K. Domsic, and C. M. Stoltzfus.
1999.
Splicing regulatory elements within tat exon 2 of human immunodeficiency virus type 1 (HIV-1) are characteristic of group M but not group O HIV-1 strains.
J. Virol.
73:9764-9772 |
| 11. | Caputi, M., A. Mayeda, A. R. Krainer, and A. M. Zahler. 1999. hnRNP A/B proteins are required for inhibition of HIV-1 pre-mRNA splicing. EMBO J. 18:4060-4067[CrossRef][Medline]. |
| 12. |
Cullen, B. R.
2000.
Nuclear export pathways.
Mol. Cell. Biol.
20:4181-4187 |
| 13. | Damier, L., L. Domenjoud, and C. Branlant. 1997. The D1-A2 and D2-A2 pairs of splice sites from human immunodeficiency virus type 1 are highly efficient in vitro, in spite of an unusual branch site. Biochem. Biophys. Res. Commun. 237:182-187[CrossRef][Medline]. |
| 14. |
delGatto-Konczak, F.,
M. Olive,
M.-C. Gesnel, and R. Breathnach.
1999.
hnRNP A1 recruited to an exon in vivo can function as an exon splicing silencer.
Mol. Cell. Biol.
19:251-260 |
| 15. |
Dignam, J. D.,
R. M. Lebovitz, and R. G. Roeder.
1983.
Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res.
11:1475-1489 |
| 16. | Emerman, M., R. Vazeus, and K. Peden. 1989. The rev gene product of the human immunodeficiency virus affects envelope-specific RNA localization. Cell 57:1155-1165[CrossRef][Medline]. |
| 17. |
Felber, B. K.,
M. Hadzopoulou-Cladaras,
C. Cladaras,
T. Copeland, and G. N. Pavlakis.
1989.
Rev protein of human immunodeficiency virus type 1 affects the stability and transport of the viral mRNA.
Proc. Natl. Acad. Sci. USA
86:1495-1499 |
| 18. | Furtado, M. R., R. Balachandran, P. Gupta, and S. M. Wolinsky. 1991. Analysis of alternatively spliced human immunodeficiency virus type 1 mRNA species, one of which encodes a novel TAT-ENV fusion protein. Virology 185:258-270[CrossRef][Medline]. |
| 19. |
Guatelli, J. C.,
T. R. Gingeras, and D. D. Richman.
1990.
Alternative splice acceptor utilization during human immunodeficiency virus type 1 infection of cultured cells.
J. Virol.
64:4093-4098 |
| 20. |
Hadzopoulos-Cladaras, M.,
B. K. Felber,
C. Cladaras,
A. Athanassopoulos,
A. Tse, and G. Pavlakis.
1989.
The rev (trs/art) protein of human immunodeficiency virus type 1 affects viral mRNA and protein expression via a cis-acting sequence in the env region.
J. Virol.
63:1265-1274 |
| 21. |
Hammarskjold, M.-L.,
J. Heimer,
B. Hammarskjold,
I. Sangwan,
L. Albert, and D. Rekosh.
1989.
Regulation of human immunodeficiency virus env expression by the rev gene product.
J. Virol.
63:1959-1966 |
| 22. |
Hoffman, B. E., and P. J. Grabowski.
1992.
U1 snRNP targets an essential splicing factor, U2AF65, to the 3' splice site by a network of interactions spanning the exon.
Genes Dev.
6:2554-2568 |
| 23. |
Jacquenet, S.,
D. Ropers,
P. S. Bilodeau,
L. Damier,
A. Mougin,
C. M. Stoltzfus, and C. Branlant.
2001.
Conserved stem-loop structures in the HIV-1 RNA region containing the A3 3' splice site and its cis-regulatory element: possible involvement in RNA splicing.
Nucleic Acids Res.
29:464-478 |
| 24. |
Kim, S.,
R. Byrn,
J. Groopman, and D. Baltimore.
1989.
Temporal aspects of DNA and RNA synthesis during human immunodeficiency virus infection: evidence for differential gene expression.
J. Virol.
63:3708-3713 |
| 25. |
Klotman, M. E.,
S. Kim,
A. Buchbinder,
A. DeRossi,
D. Baltimore, and F. Wong-Staal.
1991.
Kinetics of expression of multiply spliced RNA in early human immunodeficiency virus type 1 infection of lymphocytes and monocytes.
Proc. Natl. Acad. Sci. USA
88:5011-5015 |
| 26. | Konig, H., H. Ponta, and P. Herrlich. 1998. Coupling of signal transduction to alternative pre-mRNA splicing by a composite splice regulator. EMBO J. 17:2904-2913[CrossRef][Medline]. |
| 27. | Kuiken, C., B. Foley, B. Hahn, P. Marx, F. McCutchan, J. W. Mellors, J. Mullins, S. Wolinsky, and B. Korber. 1999. Human retroviruses and AIDS 1999. Los Alamos National Laboratory, Los Alamos, N.Mex. |
| 28. |
Li, H. P.,
X. Zhang,
R. Duncan,
L. Comai, and M. M. C. Lai.
1997.
Heterogeneous nuclear ribonucleoprotein A1 binds to the transcription-regulatory region of mouse hepatitis virus RNA.
Proc. Natl. Acad. Sci. USA
94:9544-9549 |
| 29. |
Mackay, C. R.,
H.-J. Terpe,
R. Stauder,
W. L. Martson,
H. Stark, and U. Gunthert.
1994.
Expression and modulation of CD44 variant isoforms in humans.
J. Cell Biol.
124:71-82 |
| 30. | Malim, M. H., J. Hauber, S.-Y. Le, J. V. Maizel, and B. R. Cullen. 1989. The HIV-1 rev trans-activator acts through a structured target sequence to activate nuclear export of unspliced viral mRNA. Nature 338:254-257[CrossRef][Medline]. |
| 31. |
Matter, N.,
M. Marx,
S. Weg-Remers,
H. Ponta,
P. Herrlich, and H. Konig.
2000.
Heterogeneous ribonucleoprotein A1 is part of an exon-specific splice-silencing complex controlled by oncogenic signaling pathways.
J. Biol. Chem.
275:35353-35360 |
| 32. | Mayeda, A., and A. R. Krainer. 1992. Regulation of alternative pre-mRNA splicing by hnRNP A1 and splicing factor SF2. Cell 68:365-375[CrossRef][Medline]. |
| 33. | Mayeda, A., S. H. Munroe, J. F. Caceres, and A. R. Krainer. 1994. Function of conserved domains of hnRNP A1 and other hnRNP A/B proteins. EMBO J. 13:5483-5495[Medline]. |
| 34. | Neumann, M., J. Harrison, M. Saltarelli, E. Hadziyannis, V. Erfle, B. K. Felber, and G. N. Pavlakis. 1994. Splicing variability in HIV type 1 revealed by quantitative RNA polymerase chain reaction. AIDS Res. Hum. Retrovir. 10:1531-1542[Medline]. |
| 35. |
Purcell, D. F. J., and M. A. Martin.
1993.
Alternative splicing of human immunodeficiency virus type 1 mRNA modulates viral protein expression, replication, and infectivity.
J. Virol.
67:6365-6378 |
| 36. |
Robberson, B. L.,
G. J. Cote, and S. M. Berget.
1990.
Exon definition may facilitate splice site selection in RNAs with multiple exons.
Mol. Cell. Biol.
10:84-94 |
| 37. |
Robert-Guroff, M.,
M. Popovic,
S. Gartner,
P. Markham,
R. C. Gallo, and M. S. Reitz.
1990.
Structure and expression of tat-, rev-, and nef-specific transcripts of human immunodeficiency virus type 1 in infected lymphocytes and macrophages.
J. Virol.
64:3391-3398 |
| 38. | Salfeld, J., H. Gottlinger, R. Sia, R. Park, J. Sodroski, and W. Haseltine. 1990. A tripartite HIV-1 tat-env-rev fusion protein. EMBO J. 9:965-970[Medline]. |
| 39. |
Schwartz, S.,
B. K. Felber,
D. M. Benko,
E.-M. Fenyo, and G. N. Pavlakis.
1990.
Cloning and functional analysis of multiply spliced mRNA species of human immunodeficiency virus type 1.
J. Virol.
64:2519-2529 |
| 40. | Shi, S. T., P. Huang, H.-P. Li, and M. C. Lai. 2000. Heterogeneous nuclear ribonucleoprotein A1 regulates RNA synthesis of a cytoplasmic virus. EMBO J. 19:4701-4711[CrossRef][Medline]. |
| 41. |
Si, Z.-H.,
B. A. Amendt, and C. M. Stoltzfus.
1997.
Splicing efficiency of human immunodeficiency virus type 1 Tat RNA is determined by both a suboptimal 3' splice site and a 10 nucleotide exon splicing silencer element located within tat exon 2.
Nucleic Acids Res.
25:861-867 |
| 42. |
Si, Z.-H.,
D. Rauch, and C. M. Stoltzfus.
1998.
The exon splicing silencer in human immunodeficiency virus type 1 Tat exon 3 is bipartite and acts early in spliceosome assembly.
Mol. Cell. Biol.
18:5404-5413 |
| 43. | Staffa, A., and A. Cochrane. 1995. Identification of positive and negative splicing regulatory elements within the terminal tat/rev exon of human immunodeficiency virus type 1. Mol. Cell. Biol. 15:4597-4605[Abstract]. |
| 44. |
Tomonaga, K.,
T. Kobayashi,
B.-J. Lee,
M. Watanabe,
W. Kamitani, and K. Ikuta.
2000.
Identification of alternative splicing and negative splicing activity of a nonsegmented negative-strand RNA virus, Borna disease virus.
Proc. Natl. Acad. Sci. USA
97:12788-12793 |
| 45. |
Weiss, J. M.,
J. Sleeman,
A. C. Renkl,
H. Dittmar,
C. C. Termeer,
S. Taxis,
N. Howells,
M. Hofmann,
G. Kohler,
E. Schopf,
H. Ponta,
P. Herrlich, and J. C. Simon.
1997.
An essential role for CD44 variant isoforms in epidermal Langerhans cell and blood dendritic cell function.
J. Cell Biol.
137:1137-1147 |
| 46. | Wentz, M. P., B. E. Moore, M. W. Cloyd, S. M. Berget, and L. A. Donehower. 1997. A naturally arising mutation of a potential silencer of exon splicing in human immunodeficiency virus type 1 induces dominant aberrant splicing and arrests virus production. J. Virol. 71:8542-8551[Abstract]. |
| 47. |
Yang, X.,
M.-R. Bani,
S.-J. Lu,
S. Rowan,
Y. Ben-David, and B. Chabot.
1994.
The A1 and A1B proteins of heterogeneous nuclear ribonucleoproteins modulate 5' splice site selection in vivo.
Proc. Natl. Acad. Sci. USA
91:6924-6928 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||