Previous Article | Next Article 
Journal of Virology, September 2001, p. 8478-8486, Vol. 75, No. 18
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.18.8478-8486.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Role of Chimeric Murine Leukemia Virus
env
-Turn Polyproline Spacers in Receptor
Cooperation
Sandrine
Valsesia-Wittmann*
Vectorologie Rétrovirale et
Thérapie Génique, Ecole Normale Supérieure de Lyon,
INSERM U412, 69364 Lyon Cedex 07, France
Received 27 November 2000/Accepted 13 June 2001
 |
ABSTRACT |
We have previously reported a set of Moloney murine leukemia virus
derived envelopes retargeted to the Pit-2 phosphate transporter molecule, by insertion of the Pit-2 binding domain (BD) at the N
terminus of the ecotropic retroviral envelope glycoproteins (S. Valsesia-Wittmann et al., J. Virol. 70:2059-2064, 1996). The resulting chimeric envelopes share two BDs: an additional N-terminal BD
(Pit-2 BD) and the BD of the ecotropic envelope (mCAT-1 BD). By
inserting a variety of different amino acid spacers between the two
binding domains, we showed that retroviruses can potentially use the
targeted cell surface receptor Pit-2, the ecotropic retroviral receptor
mCAT-1, or both receptors cooperatively for entry into target cell (S. Valsesia-Wittmann et al., EMBO J 6:1214-1223, 1997). An extreme
example of receptor cooperativity was encountered when envelopes with
specific proline-rich interdomain spacers (PRO spacers) were tested:
both receptors had to be coexpressed at the surface of the targeted
cells to cooperatively allow infection. Here, we characterized the role
of PRO spacer in the cooperation of receptors. We have shown that the
particular organization of the PRO spacer
a
-turn polyproline
was
responsible for the cooperative effect. In the native configuration of
the viruses, the structure masked the regions located downstream of the
PRO spacer, thus the mCAT-1 BD. After interaction with the targeted
Pit-2 receptor, the BD of the backbone envelope became accessible, and
we demonstrated that interaction between the mCAT-1 BD and the mCAT-1
receptor is absolutely necessary. This interaction leads to natural
fusion triggering and entry of viruses into targeted cells.
 |
INTRODUCTION |
Most type C mammalian retrovirus
envelopes share proline-rich regions located in the middle of their
surface proteins (SUs). These regions provide a hinge separating
two functional domains of the SU (10): the N-terminal
receptor binding domain (BD) (3) and the C-terminal domain
involved in post-binding entry events (16, 18). Several
reports suggest that the proline-rich domain is not just a flexible
linker but rather a functional domain; it was found (i), in some cases,
to influence receptor recognition (3, 17); (ii) to be
important for stabilization of SU-transmembrane protein (TM)
interaction (10), and (iii) to affect virus fusiogenicity possibly by altering glycosylation (1). A direct role of
the natural proline-rich region of the SU in stabilization of the conformation and fusiogenicity of the murine leukemia virus (MLV) envelope (13, 23) was recently demonstrated. Predictive
structure analysis indicated that the proline-rich peptides present in
these contructs may be organized as a
-turn polyproline. This
particular structure has uncommon properties, such as the ability to
oligomerize in quaternary structure and also to develop elastomeric
forces (20).
When such a proline-rich domain was inserted between two BDs of a
chimeric MLV envelope glycoprotein, generated by fusion of a Pit-2 BD
at the N terminus of Moloney retrovirus envelope protein mCAT-1 BD, we
showed that the entry of retroviruses into targeted cells required the
presence of both receptors Pit-2 and mCAT-1 at the surface of the cells
(21, 22). Binding assays indicated that the mCAT-1 BD of
the virion-associated chimeric envelopes is partially or completely
hidden (22). Moreover, substitution of proline-rich
intergenic spacer (PRO spacer) by a characterized
-turn polyproline
fragment from bovine elastin gave the same efficiency of cooperation of
the receptors. Finally, we demonstrated that, after unmasking,
secondary interaction between mCAT-1 and the backbone envelope is a
crucial prerequisite for induction of the fusion process involving the
TM subunit. These data are consistent with a model for receptor
cooperativity in which binding to the targeted (Pit-2) receptor
triggers conformational rearrangements of the envelope that lead to
unmasking of the hidden mCAT-1 BD, thereby facilitating its interaction
with the viral (mCAT-1) receptor, which leads to fusion.
 |
MATERIALS AND METHODS |
Cell lines.
The human fibroblastic TE671 cell line (ATCC
CRL8805) was grown in Dulbecco modified Eagle medium (DMEM; Life
Technologies) supplemented with 10% fetal bovine serum (Gibco-BRL).
These cells express Pit-2 receptor and are susceptible to amphotropic MLV.
The TELCeB6 cell line was derived from the TE671 cell line after
transfection and clonal selection of cells containing a plasmid expressing Moloney MLV (MMLV) gag and pol proteins. TELCeB6 cells produce noninfectious viral core particles, carrying an nlsLacZ reporter retroviral vector.
Normal Chinese hamster ovary (CHO) fibroblasts are resistant to
infection by both amphotropic and ecotropic MLVs. CeRD9 was derived
from the CHO cell line after transfection and clonal selection of cells
containing a plasmid expressing the mCAT-1 receptor (12). The CeAR13 cell line was derived from transfection of CeRD9 clone after
clonal selection of cells containing a plasmid expressing Pit-2
receptor and thus expressed both receptors (12). We
generated CHO-Pit-2 cells by transfection and clonal selection of
cells expressing Pit-2 receptor. All cells were grown in DMEM (Life Technologies) supplemented with 10% fetal bovine serum and proline (Life Technologies). The murine fibroblastic NIH 3T3 cell line expressing both mCAT-1 and Pit-2 receptor were grown in DMEM (Life Technologies) supplemented with 10% new born bovine serum (Life Technologies).
Plasmids, transfection, and virus production.
Plasmids
encoding the ecotropic (FBMOSALF), amphotropic (FBASALF), and AMO
chimeric (FBAMOSALF) envelopes were described elsewhere (6). Expression plasmids for AMOFx, AMO1, AMO1Fx,
AMOG1Fx, AMOG2, AMOG2Fx, AMOG3Fx, AMO
PRO2, AMO
PRO3,
AMO
PRO4, and AMOPRO chimeric envelopes were as described elsewhere
(21, 22).
To generate expression plasmids for AMOEL3, AMOEL3V, AMOEL3VA, AMOEL3I,
and AMOEL3AI, we reconstituted, for each spacer, a double-stranded DNA
by hybridization of sense and antisense oligonucleotides corresponding
to the entire sequence of the spacer elastin since no templates were
available. We mixed equimolar amounts of both oligonucleotides, heated
at 95°C in a thermoblock for a few seconds, and then allowed them to
cool slowly to room temperature in order to allow hybridization.
Double-stranded products of 63 bp each were then digested with
EaeI and cloned into NotI-linearized
FBAMOSALF plasmid (6). The correct sequence of
final clones was systematically confirmed by sequencing.
To generate the others constructs, a general method of PCR
amplification, using a high-fidelity polymerase (Vent polymerase; Biolabs) was performed as previously described (21). The
correct sequence of PCR products, as well as the final constructs, were systematically confirmed by sequence analysis.
To generate AMOGS3 plasmid, an upper nucleotide (805Fc,
5'-TCCAATTCCTTCCAAGGGGC) located just upstream of the
XhoI site of the 4070A env gene (nucleotide 594)
was used in combination with an oligonucleotide providing a
BamHI site (LowGS3,
5'-TATAGGATCCCCCACCTCCAGATCCGCCACCTCCCACATTAAGGACCTGCCGGGTCAGGA) to generate by PCR amplification a 159-bp fragment encompassing the GS3 interdomain spacer on the FBAMOSALF env gene as
template. In parallel, a second PCR amplification was performed with an oligonucleotide (LMOA
PRO3,
5'-TATGTGCGGCCGCGTCTGGCAGAACGGGGTTTGG) located downstream of
the BspEI site of the FBMOSALF env gene in
combination with an oligonucleotide providing a BamHI site (UpGS3, 5'-CATCGGATCCGGTGGTGGCGGATCGGCCGCACCTCATCAAGTCTAT)
to generate a 623-bp fragment also encompassing the GS3 spacer
domain on the FBAMOSALF env gene template. These two
PCR-amplified fragments were digested, respectively, with
XhoI-BamHI and BamHI-BspEI
and cloned into XhoI-BspEI-digested FBAMOSALF plasmid.
MOD84K plasmid was generated by two PCR amplifications. (i) The first
used oligonucleotide Xba-ATG (5'-ACCATCCTCTGGACGACATG) located on the XbaI site and an ATG initiation codon
of FBMOSALF env gene in combination with an oligonucleotide
providing the substitution of D to K and creating an XhoI
site (Low XhoD84K, 5'-ATTTTCTCGAGCAGCCTGGGCTGCTGCCCC). The
PCR amplification product of 360 bp was then digested by
XbaI and XhoI. (ii) The second used
oligonucleotide LMOA
PRO3 in combination with an oligonucleotide providing the substitution of D to K and creating an XhoI
(Up XhoD84K, 5'-AGGCTGCTCGAGAAAATGCGAAGAACCTTTAACCTCCC). The
470-bp PCR product was then digested with
XhoI-BamHI. The two digested PCR fragments were
cloned into the XbaI-BamHI FBMOSALF plasmid expressing the MO envelope.
To generate the AMOD84K mutants, the same strategy was used with
oligonucleotide 805FC instead of Xba-ATG in combination with the
oligonucleotide Low XhoD84K to generate a 430-bp fragment and also the
same 470-bp PCR fragment resulting from LMOA
PRO3-Up XhoD84K
amplification. Both fragments were digested by XhoI and XhoI-BamHI, respectively, and cloned into an
XhoI-BamHI FBAMOSALF plasmid.
To generate the AMO
3PROD84K and AMOPROD84K constructs, the
NotI-BamHI fragment from AMOD84K plasmid sharing
the D-to-K mutation was cloned into the
NotI-BamHI AMO
3PRO and AMOPRO plasmids.
To generate AMOGIXD84K, the 200-bp XhoI-BstEII
fragment from the AMOG1X plasmid, corresponding to the G1X spacer, was
cloned into the XhoI-BstEII AMOD84K plasmid.
To generate expression plasmids for MOAPRO, an upper oligonucleotide
(UpMOAPRO, 5'-ACTGGGGCTTACGTTTGT-3-') located just upstream of the BamHI site of the MMLV env gene was used
in combination with a lower oligonucleotide providing a NotI
site (LMOAPRO,
5'-ATCGAGGTCACCGCGGCCGCGGGACCCCGAGTCCCCATAGGGCCC-3') to
generate by PCR a 200-bp fragment encompassing the PRO
interdomain spacer on the FBMOSALF env gene as a
template. This PCR fragment was double digested with BamHI
and NotI. In parallel, a 2-kbp NdeI-BamHI fragment from the FBMOSALF plasmid was
purified, providing the 5' end of the MO env gene. These two
inserts were then cloned into the
NdeI-NotI-digested FBEASALF plasmid
(7).
The MOA
PRO plasmid was generated by performing a PCR amplification
with UpMOAPRO oligonucleotide in combination with the LMOA
PRO3 lower
oligonucleotide, providing a shorter PRO spacer. After
BamHI-NotI digestion, this insert was cloned into
the BamHI-NotI-linearized MOAPRO plasmid.
TELCeB6 cells were transfected with envelope expression plasmids by
calcium phosphate precipitation as previously described (6). Transfected cells were selected with phleomycin (50 µg/ml), and phleomycin-resistant colonies were pooled.
Virus-containing supernatants were collected after an overnight
production from freshly confluent env-transfected TELCeB6 cells in regular medium.
Immunoblots.
Virus producer cells were lysed in a 20 mM
Tris-HC1 buffer (pH 7.5) containing 1% Triton X-100, 0.05% sodium
dodecyl sulfate (SDS), 5 mg of sodium deoxycholate per ml, 150 mM NaCl,
and 1 mM phenylmethylsulfonyl fluoride. Lysates were incubated for 10 min at 4°C and then centrifuged for 10 min at 10,000 × g to pellet the nuclei. Supernatants were then frozen at
70°C
until further analysis. Virus samples were obtained by
ultracentrifugation of viral supernatants (10 ml) in a SW41 Beckman
rotor (30,000 rpm, 1 h, 4°C). Pellets were suspended in 100 µl
of phosphate-buffered saline (PBS) and frozen at
70°C. Samples (30 µg for cell lysates or 10 µl for purified viruses) were mixed 5:1
(vol/vol) in a 375 mM Tris-HCl (pH 6.8) buffer containing 6% SDS, 30%
-mercaptoethanol, 10% glycerol, and 0.06% bromophenol blue; boiled
for 3 min, and then run on SDS-10% acrylamide gels. After protein
transfer onto nitrocellulose filters, immunostaining was performed in
Tris base saline (pH 7.4) (TBS) with 5% milk powder and 0.1%
Tween 20. The Antibodies (Quality Biotech, Inc.) were goat antisera
raised against either Rausher leukemia virus (RLV) gp70-SU protein or
RLV p30-CA protein and were diluted 1/1,000 and 1/10,000, respectively.
Blots were developed using horseradish peroxidase-conjugated rabbit anti-goat immunoglobulin antibodies (Dako) and an enhanced
chemiluminescence kit (Amersham Life Science).
Binding assays.
Target cells were washed in PBS and detached
by a 10-min incubation at 37°C with 0.02% EDTA in PBS. Cells were
washed in PBA (PBS with 2% fetal calf serum and 0.1% sodium azide).
Then, 5 × 105 cells were incubated in PBA with
viruses for 45 min at 37°C. Cells were then washed with PBA and
incubated for 45 min at 4°C with monoclonal antibody 83A25, which
recognizes a common epitope present on the ecotropic and amphotropic
MLV surface unit (SU) and allows the detection of SU proteins that are
either soluble or associated with the virus (8), or 9E8,
which is specific of the transmembrane unit of the MLV envelope (TM),
and allows the detection of MLV envelope only when associated with the
virus (virus binding). Cells were washed twice with PBA and incubated with anti-rat immunoglobulin fluorescein isothiocyanate-conjugated antibodies (Dako). At 5 min before the two final washes in PBA, cells
were counterstained with 20 µg of propidium iodide per ml. The
specific fluorescence of the cells was analyzed with a flow cytometer
(FACSCalibur; Becton Dickinson).
Infection assays.
Target cells were seeded in 24-well plates
at a density of 5 × 104 cells per well. Viral
supernatant dilutions containing 5 µg of Polybrene per ml were added,
and cells were incubated for 3 to 5 h at 37°C. Viral supernatant was
then removed, and cells were incubated in regular medium for 48 h.
X-Gal (5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside) staining and viral titer determination as lacZ infectious
units (iu)/milliliter were performed as previously described
(6).
 |
RESULTS |
We have previously reported a set of chimeric MMLV-derived
envelopes designed to retarget the Pit-2 phosphate transporter molecule
by insertion into MMLV envelope of the first 205 amino acids of the
amphotropic MLV 4070A SU corresponding to the BD (4070A BD) (Fig.
1) (22). We have shown that
the infection of target cells by virions bearing these envelopes is
strictly dependent on the nature of the interdomain spacer separating
the 4070A BD from the MMLV backbone envelope. When a proline-rich motif
of 60 amino acids was inserted as a spacer, generating the AMOPRO envelope, infection was dependent on the presence of both receptors (Pit-2 and mCAT-1) at the surface of the target cells, suggesting that
these receptors cooperate during virus entry (Fig.
2). In contrast, when truncated forms of
the proline-rich motif (AMO
PRO2, AMO
PRO3, or AMO
PRO4 chimeric
envelopes) were used, infection occurred only when the targeting
receptor was expressed at the surface of cells but not when receptor
corresponding to the backbone envelope was expressed alone. These data
are consistent with a dynamic role of the proline-rich motif inserted
into chimeric MLV-derived env in receptor cooperation during
retroviral entry.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic representation of envelope chimeras. The
plasmid construct coding for chimeric envelope glycoproteins in which
the Pit-2 BD was fused to MMLV SU is displayed. The general format is
shown diagrammatically, and the amino acid sequence of the interdomain
spacer is shown in detail. Vertical arrows, protein cleavage sites; SU,
surface protein; TM, transmembrane protein; SP, envelope signal
peptide; T, transmembrane domain; Pit-2 ligand, MLV-A receptor BD;
black boxes, MMLV-derived envelope sequences; gray boxes, MLV-A-derived
envelope sequences; white boxes, other MLV-derived envelope sequence.
All env genes were expressed using the same promoter (LTR)
and polyadenylation sites (polyA) from a subgenomic mRNA using
retroviral splice donor (SD) and acceptor (SA) sites.
|
|

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 2.
Infection by virions expressing targeting envelopes.
Virions were used to infect CHO cells expressing Pit-2 receptor
(CHO-Pit-2 cells; white bars), mCAT-1 receptor (CeRD9; gray bars), or
both receptors (CeAR13; striped bars). Data correspond to the average
of 20 repeats (each duplicate), and no significant difference from one
experiment to another was observed (standard deviation of 0.25 log,
99% confidence interval of the mean).
|
|
-Turn helix plays a critical role in receptor cooperation.
The proline-rich region of 4070A MLV is predicted by the Chou-Fasman
analysis (5) to form a regular arrangement of 11
-turns induced by the majority of the prolines in this region (13, 22). This highly ordered structure, consisting of multiple
reverse turns, is consistent with the polyproline
-turn helix form
of a secondary structure (15).
As shown for the dynamic
-spirals of bovine elastin, such a
repetitive
-turn motif in the MLV env proline-rich region
may display unusual physical properties, such as self-assembly into oligomeric quaternary structures, increasing structural order with
increasing temperature, and the development of elastomeric forces
coincident with molecular ordering (20).
In order to see if the properties of the polyproline
-turn helices
can account for the behavior of retroviruses coated with AMOPRO and
AMO
PRO envelopes, we tried to replace PRO spacers by a nonviral
-spiral peptide from bovine elastin (4, 20). Three
synthetic peptides were chosen for this approach: (i) an 18-amino-acid
spacer corresponding to three repeats of the hexapeptide APGVGV, named
EL3VA (APGVGVAPGVGVAPGVGV), or (ii) a 15-amino-acid peptide
corresponding to three repeats of a pentapeptide VPGVG, named EL3V
(VPGVGVPGVGVPGVG), which were both shown to correspond to the main
repeating sequences identified in the tropoelastin, the precursor of
fibrous elastin, or (iii) three repeats of the pentapeptide APGVG
motif, called EL3 (APGVGAPGVGAPGVG).
These peptides were predicted to have propensities to form a
-spiral
and can be classified from weakest to strongest in
-turn helix
propensity as EL3, EL3VA, and EL3V.
In order to check if the size of the spacer might influence receptor
cooperation efficiency, a length control unfolded spacer of 15 amino
acids was designed: GS3, which corresponds to three repeats of four
glycine residues and one serine residue. This spacer was cloned into
the AMO env to generate the AMOGS3 envelope.
The resulting envelopes, AMOEL3VA, AMOEL3V, AMOEL3, and AMOGS3, were
transfected into TelCeB6 cells that provide MLV core and an nls-LacZ
vector (6).
By Western blot analysis of cell lysates of transfected cells or
supernatants of these cells, we demonstrated that chimeric EL3
envelopes were processed and incorporated into MLV particles (Fig. 3A
and B). We also showed that they were all
able to bind to the Pit-2 receptor (Fig.
4). To address the question of the infectivity of retroviruses generated, cells expressing either Pit-2 or
mCAT-1 receptor alone (CHO-Pit-2 and CerD9, respectively) or Pit-2 and
mCAT-1 (CeAR13) were infected. When AMOGS3 envelopes were used as a
control (Fig. 2), minimum or no significant cooperation of receptors
was seen.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 3.
Viral incorporation of chimeric envelope glycoproteins.
Immunoblots of pellets of viral particles from TELCeB6 cells
transfected with the envelopes. The blot was stained with an SU
antiserum and cut at 46 kDa in order to stain the lower part with a p30
antiserum to detect the CA protein as a viral production control.
|
|

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 4.
Binding assays on Pit-2 receptor. Human TE671 cells
expressing Pit-2 receptors were used as a target. The background of
fluorescence was provided by incubating the cells with DMEM only (white
histograms). Binding assays (black histograms) were performed with some
of the envelopes shown in Fig. 1. The envelope glycoprotein content of
the different samples was normalized by immunoblot on a viral
supernatant.
|
|
For the EL3-based envelope, the results revealed a different
cooperation efficiency depending on the nature of the
-spiral peptide inserted. We first showed that substitution of the PRO spacer
by the less-stable
-spiral peptide (EL3) leads to a cooperation of
receptors similar to the one obtained for AMO
PRO3 envelope: chimeric
virions can infect cells only if the target Pit-2 receptor was
expressed, with very low efficiency when mCAT-1 receptor was present
and with increased efficiency when both receptors are expressed. Once
more, when the intermediate-strength
-spiral peptide (EL3VA) was
used as a spacer, the infection of target cells was strictly dependent
on the presence of the two receptors, a result surprisingly similar to
that seen with the 60-amino-acid PRO spacer. These results demonstrated
the critical role of the nature of the
-turn helix in the
cooperation of receptors.
However, with the EL3V spacer, which had the strongest propensity to
form a
-spiral (whereas the chimeric protein is normally and
correctly processed), no infection was observed, even in the presence
of both receptors, thus demonstrating that insertion of very stable
-spiral spacers blocks the transmission of conformational changes of
the protein after binding to the Pit-2 receptor.
These data suggested that the substitution of PRO spacers by
-turn
polyproline helix from bovine elastin leads to a cooperation of
receptors and that the efficiency of cooperation depends on the
stability of the helix.
Deletion of proline residue in the
-turn helix abolishes
cooperation.
In order to confirm the dynamic role of the
env structure in receptor cooperation, we replaced the
repeated proline residues with isoleucine, which prevents
-turn
helix formation. By PCR mutation we replaced the three proline residues
present in the EL3 spacer of AMOEL3 and AMOEL3-VA and derived envelopes
named AMOEL3-I and AMOEL3-AI, respectively. As expected, these
mutations had no effect on the processing and virion incorporation of
the corresponding envelopes (Fig. 3B).
To assess the effect of such mutations on infectivity, infection assays
was performed on target cells expressing either one or two receptors.
The results obtained are reported in Fig. 2. We demonstrated that a
proline-to-isoleucine substitution (AMOEL3AI versus AMOEL3VA) abolished
receptor cooperation. Unlike AMOEL3VA, the AMOEL3AI virions were able
to infect cells expressing either mCAT-1 or Pit-2 with an efficiency at
least of 104 iu/ml. Viral titers were 1 log greater
on cells expressing both receptor CeAR13s than the
AMOEL3VA ones.
For the AMOEL3 envelope, the mutation of proline to isoleucine enhanced
the infection efficiency by at least 1 log on cells expressing Pit-2
receptors alone and by 4 logs on cells expressing mCAT-1. These data
suggest that the structure of the spacers as a
-turn polyproline
helix is crucial for receptor cooperation efficiency.
Interaction with both receptors is required for fusion
transduction.
Our results are consistent with a model of two-step
interaction for the entry of the targeted virions into cells. To
address the requirement, in the second step, of MMLV backbone envelope interaction with the mCAT-1 receptor, we generated a set of mCAT-1 binding-defective mutants. It has been previously demonstrated (14) that an Asp residue in position 84 in the MMLV
wild-type env plays a critical role in binding to receptor.
When Asp-84 is replaced with a Lys residue, the infection is blocked.
By PCR amplification, we created the Asp-to-Lys mutation at position 84 of the mCAT-1 BD of AMO, AMO
PRO3, AMOPRO, and AMOG1X, resulting in
AMOD84K, AMO
PRO3D84K, AMOPROD84K, and AMOG1XD84K, respectively. The
resulting envelopes were tranfected into TELCeB6 cells, and we showed
by Western blot analysis that the production, maturation, and
incorporation into viral particles of each env glycoprotein were not significally affected by the mutation (Fig. 3C).
By flow cytometric analysis, we also confirmed that, whereas all of
these mutants were able to bind to cells expressing Pit-2 receptors in
a manner similar to that of env (Fig.
5A), none were able to bind to cells
expressing mCAT-1 receptors alone (Fig. 5B).

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 5.
Envelope binding assays. The background fluorescence was
provided by incubating the cells with DMEM only (dotted line
histograms). (A) Pit-2 binding control of the D84K mutant. Human TE671
cells expressing Pit-2 receptors were used as a target. Binding assays
of D84K mutant envelopes (white histograms) were compared to chimeric
envelope unmutated on residue 84 (black histograms). (B) mCAT-1 binding
test of D84K mutant. CeRD9 cells expressing mCAT-1 receptor alone were
used as a target. Binding assays of D84K mutant envelope binding (white
histograms) were compared to unmutated recombinant envelope (black
histograms). The envelope glycoprotein content of the different samples
was normalized by immunoblot on a viral supernatant.
|
|
To check the infectious properties of the resulting mutants, an
infection assay was performed on cells expressing mCAT-1, Pit-2, or
both receptors as previously described. The results are reported
in Fig. 6. As expected, AMO and AMOG1X
viruses, which were able to infect cells that only express mCAT-1,
failed to be infectious in the same cells when the D84K mutation was
inserted, thus confirming the critical role of the Asp-84 residue. Like the controls AMO
PRO3, and AMOPRO, AMO
PRO3D84K and
AMOPROD84K env-bearing viruses remained unable to infect
cells which only expressed mCAT-1. The D84K mutation did not affect the
entry of viruses through Pit-2, since AMOD84K, AMO
PRO3D84K, and
AMOG1XD84K were able to infect cells expressing Pit-2 receptors.
AMOPROD84K, like the control AMOPRO env-bearing viruses,
remained unable to infect cells when only Pit-2 is expressed.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 6.
Infection by virions expressing mCAT-1-deficient binding
envelopes. Virions were used to infect CHO cells expressing Pit-2
receptor (CHO-Pit-2 cells; white bars), mCAT-1 receptor (CeRD9; gray
bars), or both receptors (CeAR13; striped bars). Data correspond to the
average of 20 repeats, and no significant difference from experiment to
another was observed (standard deviation of 0.2 log, 99% confidence
interval of the mean).
|
|
In CeAR13 cells which express both receptors, we observed for AMOD84K,
AMO
PRO3D84K, and AMOG1XD84K a 1-log reduction of viral titers
compared to the corresponding wild-type chimeric envelopes.
These results are consistent with an infection occurring, in the normal
configuration, in a ratio of 1 log through mCAT-1 receptors and a range
of 103 to 104 through Pit-2, depending on the
chimeric envelope. This suggests that the mechanisms of viral entry
through these two receptors are different and that mCAT-1 is less
efficient at allowing fusion when the mCAT-1 BD is not separated from
the N-terminal domain of env by PRO spacers.
However, for AMOPRO viruses, for which infection was dependent on the
presence of both receptors, inhibition of the interaction between
mCAT-1 BD and its receptor completely prevented infection, thus
demonstrating the crucial role of this second-step interaction for the
entry of chimeric viruses into cells.
Reciprocal receptor cooperation.
To test if there is a
preferential order of interaction with receptors, we used as the
backbone envelope the 4070A amphotropic envelope. The ecotropic mCAT-1
BD was fused at the N terminus of the 4070A Env protein. These two BD
were spaced either with
PRO3 or PRO spacers. The resulting plasmids,
named MOA
PRO3 and MOAPRO, were transfected into TELCeB6 cells as
previously described.
These chimeric amphotropic backbone envelopes were normally processed
and incorporated into viral particles (data not shown).
As with their counterpart, AMO
PRO, the MOA
PRO virions could only
infect cells that express the targeted receptor alone (in that case
CeRD9 cells expressing mCAT-1) and the CeAR13 cells expressing
both receptors (Table 1). However,
although AMO
PRO virions were unable to infect cells that only
expressed the receptor corresponding to the backbone envelope
(CeRD9), MOA
PRO virions remained able to infect, even with
low efficiency, cells through Pit-2 receptors (CHO-Pit-2).
Similar to AMOPRO, MOAPRO failed to infect cells expressing the
backbone receptor alone, whereas it was able to infect CeAR13 cells expressing both receptors. These data seem to indicate that the
Pit-2 BD isn't functional and that a receptor cooperation is required
for infection.
However, we observed that MOAPRO virions remained able to infect
cells expressing only the targeted receptor (CeRD9), although with a very poor efficiency. These data suggest that even if receptor cooperation was efficient, it appeared to be less stringent than what
we observed for AMOPRO virions.
 |
DISCUSSION |
Proline-rich regions are known to play a critical role in several
pro- and eucaryotic systems (9, 15, 20). Depending on
their structure, they contribute directly or indirectly to the binding
properties, the structure and stability, or the functionality of
proteins that contain such proline-rich regions. Thus, the proline-rich
region seems to be a functional domain rather than a spacing region. We
showed that insertion of a 60-residue PRO peptide between two BDs of
chimeric MMLV-derived retroviral glycoproteins limited their ability to
infect cells: infection became strickly dependent on the presence of
both receptors, corresponding to the two BDs of the chimeric envelope
glycoproteins at the surface of the cells.
Predictive structure analysis indicates that this PRO spacer may be
organized as a
-turn helix. We showed that this structure can
account for the behavior of the chimeric envelope since the substitution of PRO spacers by nonviral peptides, shown to be organized
as a
-turn helix, induces receptor cooperation. Further, we
demonstrated that the efficiency of receptors cooperation is modulated
(i) by the number of turns forming the
-helix and (ii) within one
-turn of the helix by the number and nature of the amino acid
spacing the PRO residues.
We showed that the most efficient cooperation was observed with the
chimeric envelope containing the whole PRO region and that, at least,
three to four
-turns are required to mask the backbone ecotropic
envelope. Even for an equal given number of
-turns, while three
repeats of PGVGAP corresponding to EL3 spacer "cooperates" as well
as three turns of the PRO spacer (
PRO3), three repeats of
PGVGVP (corresponding to EL3V) completely blocked cooperation.
We speculate that the greater stability of the
-turn arrangement is
not compatible with the refolding of the spacer after interaction
between the additional N-terminal binding domain and its receptor.
These data seem to indicate that spacers need to share a stability not
too strong in order to transmit "signal" after interaction trough
changes of conformation.
We also showed that the 18-amino-acid EL3VA spacer (APGVGV motif)
presents the same "cooperative" properties as the 60-residue PRO
spacers, and we can assume that this spacer has an improved arrangement
of the
-turns in terms of structure and stability.
Taken together, these data suggest that the composition, length, and
strength that determines the stability of the
-turn helix is crucial
for the efficiency of receptor cooperation. As in the naive viral SU,
the BD located downstream of the PRO spacer is masked by the presence
of PRO spacers (22); these data are consistent with
two-step receptor cooperation as follows: (i) binding to a targeted
surface molecule induces conformational changes in the chimeric
glycoprotein envelope via the
-turn helix and (ii) this, in
turn, allows interaction with the fusion-competent retroviral receptor.
It is interesting to draw a parallel between the masking of the
receptor binding region located downstream of the PRO spacer in the
chimeric envelope and the masking of the fusion peptide by the
proline-rich region naturally present between the BD of the SU and TM
subunits in wild-type MLV envelope glycoproteins. Viruses have been
selected to develop efficient and specific systems to block the
activity of their fusion peptide until they bind specifically to the
right receptor, and we can argue that the natural proline-rich region
of wild-type MLV glycoproteins share a similar function.
This two-step entry of a virus into a cell, in a natural, efficient
way, is attractive for the design of a new generation of retroviral
vectors suitable for gene therapy. Indeed, we previously demonstrated
that "one-step targeting", by insertion of new BDs at the N
terminus of the MMLV glycoprotein (6, 21) is not efficient
in terms of the transduction of human cells. So, depending on the cells
to be targeted, the next strategy will be to design a chimeric
targeting envelope based on the backbone envelope for which human cells
express the most efficient receptors in terms of transduction of the
fusion signal. This might be performed with (i) an amphotropic envelope
for which the ubiquitous receptor Pit-2 is expressed at the surface of
nearly all human cells, (ii) a gibbon ape leukemia virus envelope for
which Pit-1 receptors are largely expressed at the surface of
hematopoietic precursors, or (iii) a hemagglutinin envelope of
influenza viruses which recognizes the ubiquitous sialic acid
(10a).
We demonstrated that reciprocal Pit-2-mCAT-1 cooperation with MOAPRO
virions is possible, although infection still occurs partially directly
through the targeted receptor. These observations suggested that even
if ecotropic and amphotropic envelopes share similar topologies and
properties, their exploitation of receptor potential seem to be
slightly different.
In the MOAPRO construct, the PRO spacer inserted between the two BDs
was derived from ecotropic strain, whereas for the AMOPRO construct the
PRO spacer was derived from amphotropic ones.
The efficiency of masking of the PRO spacer appears to be lower for the
amphotropic backbone envelope compared to the ecotropic one. This
observation can be correlated with the predicted structure of these two
regions: the amphotropic helix shares more stable and more numerous
-turns than ecotropic ones. We speculate that amphotropic envelopes
are more fusogenic than ecotropic ones and, as a prerequisite, the
inhibition of the fusion domain is more effective in order to restrict
the fusion process unless specific binding to the receptor occurs.
A new goal will be to generalize this two-step targeting phenomena to
the design of vectors suitable for gene therapy purposes. First, the
backbone envelope has to be improved depending on the human cells to be
targeted. We have to choose the most suitable backbone envelope for
which the target cells express the most efficient retroviral receptors.
Second, the spacer has to be optimized in order to design the most
efficient
-turn helix polyproline in terms of masking and also
unmasking. Lastly, the most specific ligand able to target the virus to
specific cell surface molecules will have to be developed.
The improvement of these three components will give rise to a new
concept for gene therapy retroviral vector design.
 |
ACKNOWLEDGMENTS |
This work was supported by Agence Nationale pour la
Recherche contre le SIDA (ANRS), the European Community, AFIRST,
Association Française contre les Myopathies (AFM), Association
pour la Recherche contre le Cancer (ARC), SIDACTION, and Institut
National de la Santé et de la Recherche Médicale (INSERM).
I thank Michèle Ottmann-Terrangle, David Camerini, and Fabian
Wild for critical reading of the manuscript.
 |
FOOTNOTES |
*
Present address: Laboratoire des Virus Gamma
Herpès Humain, Ecole Normale Supérieure de Lyon, INSERM
U412, 46 Allée d'Italie, 69364 Lyon Cedex 07, France. Phone:
334-72-72-81-75. Fax: 334-72-72-87-77. E-mail:
sandrinewittmann{at}yahoo.fr.
 |
REFERENCES |
| 1.
|
Andersen, K. B.
1994.
A domain of murine retrovirus surface protein gp70 mediates cell fusion, as shown by a novel SC-1 cell fusion system.
J. Virol.
68:3175-3182[Abstract/Free Full Text].
|
| 2.
|
Bae, Y.,
S. M. Kingsman, and A. J. Kingsman.
1997.
Functional dissection of the Moloney murine leukemia virus envelope protein gp70.
J. Virol.
71:2092-2099[Abstract].
|
| 3.
|
Battini, J. L.,
O. Danos, and J. M. Heard.
1995.
Receptor-binding domain of murine leukemia virus envelope glycoproteins.
J. Virol.
69:713-719[Abstract].
|
| 4.
|
Bhandary, K.,
S. E. Senadhi,
K. U. Prasad,
K. Prasad,
D. W. Urry, and S. Vijay-Kumar.
1990.
Conformation of a cyclic decapeptide analog of a repeat pentapeptide sequence of elastin: cyclo-bis(valyl-prolyl-alanyl-valyl-glycyl).
Int. J. Peptide Protein Res.
36:122-127[Medline].
|
| 5.
|
Chou, P. Y., and G. D. Fasman.
1978.
Empirical predictions of protein conformation.
Annu. Rev. Biochem.
47:45-148.
|
| 6.
|
Cosset, F.-L.,
F. J. Morling,
Y. Takeuchi,
R. A. Weiss,
M. K. L. Collins, and S. J. Russell.
1995.
Retroviral retargeting by envelopes expressing an N-terminal binding domain.
J. Virol.
69:6314-6322[Abstract].
|
| 7.
|
Cosset, F.-L.,
Y. Takeuchi,
J. L. Battini,
R. A. Weiss, and M. K. L. Collins.
1995.
High-titer packaging cells producing recombinant retroviruses resistant to human serum.
J. Virol.
69:7430-7436[Abstract].
|
| 8.
|
Evans, L. H.,
R. P. Morrison,
F. G. Malik,
J. Portis, and W. Britt.
1990.
A neutralizable epitope common to the envelope glycoproteins of ecotropic, polytropic, xenotropic, and amphotropic murine leukemia viruses.
J. Virol.
64:6176-6183[Abstract/Free Full Text].
|
| 9.
|
Fontenot, J. D.,
N. Tjandra,
C. Ho,
P. C. Andrews, and R. C. Montelaro.
1994.
Structure and self-assembly of a retrovirus (FeLV) proline-rich neutralization domain.
J. Biomol. Struct. Dyn.
11:821-837[Medline].
|
| 10.
|
Gray, K. D., and M. J. Roth.
1993.
Mutational analysis of the envelope gene of Moloney murine leukemia virus.
J. Virol.
67:3489-3496[Abstract/Free Full Text].
|
| 10a.
|
Hatziioannou, T.,
E. Delahaye,
F. Martin,
S. J. Russell, and F. L. Cosset.
1999.
Retroviral display of functional binding domains fused to the amino terminus of influenza hemagglutinin.
Hum. Gene Ther.
10:1533-1544[CrossRef][Medline].
|
| 11.
|
Kabat, D.
1989.
Molecular biology of Friend viral erythroleukemia.
Curr. Top. Microbiol. Immunol.
148:1-42[Medline].
|
| 12.
|
Kozak, S. L.,
D. C. Siess,
M. P. Kavanaugh,
A. D. Miller, and D. Kabat.
1995.
The envelope glycoprotein of an amphotropic murine retrovirus binds specifically to the cellular receptor/phosphate transporter of susceptible species.
J. Virol.
69:3433-3440[Abstract].
|
| 13.
|
Lavillette, D.,
M. Maurice,
C. Roche,
S. J. Russell,
M. Sitbon, and F.-L. Cosset.
1998.
A proline-rich motif downstream of the receptor binding domain modulates conformation and fusogenicity of murine retroviral envelopes.
J. Virol.
72:9955-9965[Abstract/Free Full Text].
|
| 14.
|
MacKrell, A. J.,
N. W. Soong,
C. M. Curtis, and W. F. Anderson.
1996.
Identification of a subdomain in the Moloney murine leukemia virus envelope protein involved in receptor binding.
J. Virol.
70:1768-1774[Abstract].
|
| 15.
|
Matsushima, C. N.,
E. Creutz, and R. H. Kretsinger.
1990.
Polyproline, beta-turn helices. Novel secondary structures proposed for the tandem repeats within rhodopsin, synaptophysin, synexin, gliadin, RNA polymerase II, hordein, and gluten.
Proteins
7:125-155[CrossRef][Medline].
|
| 16.
|
Nussbaum, O.,
A. Roop, and W. F. Anderson.
1993.
Sequences determining the pH dependence of viral entry are distinct from the host range-determining region of the murine ecotropic and amphotropic retrovirus envelope proteins.
J. Virol.
67:7402-7405[Abstract/Free Full Text].
|
| 17.
|
Ott, D., and A. Rein.
1992.
Basis for receptor specificity of nonecotropic murine leukemia virus surface glycoprotein gp70SU.
J. Virol.
66:4632-4638[Abstract/Free Full Text].
|
| 18.
|
Pinter, A.,
T.-E. Chen,
A. Lowy,
N. G. Cortez, and S. Siligari.
1986.
Ecotropic murine leukemia virus-induced fusion of murine cells.
J. Virol.
57:1048-1054[Abstract/Free Full Text].
|
| 19.
|
Takeuchi, Y.,
F. L. Cosset,
P. J. Lachmann,
H. Okada,
R. A. Weiss, and M. K. L. Collins.
1994.
Type C retrovirus inactivation by human complement is determined by both the viral genome and the producer cell.
J. Virol.
68:8001-8007[Abstract/Free Full Text].
|
| 20.
|
Urry, D. W.
1988.
Entropic elastic processes in protein mechanisms. II. Simple (passive) and coupled (active) development of elastic forces.
J. Protein Chem
7:1-34[CrossRef][Medline].
|
| 21.
|
Valsesia-Wittmann, S.,
F. J. Morling,
B. H. K. Nilson,
Y. Takeuchi,
S. J. Russell, and F.-L. Cosset.
1996.
Improvement of retroviral retargeting by using amino acid spacers between an additional binding domain and the N terminus of Moloney murine leukemia virus SU.
J. Virol.
70:2059-2064[Abstract].
|
| 22.
|
Valsesia-Wittmann, S.,
F. J. Morling,
B. H. K. Nilson,
Y. Takeuchi,
S. J. Russell, and F.-L. Cosset.
1997.
Receptor cooperation in retrovirus entry: recruitment of an auxiliary entry mechanism after retargeted binding.
EMBO J.
6:1214-1423[CrossRef].
|
| 23.
|
Zavorotinskaya, T., and L. M. Albritton.
1999.
Suppression of a fusion defect by second site mutations in the ecotropic murine leukemia virus surface protein.
J. Virol.
73:5034-5042[Abstract/Free Full Text].
|
Journal of Virology, September 2001, p. 8478-8486, Vol. 75, No. 18
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.18.8478-8486.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Qian, Z., Albritton, L. M.
(2004). An Aromatic Side Chain Is Required at Residue 8 of SU for Fusion of Ecotropic Murine Leukemia Virus. J. Virol.
78: 508-512
[Abstract]
[Full Text]
-
Martin, F., Chowdhury, S., Neil, S. J., Chester, K. A., Cosset, F.-L., Collins, M. K.
(2003). Targeted Retroviral Infection of Tumor Cells by Receptor Cooperation. J. Virol.
77: 2753-2756
[Abstract]
[Full Text]