Previous Article | Next Article 
Journal of Virology, September 2001, p. 8469-8477, Vol. 75, No. 18
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.18.8469-8477.2001
DNA Vaccination with the Hantaan Virus M Gene Protects Hamsters
against Three of Four HFRS Hantaviruses and Elicits a High-Titer
Neutralizing Antibody Response in Rhesus Monkeys
J. W.
Hooper,*
D. M.
Custer,
E.
Thompson, and
C. S.
Schmaljohn
Virology Division, United States Army Medical
Research Institute of Infectious Diseases, Fort Detrick, Maryland 21702
Received 12 March 2001/Accepted 11 June 2001
 |
ABSTRACT |
Four hantaviruses
Hantaan virus (HTNV), Seoul virus (SEOV),
Dobrava virus (DOBV) and Puumala virus
are known to cause hemorrhagic fever with renal syndrome (HFRS) in Europe and Asia. HTNV causes the
most severe form of HFRS (5 to 15% case-fatality rate) and afflicts
tens of thousands of people annually. Previously, we demonstrated that
DNA vaccination with a plasmid expressing the SEOV M gene elicited
neutralizing antibodies and protected hamsters against infection with
SEOV and HTNV. Here, we report the construction and evaluation of a DNA
vaccine that expresses the HTNV M gene products, G1 and G2. DNA
vaccination of hamsters with the HTNV M gene conferred sterile
protection against infection with HTNV, SEOV, and DOBV. DNA vaccination
of rhesus monkeys with either the SEOV or HTNV M gene elicited high
levels of neutralizing antibodies. These are the first immunogenicity
data for hantavirus DNA vaccines in nonhuman primates. Because a
neutralizing antibody response is considered a surrogate marker for
protective immunity in humans, our protection data in hamsters
combined with the immunogenicity data in monkeys suggest that
hantavirus M gene-based DNA vaccines could protect humans against the
most severe forms of HFRS.
 |
INTRODUCTION |
Hantaan virus (HTNV) (genus
Hantavirus, family Bunyaviridae) is the causative
agent of the most severe form of a rodent-borne disease known as
hemorrhagic fever with renal syndrome (HFRS). Other hantaviruses that
are known to cause HFRS include Seoul virus (SEOV), which causes
disease primarily in Asia, and Dobrava virus (DOBV) and Puumala virus
(PUUV), which cause disease in Europe, Scandinavia, and western Russia
(19). In addition, several other hantaviruses have been
associated with outbreaks of a highly lethal disease, hantavirus
pulmonary syndrome (HPS), in the Americas (20). Because
hantaviruses can cause epidemics with high morbidity, or outbreaks with
high case-fatality rates, and because there is no proven therapy for
hantaviral disease, a safe and effective vaccine(s) against
hantaviruses is needed.
Hantavirus virions are enveloped particles that contain a tripartite
genome consisting of three negative-sense RNA segments (21). The large (L) segment encodes the RNA-dependent RNA
polymerase the small (S) segment encodes the nucleocapsid protein (N)
and the medium (M) segment encodes a polypeptide that is
cotranslationally cleaved to yield two membrane-associated
glycoproteins, G1 and G2. G1 and G2 form oligomers that comprise the
surface morphologic units of the virion and are the targets of
neutralizing antibodies (1, 9, 29). Passive transfer of
neutralizing antibodies protects newborn rats (29),
suckling mice (2), or hamsters (24) against
infection. N-specific antibodies are neither neutralizing nor protective.
We previously demonstrated that DNA vaccination with a plasmid
containing a cDNA representing the SEOV M segment (pWRG/SEO-M) elicited
neutralizing antibody responses in mice and hamsters (11).
In a hamster infection model, we demonstrated that gene gun vaccination
with pWRG/SEO-M, but not with a plasmid containing a cDNA representing
the SEOV S segment, protected hamsters against infection with SEOV and
HTNV (11, 12).
Here we report the development of a HTNV M DNA vaccine. This vaccine
expresses the G1 and G2 proteins of HTNV, elicits neutralizing antibodies, and protects hamsters against infection with three of the
four hantaviruses known to cause HFRS. More importantly, we demonstrate
for the first time that both the SEOV M and HTNV M DNA vaccines elicit
high-titer neutralizing antibody responses in rhesus macaques. These
nonhuman primate data are an important contribution to the development
of a DNA vaccine to protect humans against hantaviral disease.
 |
MATERIALS AND METHODS |
Viruses, cells, medium, and MAbs.
HTNV strain 76-118 (14), SEOV strain SR-11 (13), DOBV
(4) and PUUV strain K27 (26) were propagated
in Vero E6 cells (Vero C1008; ATCC CRL 1586). Transient-expression
experiments were performed with COS cells (COS-7; ATTC CRL1651). Both
cell types were maintained in Eagle minimal essential medium with
Earle's salts (EMEM) containing 10% fetal bovine serum, 10 mM HEPES
(pH 7.4), and the antibiotics penicillin (100 U/ml), streptomycin (100 µg/ml), and gentamicin (50 µg/ml) (cEMEM) at 37°C in a 5% CO2 incubator.
The HTNV G1-specific monoclonal antibody (MAb) 6D4 and the G2-specific
MAb 23G10 were described previously (1).
Construction of hantavirus M gene DNA vaccine plasmids.
Construction of the SEOV M DNA vaccine plasmid, pWRG/SEO-M, was as
described previously (11).
To make pWRG/SEO-M(x), DNA encoding the SEOV G1 and G2 proteins was
amplified by PCR from pWRG/SEO-M by using a forward primer
(primer1-24,
5'-GGCCGCGGCCGCGGATCTGCAGGAATTCGGCACGAGAGTAGTAGACTCCGCAAGAAACAGCA)
and a reverse primer (SEOMX,
5'-GCGCGGATCCAGATTGGGAGATAGAAGAGAG).
The PCR product was cut
with
NotI and
BamHI and then ligated into
NotI-
BglII-cut pWRG7077 vector. This clone was
made to remove
undesirable cloning artifact DNA (~100 nucleotides of
the simian
immunodeficiency virus
nef gene) found between
the
BamHI and
BglII
sites of pWRG7077. Removing
this sequence had no effect on expression
of cloned genes (data not
shown).
The HTNV M DNA vaccine plasmid, pWRG/HTN-M, was constructed essentially
as follows. First, DNA encoding HTNV G1 and G2 was
cut from pTZ19RHTNMm
(
22) as a
BglII fragment and ligated into
BamHI-cut pWRG7077 vector. This plasmid expressed G2 but not
G1
(data not shown). Next, the
NotI-
PshAI
fragment of this plasmid,
which contained the 5' end of the M gene, was
excised and replaced
with DNA amplified by PCR (from a pUC18 plasmid
containing a full-length
HTNV M gene cloned by reverse
transcriptase-PCR cloning from viral
RNA), using primer1-24 (see above)
and a reverse primer (M5B,
5'-TCAGGACTCCTGTCATGCAATAAGATCTC).
The reverse primer included
silent nucleotide changes in the HTNV
M gene that created a
BglII
site used for diagnostic
purposes. The PCR product was cut with
NotI and
PshAI and ligated into the
NotI-
PshAI-cut plasmid to
create pWRG/HTN-M.
pWRG/HTN-M(x) was constructed by using primer1-24 and a reverse primer
(HTNMX, 5'-GCGCGGATCCGTTTGTGGTTAGAAAGCTAC) to PCR amplify
the HTNV M gene from pWRG/HTN-M. PCR product was cut with
NotI
and
BamHI and ligated into the
NotI-
BglII-cut pWRG7077 vector.
This clone was
identical to pWRG/HTN-M; however, a portion of
the 3'-untranslated
region of the gene and the vector sequence
between
BamHI and
BglII was
removed.
Plasmid DNA was purified by using Qiagen Maxiprep DNA purification kits
according to the manufacturer's
directions.
Immunoprecipitation.
COS cells grown in T-25 cell culture
flasks were transfected with 5 µg of plasmid DNA with Fugene6
(Boehringer Mannheim). After 24 h, expression products were
radiolabeled with Promix ([35S]methionine and
[35S]cysteine; Amersham) and immunoprecipitated as
described previously (25). Reduced samples were run on 4 to 12% bis-Tris sodium dodecyl sulfate polyacrylamide gel
electrophoresis gradient gels with morpholinepropanesulfonic acid
running buffer (NuPage), at a 200-V constant voltage.
Vaccinations.
Gene gun cartridges (~0.5 µg of plasmid
DNA coated on 0.5 mg of gold) were prepared, and outbred golden Syrian
hamsters were gene gun vaccinated as described previously
(11). Briefly, each vaccination consisted of four gene gun
(Powderject-XR Delivery Device; Powderject Vaccines, Inc.)
administrations (four cartridges) at nonoverlapping sites on the shaved
abdominal epidermis using 400 lb/in2 of helium pressure.
Hamsters were vaccinated three times at 3-week intervals. Rhesus
macaques were vaccinated with the same type of cartridges and the same
gene gun conditions used to vaccinate the hamsters; however, the
monkeys received eight administrations per vaccination, rather than
four. Hamsters and monkeys were anesthetized during the nonpainful gene
gun procedure, which only results in mild erythema.
Rhesus macaques were vaccinated with a recombinant vaccinia virus,
rVV/HTN-M+S, by the method used to vaccinate humans in
a phase II
clinical trial (
17). The vaccine (3.4 × 10
7 PFU in 0.5 ml of PBS) was injected subcutaneously into
the right
lateral upper arm with a 26G 3/8-in. needle. After 42 days,
the
monkeys received an identical vaccination on the left
arm.
Plaque reduction neutralization tests (PRNT).
Neutralization
assays were performed essentially as previously described (7,
10). Heat-inactivated (56°C, 30 min) serum samples were
diluted in cEMEM and then combined with an equal volume (111 µl) of
cEMEM containing ~75 PFU of virus and 10% guinea pig complement
(catalog no. ACL-4051; Accurate Chemical and Scientific Corp.). This
mixture was incubated overnight at 4°C, and then a plaque assay was
performed exactly as described previously, using 7-day-old Vero E6
monolayers in six-well plates (11). HTNV and SEOV PRNT
were stained with neutral red (Gibco-BRL) after 1 week and PUUV and
DOBV PRNT were stained after 9 days. Plaques were counted 2 days
(37°C) after staining.
Challenge with hantaviruses.
Adult, female, Syrian hamsters
(Charles River) were injected intramuscularly (i.m.; caudal thigh,
25-gauge needle) with the indicated hantavirus diluted in 0.2 ml of
sterile PBS (pH 7.4). The challenge dose for each virus was 2,000 PFU.
This dose is ~1,000 50% infective doses (ID50) for HTNV
and SEOV, ~100 ID50 for DOBV, and ~10 ID50
for PUUV (J. W. Hooper, unpublished data). At 28 days after
challenge, the hamsters were anesthetized and exsanguinated by cardiac
puncture. Pre- and postchallenge sera were evaluated for the presence
of N-specific antibodies by enzyme-linked immunosorbent assay (ELISA)
and for the presence of neutralizing antibodies by PRNT. Detecting
postchallenge N-specific antibody indicated that the hamster was
infected with the challenge virus.
This animal research was conducted in accordance with procedures
described in the 1996
Guide for the Care and Use of Laboratory Animals (National Institutes of Health, Bethesda, Md.). The
facilities
are fully accredited by the American Association for
Accreditation
of Laboratory Animal
Care.
N-specific ELISA.
The ELISA used to detect N-specific
antibodies was previously described (10, 11). The antigen
consisted of a truncated SEOV N (amino acids 1 to 117) or truncated
PUUV N (amino acids 1 to 117) expressed as a histidine-tagged fusion
protein by using the pRSET plasmid (Invitrogen) in Escherichia
coli BL21(DE3) (Novagen, Inc.) and purified by affinity
chromatography on Ni-nitrilotriacetic acid columns (Qiagen). A negative
control antigen (pET19B plasmid expressing the Ebola virus nucleocapsid
protein) was prepared by the same affinity chromatography method. The
secondary antibody was horseradish peroxidase-labeled goat anti-hamster
antibody (catalog no. 14-22-06; Kirkegaard & Perry Laboratories). The
substrate was tetramethylbenzidine substrate (catalog no. 50-76-04;
Kirkegaard & Perry Laboratories). The colorimetric reaction was stopped
by adding Stop solution (catalog no. 50-85-04, Kirkegaard & Perry Laboratories), and the optical density (OD) at 450 nm was determined. Nonspecific binding was controlled for by subtracting OD values obtained on negative control antigen from OD values obtained on the
hantavirus N antigen. Endpoint titers were determined as the highest
dilution with an OD greater than the mean OD value of serum samples
from negative control serum sample wells plus three standard
deviations. The SEOV N antigen was used to detect HTNV N-, DOBV N-, and
SEOV N-specific antibodies. The PUUV N was used to detect PUUV
N-specific antibodies.
 |
RESULTS |
Expression of G1 and G2 from HTNV M DNA vaccine.
cDNA
representing the HTNV M genome segment was cloned into a
cytomegalovirus promoter-based expression plasmid, pWRG7077, to create
pWRG/HTN-M. Radioimmunoprecipitation assay (RIPA) experiments using
polyclonal antibodies and MAbs indicated that both the G1 and G2
proteins were transiently expressed in cells transfected with
pWRG/HTN-M (Fig. 1).

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 1.
Transient expression of HTNV G1 and G2. COS cells were
transfected with pWRG/HTN-M or a negative control plasmid (pWRG7077)
and, after 24 h, radiolabeled cell lysates were prepared for
analysis by RIPA. Expression products were immunoprecipitated with a
polyclonal mouse hyperimmune ascitic fluid against HTNV (HTN HMAF), a
G1-specific MAb (MAb 6D4), or a G2-specific MAb (MAb 23G10). Molecular
size markers (M) are shown in the first lane and sizes in kilodaltons
are indicated to the left. The position of G1 and G2 are shown at the
right.
|
|
DNA vaccination with pWRG/HTN-M elicits neutralizing antibodies and
protects hamsters against infection with HTNV.
To determine if the
HTNV M DNA vaccine plasmid was immunogenic, we used a gene gun to
vaccinate hamsters with either pWRG/HTN-M (pWRG/HTN-M or pWRG/HTN-M(x);
see Materials and Methods) or a negative control. Three weeks after the
final vaccination, the hamsters were bled and sera were evaluated for
neutralizing antibodies by PRNT. In two separate experiments, all of
the hamsters vaccinated with pWRG/HTN-M developed HTNV-neutralizing
antibody responses (Fig. 2). Titers (80%
PRNT [PRNT80]) ranged from 20 to 1,280 with a geometric
mean titer (GMT) of 104 in the first experiment and from 20 to 10,240 with a GMT of 493 in the second experiment. Negative control groups
remained seronegative. Thus, gene gun vaccination with pWRG/HTN-M was
immunogenic in hamsters.

View larger version (66K):
[in this window]
[in a new window]
|
FIG. 2.
DNA vaccination with plasmid expressing HTNV G1 and G2
protects against HTNV infection. The results of two independent
experiments are combined in this figure. In the first experiment, one
group of hamsters (659 to 666) was vaccinated with pWRG/HTN-M, and a
second negative control group (667 to 674) was vaccinated with the
vector plasmid, pWRG7077. In the second experiment one group of
hamsters (2101 to 2108) was vaccinated with a slightly modified
plasmid, pWRG/HTN-M(x), and a second negative control group (2109 to
2116) remained unvaccinated. Three weeks after the final vaccination,
prechallenge serum samples were obtained, and the hamsters were
challenged with HTNV. Postchallenge serum samples were collected 28 days after challenge. The pre- and postchallenge serum samples were
tested for N-specific antibodies by anti-N ELISA and for neutralizing
antibodies by PRNT. The pre- and postchallenge endpoint antibody titer
for each hamster is shown. For each experiment, the prechallenge
homologous PRNT80 titers were sorted from highest to lowest
(left to right).
|
|
To determine the protective efficacy of pWRG/HTN-M, we used an
infection model described previously (
11). The model
involves
challenging vaccinated hamsters with virus and, after 4 weeks,
using serological assays to detect evidence of infection. Specifically,
if a challenged hamster developed antibodies to hantavirus N protein
(which is not a component of the vaccine), then that hamster was
considered to be infected. On the other hand, if a challenged
hamster
failed to develop a N-specific antibody response, then
that hamster was
considered not to be infected (i.e., protected
against infection). A
>4-fold increase in the neutralizing antibody
response after challenge
also served as a marker for evidence
of
infection.
Vaccinated hamsters were challenged with 2,000 PFU (the
ID
50 is approximately 2 PFU; Hooper, unpublished) of HTNV
i.m. At
4 weeks after challenge, blood samples were collected, and sera
were tested for N-specific antibodies by ELISA and for neutralizing
antibodies by PRNT. All of the hamsters that were vaccinated with
pWRG/HTN-M were protected against infection as defined by an absence
of
a postchallenge N-specific antibody response (Fig.
2). In addition,
the
pre- and postchallenge PRNT titers differed by

4-fold. In
contrast,
all of the negative control hamsters, whether they were
vaccinated with
pWRG7077 or remained unvaccinated, were infected,
as evidenced by the
development of N-specific antibodies and neutralizing
antibodies
postchallenge (Fig.
2). Thus, gene gun vaccination
with
pWRG/HTN-M [or pWRG/HTN-M(x)] protected against productive
infection with HTNV, even when the prechallenge PRNT
80
titer was
as low as
20.
DNA vaccination with either pWRG/SEO-M or pWRG/HTN-M cross-protects
against challenge with heterologous hantaviruses.
Having
determined that our SEOV M (11, 12) and HTNV M gene-based
DNA vaccines were capable of protecting hamsters against infection with
homologous virus, we wanted to determine if either of these vaccines
could cross-protect against other HFRS-associated hantaviruses. We
first measured the cross-neutralizing activities of sera from HFRS
hantavirus-infected hamsters and of hamsters vaccinated with either the
SEOV M or HTNV M vaccine (Table 1). We
found that sera from SEOV-infected hamsters had a low level of HTNV
neutralizing activity and no detectable DOBV or PUUV neutralizing activity. Sera from HTNV- or DOBV-infected hamsters exhibited a low
level of neutralizing antibodies against SEOV, DOBV, and PUUV. Sera
from PUUV-infected hamsters failed to neutralize HTNV or SEOV and had a
barely detectable DOBV-neutralizing activity. The sera from vaccinated
hamsters exhibited greater levels of cross-neutralizing activity than
the sera from the infected hamsters. Vaccination with either pWRG/SEO-M
or pWRG/HTN-M elicited an antibody response that cross-neutralized
SEOV, HTNV, and DOBV, but not PUUV.
We previously demonstrated that the SEOV M DNA vaccine protected most
hamsters not only from SEOV but also from challenge
with HTNV
(
12). To confirm these findings and to further evaluate
the capacity of the SEOV M vaccine to cross-protect against other
hantaviruses, we tested pWRG/SEO-M for protective efficacy against
HTNV, DOBV, and PUUV. The results of this study indicated that
most
hamsters vaccinated with pWRG/SEO-M were protected against
HTNV and
DOBV, but not PUUV, as determined by the absence of anti-N
antibody
response after challenge (Fig.
3). A
homologous PRNT
80 titer of >160 protected against HTNV,
and a titer of

80 protected
against DOBV, but a titer of as high as
1,280 failed to protect
against PUUV (Fig.
3A, B, and C). One
vaccinated and one control
hamster failed to respond to the PUUV
challenge, probably because
the PUUV challenge dose was 10 ID
50, whereas it was 10 to 100
times higher for the other
viruses.

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 3.
Cross-protection. Hamsters were vaccinated with the
indicated plasmid [pWRG/SEO-M, pWRG/HTN-M(x), or a negative control],
and then challenged with the indicated virus. The negative control
hamsters in panels A, B, and C were vaccinated with a pWRG7077-based
plasmid; the negative control hamsters in panels D and E remained
unvaccinated. Pre- and postchallenge serum samples were tested for
anti-N antibodies by anti-N ELISA and for neutralizing antibodies by
PRNT. PRNT80 titers for homologous virus and
PRNT50 titers for heterologous virus were determined. The
prechallenge ( ) and postchallenge
( )
endpoint antibody titers for each hamster are shown. Prechallenge
homologous PRNT80 titers (sorted from highest to lowest,
left to right) are shown as lines with symbols ( ). The
identification code for each hamster is shown on the x axis.
The HTNV PRNT and anti-N ELISA data for hamsters 943, 944, 945, and 948 were published previously (11).
|
|
We similarly tested the capacity of pWRG/HTN-M to cross-protect against
SEOV or DOBV. The results indicated that vaccination
with pWRG/HTN-M
elicited cross-protective immunity against both
SEOV and DOBV (Fig.
3D
and E). Homologous PRNT
80 titers of

640
were associated
with protection of hamsters against SEOV, and
titers of

320 protected
against DOBV. We did not measure the
capacity of vaccination with
pWRG/HTN-M to protect against PUUV
infection because of our findings
that the SEOV DNA vaccine did
not protect (Fig.
3C) and because a
vaccinia virus-vectored HTNV
vaccine did not protect hamsters against
PUUV infection (
8).
Together, these data indicate that DNA
vaccination with either
pWRG/SEO-M or pWRG/HTN-M cross-protected
against three of the
four HFRS-associated hantaviruses: SEOV, HTNV, and
DOBV.
DNA vaccination with pWRG/SEO-M or pWRG/HTN-M elicits a high-titer
neutralizing antibody response in nonhuman primates.
Our
vaccination data with plasmids expressing the SEOV M gene or HTNV M
gene suggest that these vaccines might be efficacious in humans. As a
further step toward the clinical development of these vaccines, we
tested their capacity to elicit antibody responses in nonhuman
primates. Two rhesus macaques were vaccinated with the SEOV M DNA
vaccine, and three rhesus macaques were vaccinated with the HTNV M DNA
vaccine. As negative controls, three monkeys were vaccinated with
pWRG7077 expressing irrelevant genes and, as positive controls, three
monkeys were vaccinated with a recombinant vaccinia virus expressing
the HTNV M and S genes, rVV/HTN-M+S (23). rVV/HTN-M+S was
previously shown to elicit HTNV-specific immunity, including
neutralizing antibodies, in hamsters (8) and to elicit
neutralizing antibodies in humans (17). The DNA vaccines
were administered three times at 3-week intervals. The rVV/HTN-M+S
vaccine was administered by the dose and schedule used in the human
phase II trials (i.e., a primary subcutaneous vaccination followed by a
boost at day 42) (17).
Three weeks after the first vaccination, two of the three monkeys
vaccinated with pWRG/HTN-M(x) demonstrated neutralizing
antibodies
(Fig.
4). Three weeks after the second
gene gun vaccination,
all of the monkeys vaccinated with either
pWRG/SEO-M(x) or pWRG/HTN-M(x)
demonstrated detectable levels of
neutralizing antibodies. Three
weeks after the third vaccination, high
titers of neutralizing
antibodies were detected in all of the monkeys
vaccinated with
pWRG/SEO-M(x) or pWRG/HTN-M(x). Negative
control-vaccinated monkeys
did not develop neutralizing antibodies.
Monkeys vaccinated with
rVV/HTN-M+S failed to develop a neutralizing
antibody response
after one vaccination but did develop neutralizing
antibodies
after the 42-day boost. Three weeks after the final
vaccination,
the PRNT
80 GMTs of the monkeys vaccinated with
pWRG/SEO-M(x),
pWRG/HTNM(x), or rVV/HTN-M+S, were 905, 2,032, and 160, respectively.
These data demonstrate, for the first time, that DNA
vaccines
expressing hantaviral M gene products are immunogenic in
nonhuman
primates and elicit very high levels of neutralizing
antibodies.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 4.
DNA vaccination with plasmid expressing SEOV or HTNV G1
and G2 elicits high-titer neutralizing antibody responses in rhesus
monkeys. Rhesus monkeys were vaccinated with either pWRG/SEO-M(x),
pWRG/HTN-M(x), negative control DNA, or rVV/HTN-M+S by the indicated
route as described in Materials and Methods. Serum samples were
obtained before vaccination (column P) and then 3 weeks after the first
(column 1), second (column 2), and third (column 3) vaccinations. The
PRNT titer represents the reciprocal serum dilution that reduced virus
plaque number by 80% or 50%. The live virus vaccinia recombinant
vaccine (rVV/HTN-M+S) was administered only two times at a 6- week
interval. The identification code for each monkey is shown below its
respective plot.
|
|
To evaluate the duration of immunity elicited by the DNA vaccine and
the recombinant vaccinia virus vaccine, sera from vaccinated
monkeys
were collected 2, 4, 6, and 8 months after the final vaccination
and
then tested for neutralizing activity. Titers in individual
DNA-vaccinated monkeys dropped two- to fourfold in the first 2
months
after the final vaccination and then decreased slowly over
the next
several months. After 8 months, all of the monkeys vaccinated
with
pWRG/SEO-M(x) or pWRG/HTN-M(x) still had detectable levels
of
neutralizing antibodies (PRNT
50% GMT = 80). In
contrast,
monkeys vaccinated with the positive control vaccine,
rVV/HTN-M+S,
exhibited little or no detectable neutralizing antibodies
(i.e.,
PRNT
50 
20) 4 to 8 months after the final
vaccination.
DNA vaccination of nonhuman primates with pWRG/SEO-M or pWRG/HTN-M
vaccines elicits antibody responses that cross-neutralize DOBV.
We
tested the sera from the vaccinated monkeys for cross-neutralizing
activity by PRNT (Table 2). All of the
monkeys vaccinated with either pWRG/SEO-M(x) or pWRG/HTNV-M(x) had
antibodies that cross-neutralized DOBV. rVV/HTN-M+S vaccinated monkeys
also had DOBV-cross-neutralizing antibodies, albeit at lower titers.
Monkeys vaccinated with pWRG/SEO-M(x) had weak or no HTNV-neutralizing antibody responses and monkeys vaccinated with pWRG/HTN-M(x) had weak
or no SEOV-neutralizing antibody responses. Only one monkey (monkey
CH32), which was DNA vaccinated with pWRG/SEO-M(x), demonstrated a
detectable level of PUUV-neutralizing antibodies.
 |
DISCUSSION |
Our previous results with the SEOV M DNA vaccine
(11), along with the results reported here demonstrating
immunogenicity and protective efficacy of the HTNV M DNA vaccine, make
a strong case for the use of a full-length M gene in DNA vaccines
against other hantaviruses. The HTNV M DNA vaccine is only the second hantavirus DNA vaccine that has been shown to express both the G1 and
G2 proteins (the other was the SEOV M DNA vaccine plasmid [11]). Difficulties in either cloning intact hantavirus
M genes, expressing intact G1 and G2, or eliciting an immune response
in DNA vaccinated animals have befallen us and been reported by others (5). It remains unclear whether or not G1 alone, G2 alone, or fragments of the glycoproteins can elicit neutralizing antibodies and protect against infection. Vaccination with recombinant
baculovirus-infected cell lysates containing G1 or G2 alone, and
recombinant vaccinia viruses expressing G1 or G2 alone, failed to
elicit neutralizing antibody and exhibited incomplete protection in a
hamster infection model (24). These data suggest that a
full-length M gene capable of expressing G1 and G2 may be required for
protective immunity. In contrast, Bharadwaj et al. reported low levels
(1:10 to 1:20) of neutralizing antibodies after i.m. needle injection
of mice with DNA vaccine plasmids containing short (~166-amino-acid)
sections of the M gene of Sin nombre virus (SNV), an HPS-associated
hantavirus (5). This finding suggests that eliciting a
neutralizing antibody response not only does not require a full-length
M gene but also occurs when only fragments of G1 or G2 are expressed.
Further studies are needed to clarify the importance of the
conformational integrity of G1 and G2 for immunogenicity.
There are four hantaviruses known to cause HFRS and at least six are
known to cause HPS, so information on cross-neutralization and
cross-protection among hantaviruses is important for the rational design of cross-protective vaccines. Investigators have evaluated the
capacity of sera from various species (including humans) infected with
hantaviruses to cross-neutralize other hantaviruses (3, 7, 15,
16, 18). Different species, and different individuals within a
species, appear to exhibit differing levels of cross-neutralizing antibodies. In general, data from these experiments indicate that sera
from HTNV-, SEOV-, or DOBV-infected individuals share
cross-neutralizing antibodies, albeit with a >4-fold difference in
titer among the serotypes, whereas sera from PUUV-infected individuals
exhibit few or no SEOV-, HTNV-, or DOBV-cross-neutralizing antibodies. Our data obtained with sera from infected or DNA-vaccinated hamsters are consistent with earlier findings. We observed a greater level of
cross-neutralizing antibodies in the pooled sera from the
DNA-vaccinated hamsters than in the pooled sera from infected hamsters.
This may reflect a qualitative difference between the antibodies
elicited after DNA vaccination and the antibodies elicited by infection or it may simply reflect a quantitative difference in antibody levels.
It is noteworthy that high homologous neutralizing antibody levels in
vaccinated hamsters did not necessarily correlate with cross-neutralizing activity (Fig. 3).
The cross-neutralization tests with the hamster serum pools suggested
that if neutralizing antibodies could predict protective immunity, then
vaccination with either pWRG/SEO-M or pWRG/HTN-M would protect against
SEOV, HTNV, and DOBV, but not PUUV and this we found, in general, to be
true. The data in Fig. 3 indicate that the presence of
cross-neutralizing antibodies correlated with a protective effect with
a single exception. Hamster 2119 exhibited cross-neutralizing
antibodies, but was not protected by definition because there was a
detectable anti-N response after challenge. However, the absence of
detectable levels of cross-neutralizing antibodies did not necessarily
predict a lack of protection. Examples of the latter case can be found
in Fig. 3, hamsters 1437, 1434, 2122, and 2133. It is possible that
cross-neutralizing antibodies are present but are not detected due to
limitations of the assay or, more likely, that responses other than
neutralizing antibody are also protective.
Whether the neutralizing antibodies elicited by DNA vaccination is
necessary and/or sufficient to confer protection, or only a surrogate
marker to predict protection, will require passive-transfer experiments
involving sera from DNA-vaccinated animals. We have not evaluated the
cell-mediated immune response elicited by DNA vaccination with
pWRG/SEO-M or pWRG/HTN-M, but we suspect that there is a response that
plays a role in protection. In support of this, another study
demonstrated that a lymphoproliferative response was elicited in mice
injected i.m. with DNA encoding ~166 amino acids of the SNV G1 or G2
proteins, indicating that a cell-mediated response to epitopes of both
G1 and G2 can occur (5). The cell-mediated response to DNA
vaccination with the full-length G1 and G2 proteins and its role in
protection remain to be determined.
In this study, we demonstrated that vaccination with either pWRG/SEO-M
or pWRG/HTN-M cross-protected against SEOV, HTNV, and DOBV. Other
experimental hantavirus vaccines can cross-protect. For example, a
vaccinia virus recombinant expressing the HTNV G1, G2, and N
(rVV/HTN-M+S) cross-protected against infection with SEOV but not PUUV
(8), and vaccinia virus recombinants expressing the SEOV
G1 and G2, or N, cross-protected against HTNV (27). Ours
is the first report of any vaccine protecting against DOBV.
All previous data concerning the immunogenicity and protective efficacy
of DNA vaccines against hantaviruses have been performed in rodents.
Here, were report for the first time, the results of experiments
performed in nonhuman primates. The hantavirus M gene-based DNA
vaccines administered by gene gun not only elicited positive responses
in rhesus macaques but also elicited levels of neutralizing antibodies
that were very high. When we combined the serological data from the
SEOV and HTNV M gene DNA thrice-vaccinated monkeys, the
PRNT80 GMT was 1,470. This neutralizing antibody response
was almost 10 times greater than that elicited by the recombinant
vaccinia virus vaccine (PRNT80 GMT = 160, PRNT50 GMT = 320), which was similar to the
neutralizing antibody responses previously reported for humans
(PRNT50 GMT = 160) (17). In China, where
several killed virus vaccines against hantaviruses have been developed
and tested in humans, the PRNT assay is used to evaluate the potency of
the vaccine (28, 30). Most of the inactivated virus
vaccines made in cell culture elicit neutralizing antibodies in 90 to
100% of the human vaccinees after three doses (GMT
100). and
the percentage of seropositive individuals drops to ~50% 6 months
after the final boost.
Eight months after the final gene gun vaccination, neutralizing
antibodies could still be detected in all of the monkeys vaccinated with either pWRG/SEO-M(x) or pWRG/HTN-M(x). In comparison, monkeys vaccinated with the recombinant vaccinia virus vaccine had low or
undetectable levels of neutralizing antibodies after 4 months (Fig.
5). We plan to monitor the kinetics of
the decline in antibody levels of the vaccinated monkeys to determine
if a low level of neutralizing antibodies is maintained beyond 8 months
or if the levels fall below our level of detection in a definable
period of time.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 5.
Neutralizing antibodies elicited by DNA vaccination are
still detected in rhesus monkeys 8 months after the final vaccination.
Rhesus monkeys vaccinated with the indicated vaccine were bled 3 weeks
after each vaccination and then at 2, 4, 6, and 8 months after the
final vaccination (weeks 14, 22, 30, and 38, respectively). The
homologous neutralizing antibody response for the indicated week after
the first vaccination (week 0) was evaluated by PRNT. Each line
represents an individual monkey. The week 9 data are also presented in
Fig. 4.
|
|
We have directed our efforts toward the development of a recombinant
hantavirus vaccine(s) that is intended to be safer and more immunogenic
than the killed-virus vaccines currently being tested in Asia. Our data
suggest that it might be possible to elicit a more robust and
longer-lasting neutralizing antibody response using a vaccine platform
that entails the expression of G1 and G2 within the cells of the
vaccinee (e.g., DNA vaccine) rather than as exogenous proteins (e.g.,
beta-propiolactone-treated virions combined with adjuvant). In support
of this, others have reported that a DNA vaccine containing the
Japanese encephalitis virus (JEV) envelope gene elicted a stronger and
longer-lasting anti-envelope antibody response than the currently used
inactivated JEV vaccine (6).
In summary, we have demonstrated that gene gun vaccination of hamsters
with DNA vaccines containing the hantavirus M gene confers sterilizing
immunity against three of the four hantaviruses that cause HFRS and
elicits very high levels of neutralizing antibodies in monkeys. Because
a neutralizing antibody response is considered a surrogate marker for
protective immunity in humans, our protection data in hamsters combined
with the immunogenicity data in monkeys suggest that hantavirus M
gene-based DNA vaccines could protect humans against the most severe
forms of HFRS.
 |
ACKNOWLEDGMENTS |
The gene gun (Powderject Delivery Device) and pWRG7077 were
kindly provided by Powderject Vaccine, Inc. The plasmids used to
prepare N-specific ELISA antigen, pSEOSXdelta and pPUUSXdelta, were
kindly provided by Fredrik Elgh. The negative control ELISA antigen was
kindly provided by Colleen Jonsson.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Virology
Division, U.S. Army Medical Research Institute of Infectious Diseases,
Ft. Detrick, MD 21702. Phone: (301) 619-4101. Fax: (301) 619-2439. E-mail: Jay.Hooper{at}det.amedd.army.mil.
 |
REFERENCES |
| 1.
|
Arikawa, J.,
A. L. Schmaljohn,
J. M. Dalrymple, and C. S. Schmaljohn.
1989.
Characterization of Hantaan virus envelope glycoprotein antigenic determinants defined by monoclonal antibodies.
J. Gen. Virol.
70:615-624[Abstract/Free Full Text].
|
| 2.
|
Arikawa, J.,
J. S. Yao,
K. Yoshimatsu,
I. Takashima, and N. Hashimoto.
1992.
Protective role of antigenic sites on the envelope protein of Hantaan virus defined by monoclonal antibodies.
Arch. Virol.
126:271-281[CrossRef][Medline].
|
| 3.
|
Asada, H.,
K. Balachandra,
M. Tamura,
K. Kondo, and K. Yamanishi.
1989.
Cross-reactive immunity among different serotypes of virus causing haemorrhagic fever with renal syndrome.
J. Gen. Virol.
70:819-25[Abstract/Free Full Text].
|
| 4.
|
Avsic-Zupanc, T.,
S. Y. Xiao,
R. Stojanovic,
A. Gligic,
G. van der Groen, and J. W. LeDuc.
1992.
Characterization of Dobrava virus: a hantavirus from Slovenia, Yugoslavia.
J. Med. Virol.
38:132-137[Medline].
|
| 5.
|
Bharadwaj, M.,
C. R. Lyons,
I. A. Wortman, and B. Hjelle.
1999.
Intramuscular inoculation of Sin Nombre hantavirus cDNAs induces cellular and humoral immune responses in BALB/c mice.
Vaccine
17:2836-2843[CrossRef][Medline].
|
| 6.
|
Chen, H. W.,
C. H. Pan,
M. Y. Liau,
R. Jou,
C. J. Tsai,
H. J. Wu,
Y. L. Lin, and M. H. Tao.
1999.
Screening of protective antigens of Japanese encephalitis virus by DNA immunization: a comparative study with conventional viral vaccines.
J. Virol.
73:10137-10145[Abstract/Free Full Text].
|
| 7.
|
Chu, Y. K.,
G. Jennings,
A. Schmaljohn,
F. Elgh,
B. Hjelle,
H. W. Lee,
S. Jenison,
T. Ksiazek,
C. J. Peters,
P. Rollin, et al.
1995.
Cross-neutralization of hantaviruses with immune sera from experimentally infected animals and from hemorrhagic fever with renal syndrome and hantavirus pulmonary syndrome patients.
J. Infect. Dis.
172:1581-1584[Medline].
|
| 8.
|
Chu, Y. K.,
G. B. Jennings, and C. S. Schmaljohn.
1995.
A vaccinia virus-vectored Hantaan virus vaccine protects hamsters from challenge with Hantaan and Seoul viruses but not Puumala virus.
J. Virol.
69:6417-6423[Abstract].
|
| 9.
|
Dantas, J. R.,
Y. Okuno,
H. Asada,
M. Tamura,
M. Takahashi,
O. Tanishita,
Y. Takahashi,
T. Kurata, and K. Yamanishi.
1986.
Characterization of glycoproteins of viruses causing hemorrhagic fever with renal syndrome (HFRS) using monoclonal antibodies.
Virology.
151:379-384[CrossRef][Medline].
|
| 10.
|
Elgh, F.,
A. Lundkvist,
O. A. Alexeyev,
H. Stenlund,
T. Avsic-Zupanc,
B. Hjelle,
H. W. Lee,
K. J. Smith,
R. Vainionpaa,
D. Wiger,
G. Wadell, and P. Juto.
1997.
Serological diagnosis of hantavirus infections by an enzyme-linked immunosorbent assay based on detection of immunoglobulin G and M responses to recombinant nucleocapsid proteins of five viral serotypes.
J. Clin. Microbiol.
35:1122-1130[Abstract].
|
| 11.
|
Hooper, J. W.,
K. I. Kamrud,
F. Elgh,
D. Custer, and C. S. Schmaljohn.
1999.
DNA vaccination with hantavirus M segment elicits neutralizing antibodies and protects against seoul virus infection.
Virology
255:269-278[CrossRef][Medline].
|
| 12.
|
Kamrud, K. I.,
J. W. Hooper,
F. Elgh, and C. S. Schmaljohn.
1999.
Comparison of the protective efficacy of naked DNA, DNA-based Sindbis replicon, and packaged Sindbis replicon vectors expressing Hantavirus structural genes in hamsters.
Virology
263:209-219[CrossRef][Medline].
|
| 13.
|
Kitamura, T.,
C. Morita,
T. Komatsu,
K. Sugiyama,
J. Arikawa,
S. Shiga,
H. Takeda,
Y. Akao,
K. Imaizumi,
A. Oya,
N. Hashimoto, and S. Urasawa.
1983.
Isolation of virus causing hemorrhagic fever with renal syndrome (HFRS) through a cell culture system.
Jpn. J. Med. Sci. Biol.
36:17-25[Medline].
|
| 14.
|
Lee, H. W.,
P. W. Lee, and K. M. Johnson.
1978.
Isolation of the etiologic agent of Korean hemorrhagic fever.
J. Infect. Dis.
137:298-308[Medline].
|
| 15.
|
Lee, P. W.,
C. J. Gibbs,
D. C. Gajdusek, and R. Yanagihara.
1985.
Serotypic classification of hantaviruses by indirect immunofluorescent antibody and plaque reduction neutralization tests.
J. Clin. Microbiol.
22:940-944[Abstract/Free Full Text].
|
| 16.
|
Lundkvist, A.,
M. Hukic,
J. Horling,
M. Gilljam,
S. Nichol, and B. Niklasson.
1997.
Puumala and Dobrava viruses cause hemorrhagic fever with renal syndrome in Bosnia-Herzegovina: evidence of highly cross-neutralizing antibody responses in early patient sera.
J. Med. Virol.
53:51-59[CrossRef][Medline].
|
| 17.
|
McClain, D. J.,
P. L. Summers,
S. A. Harrison,
A. L. Schmaljohn, and C. S. Schmaljohn.
2000.
Clinical evaluation of a vaccinia-vectored Hantaan virus vaccine.
J. Med. Virol.
60:77-85[CrossRef][Medline].
|
| 18.
|
Niklasson, B.,
M. Jonsson,
A. Lundkvist,
J. Horling, and E. Tkachenko.
1991.
Comparison of European isolates of viruses causing hemorrhagic fever with renal syndrome by a neutralization test.
Am. J. Trop. Med. Hyg.
45:660-665.
|
| 19.
|
Peters, C. J.,
G. L. Simpson, and H. Levy.
1999.
Spectrum of hantavirus infection: hemorrhagic fever with renal syndrome and hantavirus pulmonary syndrome.
Annu. Rev. Med.
50:531-45[CrossRef][Medline].
|
| 20.
|
Schmaljohn, C., and B. Hjelle.
1997.
Hantaviruses: a global disease problem.
Emerg. Infect. Dis.
3:95-104[Medline].
|
| 21.
|
Schmaljohn, C. S.
1996.
Molecular biology of hantaviruses, p. 63-90.
In
R. M. Elliott (ed.), The Bunyaviridae. Plenum Press, Inc., New York, N.Y.
|
| 22.
|
Schmaljohn, C. S.,
J. Arikawa,
J. M. Dalrymple, and A. L. Schmaljohn.
1989.
Expression of the envelope glycoproteins of Hantaan virus with vaccinia and baculovirus recombinants, p. 58-66.
In
D. Kolakofsky, and B. Mahy (ed.), Genetics and pathogenicity of negative strand viruses. Elsevier Press, Amsterdam, The Netherlands.
|
| 23.
|
Schmaljohn, C. S.,
S. E. Hasty, and J. M. Dalrymple.
1992.
Preparation of candidate vaccinia-vectored vaccines for haemorrhagic fever with renal syndrome.
Vaccine
10:10-13[CrossRef][Medline].
|
| 24.
|
Schmaljohn, C. S.,
Y. K. Chu,
A. L. Schmaljohn, and J. M. Dalrymple.
1990.
Antigenic subunits of Hantaan virus expressed by baculovirus and vaccinia virus recombinants.
J. Virol.
64:3162-3170[Abstract/Free Full Text].
|
| 25.
|
Schmaljohn, C.,
L. Vanderzanden,
M. Bray,
D. Custer,
B. Meyer,
D. Li,
C. Rossi,
D. Fuller,
J. Fuller,
J. Haynes, and J. Huggins.
1997.
Naked DNA vaccines expressing the prM and E genes of Russian spring summer encephalitis virus and Central European encephalitis virus protect mice from homologous and heterologous challenge.
J. Virol.
71:9563-9569[Abstract].
|
| 26.
|
Tkachenko, E. A.,
V. N. Bashkirtsev,
G. van der Groen,
T. K. Dzagurova,
A. P. Ivanov, and E. V. Ryltseva.
1984.
Isolation in Vero-E6 cells of hantavirus from Clethrionomys glareolus captured in the Bashkiria area of the U.S.S.R.
Ann. Soc. Belg. Med. Trop.
64:425-426[Medline].
|
| 27.
|
Xu, X.,
S. L. Ruo,
J. B. McCormick, and S. P. Fisher-Hoch.
1992.
Immunity to hantavirus challenge in Meriones unguiculatus induced by vaccinia-vectored viral proteins.
Am. J. Trop. Med. Hyg.
47:397-404.
|
| 28.
|
Yu, Y.,
Z. Zhu,
Z. Yao, and G. Dong.
1999.
Inactivated cell-culture Hantavirus vaccine developed in China, p. 157-161.
In
J. F. Saluzzo, and B. Dodet (ed.), Factors in the emergence and control of rodent-borne viral diseases (hantavirus and arenal diseases). Elsevier Press, Paris, France.
|
| 29.
|
Zhang, X.-K.,
I. Takashima, and N. Hashimoto.
1989.
Characteristics of passive immunity against hantavirus infection in rats.
Arch. Virol.
105:235-246[CrossRef][Medline].
|
| 30.
|
Zhu, Z. Y.,
H. Y. Tang,
Y. J. Li,
J. Q. Weng,
Y. X. Yu, and R. F. Zeng.
1994.
Investigation on inactivated epidemic hemorrhagic fever tissue culture vaccine in humans.
Chin. Med. J.
107:167-170[Medline].
|
Journal of Virology, September 2001, p. 8469-8477, Vol. 75, No. 18
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.18.8469-8477.2001
This article has been cited by other articles:
-
Taylor, S. L., Frias-Staheli, N., Garcia-Sastre, A., Schmaljohn, C. S.
(2009). Hantaan Virus Nucleocapsid Protein Binds to Importin {alpha} Proteins and Inhibits Tumor Necrosis Factor Alpha-Induced Activation of Nuclear Factor Kappa B. J. Virol.
83: 1271-1279
[Abstract]
[Full Text]
-
Hooper, J. W., Ferro, A. M., Wahl-Jensen, V.
(2008). Immune Serum Produced by DNA Vaccination Protects Hamsters against Lethal Respiratory Challenge with Andes Virus. J. Virol.
82: 1332-1338
[Abstract]
[Full Text]
-
Muranyi, W., Bahr, U., Zeier, M., van der Woude, F. J.
(2005). Hantavirus Infection. J. Am. Soc. Nephrol.
16: 3669-3679
[Full Text]
-
Hooper, J. W., Thompson, E., Wilhelmsen, C., Zimmerman, M., Ichou, M. A., Steffen, S. E., Schmaljohn, C. S., Schmaljohn, A. L., Jahrling, P. B.
(2004). Smallpox DNA Vaccine Protects Nonhuman Primates against Lethal Monkeypox. J. Virol.
78: 4433-4443
[Abstract]
[Full Text]
-
Custer, D. M., Thompson, E., Schmaljohn, C. S., Ksiazek, T. G., Hooper, J. W.
(2003). Active and Passive Vaccination against Hantavirus Pulmonary Syndrome with Andes Virus M Genome Segment-Based DNA Vaccine. J. Virol.
77: 9894-9905
[Abstract]
[Full Text]
-
Ogino, M., Ebihara, H., Lee, B.-H., Araki, K., Lundkvist, A., Kawaoka, Y., Yoshimatsu, K., Arikawa, J.
(2003). Use of Vesicular Stomatitis Virus Pseudotypes Bearing Hantaan or Seoul Virus Envelope Proteins in a Rapid and Safe Neutralization Test. CVI
10: 154-160
[Abstract]
[Full Text]
-
de Carvalho Nicacio, C., Gonzalez Della Valle, M., Padula, P., Bjorling, E., Plyusnin, A., Lundkvist, A.
(2002). Cross-Protection against Challenge with Puumala Virus after Immunization with Nucleocapsid Proteins from Different Hantaviruses. J. Virol.
76: 6669-6677
[Abstract]
[Full Text]