Previous Article | Next Article 
Journal of Virology, September 2001, p. 8469-8477, Vol. 75, No. 18
Virology Division, United States Army Medical
Research Institute of Infectious Diseases, Fort Detrick, Maryland 21702
Received 12 March 2001/Accepted 11 June 2001
Four hantaviruses Hantaan virus (HTNV) (genus
Hantavirus, family Bunyaviridae) is the causative
agent of the most severe form of a rodent-borne disease known as
hemorrhagic fever with renal syndrome (HFRS). Other hantaviruses that
are known to cause HFRS include Seoul virus (SEOV), which causes
disease primarily in Asia, and Dobrava virus (DOBV) and Puumala virus
(PUUV), which cause disease in Europe, Scandinavia, and western Russia
(19). In addition, several other hantaviruses have been
associated with outbreaks of a highly lethal disease, hantavirus
pulmonary syndrome (HPS), in the Americas (20). Because
hantaviruses can cause epidemics with high morbidity, or outbreaks with
high case-fatality rates, and because there is no proven therapy for
hantaviral disease, a safe and effective vaccine(s) against
hantaviruses is needed.
Hantavirus virions are enveloped particles that contain a tripartite
genome consisting of three negative-sense RNA segments (21). The large (L) segment encodes the RNA-dependent RNA
polymerase the small (S) segment encodes the nucleocapsid protein (N)
and the medium (M) segment encodes a polypeptide that is
cotranslationally cleaved to yield two membrane-associated
glycoproteins, G1 and G2. G1 and G2 form oligomers that comprise the
surface morphologic units of the virion and are the targets of
neutralizing antibodies (1, 9, 29). Passive transfer of
neutralizing antibodies protects newborn rats (29),
suckling mice (2), or hamsters (24) against
infection. N-specific antibodies are neither neutralizing nor protective.
We previously demonstrated that DNA vaccination with a plasmid
containing a cDNA representing the SEOV M segment (pWRG/SEO-M) elicited
neutralizing antibody responses in mice and hamsters (11).
In a hamster infection model, we demonstrated that gene gun vaccination
with pWRG/SEO-M, but not with a plasmid containing a cDNA representing
the SEOV S segment, protected hamsters against infection with SEOV and
HTNV (11, 12).
Here we report the development of a HTNV M DNA vaccine. This vaccine
expresses the G1 and G2 proteins of HTNV, elicits neutralizing antibodies, and protects hamsters against infection with three of the
four hantaviruses known to cause HFRS. More importantly, we demonstrate
for the first time that both the SEOV M and HTNV M DNA vaccines elicit
high-titer neutralizing antibody responses in rhesus macaques. These
nonhuman primate data are an important contribution to the development
of a DNA vaccine to protect humans against hantaviral disease.
Viruses, cells, medium, and MAbs.
HTNV strain 76-118 (14), SEOV strain SR-11 (13), DOBV
(4) and PUUV strain K27 (26) were propagated
in Vero E6 cells (Vero C1008; ATCC CRL 1586). Transient-expression
experiments were performed with COS cells (COS-7; ATTC CRL1651). Both
cell types were maintained in Eagle minimal essential medium with
Earle's salts (EMEM) containing 10% fetal bovine serum, 10 mM HEPES
(pH 7.4), and the antibiotics penicillin (100 U/ml), streptomycin (100 µg/ml), and gentamicin (50 µg/ml) (cEMEM) at 37°C in a 5% CO2 incubator.
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.18.8469-8477.2001
DNA Vaccination with the Hantaan Virus M Gene Protects Hamsters
against Three of Four HFRS Hantaviruses and Elicits a High-Titer
Neutralizing Antibody Response in Rhesus Monkeys
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Hantaan virus (HTNV), Seoul virus (SEOV),
Dobrava virus (DOBV) and Puumala virusare known to cause hemorrhagic fever with renal syndrome (HFRS) in Europe and Asia. HTNV causes the
most severe form of HFRS (5 to 15% case-fatality rate) and afflicts
tens of thousands of people annually. Previously, we demonstrated that
DNA vaccination with a plasmid expressing the SEOV M gene elicited
neutralizing antibodies and protected hamsters against infection with
SEOV and HTNV. Here, we report the construction and evaluation of a DNA
vaccine that expresses the HTNV M gene products, G1 and G2. DNA
vaccination of hamsters with the HTNV M gene conferred sterile
protection against infection with HTNV, SEOV, and DOBV. DNA vaccination
of rhesus monkeys with either the SEOV or HTNV M gene elicited high
levels of neutralizing antibodies. These are the first immunogenicity
data for hantavirus DNA vaccines in nonhuman primates. Because a
neutralizing antibody response is considered a surrogate marker for
protective immunity in humans, our protection data in hamsters
combined with the immunogenicity data in monkeys suggest that
hantavirus M gene-based DNA vaccines could protect humans against the
most severe forms of HFRS.
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Construction of hantavirus M gene DNA vaccine plasmids. Construction of the SEOV M DNA vaccine plasmid, pWRG/SEO-M, was as described previously (11).
To make pWRG/SEO-M(x), DNA encoding the SEOV G1 and G2 proteins was amplified by PCR from pWRG/SEO-M by using a forward primer (primer1-24, 5'-GGCCGCGGCCGCGGATCTGCAGGAATTCGGCACGAGAGTAGTAGACTCCGCAAGAAACAGCA) and a reverse primer (SEOMX, 5'-GCGCGGATCCAGATTGGGAGATAGAAGAGAG). The PCR product was cut with NotI and BamHI and then ligated into NotI-BglII-cut pWRG7077 vector. This clone was made to remove undesirable cloning artifact DNA (~100 nucleotides of the simian immunodeficiency virus nef gene) found between the BamHI and BglII sites of pWRG7077. Removing this sequence had no effect on expression of cloned genes (data not shown). The HTNV M DNA vaccine plasmid, pWRG/HTN-M, was constructed essentially as follows. First, DNA encoding HTNV G1 and G2 was cut from pTZ19RHTNMm (22) as a BglII fragment and ligated into BamHI-cut pWRG7077 vector. This plasmid expressed G2 but not G1 (data not shown). Next, the NotI-PshAI fragment of this plasmid, which contained the 5' end of the M gene, was excised and replaced with DNA amplified by PCR (from a pUC18 plasmid containing a full-length HTNV M gene cloned by reverse transcriptase-PCR cloning from viral RNA), using primer1-24 (see above) and a reverse primer (M5B, 5'-TCAGGACTCCTGTCATGCAATAAGATCTC). The reverse primer included silent nucleotide changes in the HTNV M gene that created a BglII site used for diagnostic purposes. The PCR product was cut with NotI and PshAI and ligated into the NotI-PshAI-cut plasmid to create pWRG/HTN-M. pWRG/HTN-M(x) was constructed by using primer1-24 and a reverse primer (HTNMX, 5'-GCGCGGATCCGTTTGTGGTTAGAAAGCTAC) to PCR amplify the HTNV M gene from pWRG/HTN-M. PCR product was cut with NotI and BamHI and ligated into the NotI-BglII-cut pWRG7077 vector. This clone was identical to pWRG/HTN-M; however, a portion of the 3'-untranslated region of the gene and the vector sequence between BamHI and BglII was removed. Plasmid DNA was purified by using Qiagen Maxiprep DNA purification kits according to the manufacturer's directions.Immunoprecipitation. COS cells grown in T-25 cell culture flasks were transfected with 5 µg of plasmid DNA with Fugene6 (Boehringer Mannheim). After 24 h, expression products were radiolabeled with Promix ([35S]methionine and [35S]cysteine; Amersham) and immunoprecipitated as described previously (25). Reduced samples were run on 4 to 12% bis-Tris sodium dodecyl sulfate polyacrylamide gel electrophoresis gradient gels with morpholinepropanesulfonic acid running buffer (NuPage), at a 200-V constant voltage.
Vaccinations. Gene gun cartridges (~0.5 µg of plasmid DNA coated on 0.5 mg of gold) were prepared, and outbred golden Syrian hamsters were gene gun vaccinated as described previously (11). Briefly, each vaccination consisted of four gene gun (Powderject-XR Delivery Device; Powderject Vaccines, Inc.) administrations (four cartridges) at nonoverlapping sites on the shaved abdominal epidermis using 400 lb/in2 of helium pressure. Hamsters were vaccinated three times at 3-week intervals. Rhesus macaques were vaccinated with the same type of cartridges and the same gene gun conditions used to vaccinate the hamsters; however, the monkeys received eight administrations per vaccination, rather than four. Hamsters and monkeys were anesthetized during the nonpainful gene gun procedure, which only results in mild erythema.
Rhesus macaques were vaccinated with a recombinant vaccinia virus, rVV/HTN-M+S, by the method used to vaccinate humans in a phase II clinical trial (17). The vaccine (3.4 × 107 PFU in 0.5 ml of PBS) was injected subcutaneously into the right lateral upper arm with a 26G 3/8-in. needle. After 42 days, the monkeys received an identical vaccination on the left arm.Plaque reduction neutralization tests (PRNT). Neutralization assays were performed essentially as previously described (7, 10). Heat-inactivated (56°C, 30 min) serum samples were diluted in cEMEM and then combined with an equal volume (111 µl) of cEMEM containing ~75 PFU of virus and 10% guinea pig complement (catalog no. ACL-4051; Accurate Chemical and Scientific Corp.). This mixture was incubated overnight at 4°C, and then a plaque assay was performed exactly as described previously, using 7-day-old Vero E6 monolayers in six-well plates (11). HTNV and SEOV PRNT were stained with neutral red (Gibco-BRL) after 1 week and PUUV and DOBV PRNT were stained after 9 days. Plaques were counted 2 days (37°C) after staining.
Challenge with hantaviruses. Adult, female, Syrian hamsters (Charles River) were injected intramuscularly (i.m.; caudal thigh, 25-gauge needle) with the indicated hantavirus diluted in 0.2 ml of sterile PBS (pH 7.4). The challenge dose for each virus was 2,000 PFU. This dose is ~1,000 50% infective doses (ID50) for HTNV and SEOV, ~100 ID50 for DOBV, and ~10 ID50 for PUUV (J. W. Hooper, unpublished data). At 28 days after challenge, the hamsters were anesthetized and exsanguinated by cardiac puncture. Pre- and postchallenge sera were evaluated for the presence of N-specific antibodies by enzyme-linked immunosorbent assay (ELISA) and for the presence of neutralizing antibodies by PRNT. Detecting postchallenge N-specific antibody indicated that the hamster was infected with the challenge virus.
This animal research was conducted in accordance with procedures described in the 1996 Guide for the Care and Use of Laboratory Animals (National Institutes of Health, Bethesda, Md.). The facilities are fully accredited by the American Association for Accreditation of Laboratory Animal Care.N-specific ELISA. The ELISA used to detect N-specific antibodies was previously described (10, 11). The antigen consisted of a truncated SEOV N (amino acids 1 to 117) or truncated PUUV N (amino acids 1 to 117) expressed as a histidine-tagged fusion protein by using the pRSET plasmid (Invitrogen) in Escherichia coli BL21(DE3) (Novagen, Inc.) and purified by affinity chromatography on Ni-nitrilotriacetic acid columns (Qiagen). A negative control antigen (pET19B plasmid expressing the Ebola virus nucleocapsid protein) was prepared by the same affinity chromatography method. The secondary antibody was horseradish peroxidase-labeled goat anti-hamster antibody (catalog no. 14-22-06; Kirkegaard & Perry Laboratories). The substrate was tetramethylbenzidine substrate (catalog no. 50-76-04; Kirkegaard & Perry Laboratories). The colorimetric reaction was stopped by adding Stop solution (catalog no. 50-85-04, Kirkegaard & Perry Laboratories), and the optical density (OD) at 450 nm was determined. Nonspecific binding was controlled for by subtracting OD values obtained on negative control antigen from OD values obtained on the hantavirus N antigen. Endpoint titers were determined as the highest dilution with an OD greater than the mean OD value of serum samples from negative control serum sample wells plus three standard deviations. The SEOV N antigen was used to detect HTNV N-, DOBV N-, and SEOV N-specific antibodies. The PUUV N was used to detect PUUV N-specific antibodies.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Expression of G1 and G2 from HTNV M DNA vaccine.
cDNA
representing the HTNV M genome segment was cloned into a
cytomegalovirus promoter-based expression plasmid, pWRG7077, to create
pWRG/HTN-M. Radioimmunoprecipitation assay (RIPA) experiments using
polyclonal antibodies and MAbs indicated that both the G1 and G2
proteins were transiently expressed in cells transfected with
pWRG/HTN-M (Fig. 1).
|
DNA vaccination with pWRG/HTN-M elicits neutralizing antibodies and
protects hamsters against infection with HTNV.
To determine if the
HTNV M DNA vaccine plasmid was immunogenic, we used a gene gun to
vaccinate hamsters with either pWRG/HTN-M (pWRG/HTN-M or pWRG/HTN-M(x);
see Materials and Methods) or a negative control. Three weeks after the
final vaccination, the hamsters were bled and sera were evaluated for
neutralizing antibodies by PRNT. In two separate experiments, all of
the hamsters vaccinated with pWRG/HTN-M developed HTNV-neutralizing
antibody responses (Fig. 2). Titers (80%
PRNT [PRNT80]) ranged from 20 to 1,280 with a geometric
mean titer (GMT) of 104 in the first experiment and from 20 to 10,240 with a GMT of 493 in the second experiment. Negative control groups
remained seronegative. Thus, gene gun vaccination with pWRG/HTN-M was
immunogenic in hamsters.
|
4-fold. In contrast,
all of the negative control hamsters, whether they were vaccinated with
pWRG7077 or remained unvaccinated, were infected, as evidenced by the
development of N-specific antibodies and neutralizing antibodies
postchallenge (Fig. 2). Thus, gene gun vaccination with
pWRG/HTN-M [or pWRG/HTN-M(x)] protected against productive infection with HTNV, even when the prechallenge PRNT80
titer was as low as 20.
DNA vaccination with either pWRG/SEO-M or pWRG/HTN-M cross-protects
against challenge with heterologous hantaviruses.
Having
determined that our SEOV M (11, 12) and HTNV M gene-based
DNA vaccines were capable of protecting hamsters against infection with
homologous virus, we wanted to determine if either of these vaccines
could cross-protect against other HFRS-associated hantaviruses. We
first measured the cross-neutralizing activities of sera from HFRS
hantavirus-infected hamsters and of hamsters vaccinated with either the
SEOV M or HTNV M vaccine (Table 1). We
found that sera from SEOV-infected hamsters had a low level of HTNV
neutralizing activity and no detectable DOBV or PUUV neutralizing activity. Sera from HTNV- or DOBV-infected hamsters exhibited a low
level of neutralizing antibodies against SEOV, DOBV, and PUUV. Sera
from PUUV-infected hamsters failed to neutralize HTNV or SEOV and had a
barely detectable DOBV-neutralizing activity. The sera from vaccinated
hamsters exhibited greater levels of cross-neutralizing activity than
the sera from the infected hamsters. Vaccination with either pWRG/SEO-M
or pWRG/HTN-M elicited an antibody response that cross-neutralized
SEOV, HTNV, and DOBV, but not PUUV.
|
80 protected against DOBV, but a titer of as high as
1,280 failed to protect against PUUV (Fig. 3A, B, and C). One
vaccinated and one control hamster failed to respond to the PUUV
challenge, probably because the PUUV challenge dose was 10 ID50, whereas it was 10 to 100 times higher for the other
viruses.
|
) and postchallenge
(
)
endpoint antibody titers for each hamster are shown. Prechallenge
homologous PRNT80 titers (sorted from highest to lowest,
left to right) are shown as lines with symbols (
). The
identification code for each hamster is shown on the x axis.
The HTNV PRNT and anti-N ELISA data for hamsters 943, 944, 945, and 948 were published previously (640 were associated
with protection of hamsters against SEOV, and titers of 320 protected
against DOBV. We did not measure the capacity of vaccination with
pWRG/HTN-M to protect against PUUV infection because of our findings
that the SEOV DNA vaccine did not protect (Fig. 3C) and because a
vaccinia virus-vectored HTNV vaccine did not protect hamsters against
PUUV infection (8). Together, these data indicate that DNA
vaccination with either pWRG/SEO-M or pWRG/HTN-M cross-protected
against three of the four HFRS-associated hantaviruses: SEOV, HTNV, and DOBV.
DNA vaccination with pWRG/SEO-M or pWRG/HTN-M elicits a high-titer neutralizing antibody response in nonhuman primates. Our vaccination data with plasmids expressing the SEOV M gene or HTNV M gene suggest that these vaccines might be efficacious in humans. As a further step toward the clinical development of these vaccines, we tested their capacity to elicit antibody responses in nonhuman primates. Two rhesus macaques were vaccinated with the SEOV M DNA vaccine, and three rhesus macaques were vaccinated with the HTNV M DNA vaccine. As negative controls, three monkeys were vaccinated with pWRG7077 expressing irrelevant genes and, as positive controls, three monkeys were vaccinated with a recombinant vaccinia virus expressing the HTNV M and S genes, rVV/HTN-M+S (23). rVV/HTN-M+S was previously shown to elicit HTNV-specific immunity, including neutralizing antibodies, in hamsters (8) and to elicit neutralizing antibodies in humans (17). The DNA vaccines were administered three times at 3-week intervals. The rVV/HTN-M+S vaccine was administered by the dose and schedule used in the human phase II trials (i.e., a primary subcutaneous vaccination followed by a boost at day 42) (17).
Three weeks after the first vaccination, two of the three monkeys vaccinated with pWRG/HTN-M(x) demonstrated neutralizing antibodies (Fig. 4). Three weeks after the second gene gun vaccination, all of the monkeys vaccinated with either pWRG/SEO-M(x) or pWRG/HTN-M(x) demonstrated detectable levels of neutralizing antibodies. Three weeks after the third vaccination, high titers of neutralizing antibodies were detected in all of the monkeys vaccinated with pWRG/SEO-M(x) or pWRG/HTN-M(x). Negative control-vaccinated monkeys did not develop neutralizing antibodies. Monkeys vaccinated with rVV/HTN-M+S failed to develop a neutralizing antibody response after one vaccination but did develop neutralizing antibodies after the 42-day boost. Three weeks after the final vaccination, the PRNT80 GMTs of the monkeys vaccinated with pWRG/SEO-M(x), pWRG/HTNM(x), or rVV/HTN-M+S, were 905, 2,032, and 160, respectively. These data demonstrate, for the first time, that DNA vaccines expressing hantaviral M gene products are immunogenic in nonhuman primates and elicit very high levels of neutralizing antibodies.
|
20) 4 to 8 months after the final vaccination.
DNA vaccination of nonhuman primates with pWRG/SEO-M or pWRG/HTN-M
vaccines elicits antibody responses that cross-neutralize DOBV.
We
tested the sera from the vaccinated monkeys for cross-neutralizing
activity by PRNT (Table 2). All of the
monkeys vaccinated with either pWRG/SEO-M(x) or pWRG/HTNV-M(x) had
antibodies that cross-neutralized DOBV. rVV/HTN-M+S vaccinated monkeys
also had DOBV-cross-neutralizing antibodies, albeit at lower titers.
Monkeys vaccinated with pWRG/SEO-M(x) had weak or no HTNV-neutralizing antibody responses and monkeys vaccinated with pWRG/HTN-M(x) had weak
or no SEOV-neutralizing antibody responses. Only one monkey (monkey
CH32), which was DNA vaccinated with pWRG/SEO-M(x), demonstrated a
detectable level of PUUV-neutralizing antibodies.
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Our previous results with the SEOV M DNA vaccine (11), along with the results reported here demonstrating immunogenicity and protective efficacy of the HTNV M DNA vaccine, make a strong case for the use of a full-length M gene in DNA vaccines against other hantaviruses. The HTNV M DNA vaccine is only the second hantavirus DNA vaccine that has been shown to express both the G1 and G2 proteins (the other was the SEOV M DNA vaccine plasmid [11]). Difficulties in either cloning intact hantavirus M genes, expressing intact G1 and G2, or eliciting an immune response in DNA vaccinated animals have befallen us and been reported by others (5). It remains unclear whether or not G1 alone, G2 alone, or fragments of the glycoproteins can elicit neutralizing antibodies and protect against infection. Vaccination with recombinant baculovirus-infected cell lysates containing G1 or G2 alone, and recombinant vaccinia viruses expressing G1 or G2 alone, failed to elicit neutralizing antibody and exhibited incomplete protection in a hamster infection model (24). These data suggest that a full-length M gene capable of expressing G1 and G2 may be required for protective immunity. In contrast, Bharadwaj et al. reported low levels (1:10 to 1:20) of neutralizing antibodies after i.m. needle injection of mice with DNA vaccine plasmids containing short (~166-amino-acid) sections of the M gene of Sin nombre virus (SNV), an HPS-associated hantavirus (5). This finding suggests that eliciting a neutralizing antibody response not only does not require a full-length M gene but also occurs when only fragments of G1 or G2 are expressed. Further studies are needed to clarify the importance of the conformational integrity of G1 and G2 for immunogenicity.
There are four hantaviruses known to cause HFRS and at least six are known to cause HPS, so information on cross-neutralization and cross-protection among hantaviruses is important for the rational design of cross-protective vaccines. Investigators have evaluated the capacity of sera from various species (including humans) infected with hantaviruses to cross-neutralize other hantaviruses (3, 7, 15, 16, 18). Different species, and different individuals within a species, appear to exhibit differing levels of cross-neutralizing antibodies. In general, data from these experiments indicate that sera from HTNV-, SEOV-, or DOBV-infected individuals share cross-neutralizing antibodies, albeit with a >4-fold difference in titer among the serotypes, whereas sera from PUUV-infected individuals exhibit few or no SEOV-, HTNV-, or DOBV-cross-neutralizing antibodies. Our data obtained with sera from infected or DNA-vaccinated hamsters are consistent with earlier findings. We observed a greater level of cross-neutralizing antibodies in the pooled sera from the DNA-vaccinated hamsters than in the pooled sera from infected hamsters. This may reflect a qualitative difference between the antibodies elicited after DNA vaccination and the antibodies elicited by infection or it may simply reflect a quantitative difference in antibody levels. It is noteworthy that high homologous neutralizing antibody levels in vaccinated hamsters did not necessarily correlate with cross-neutralizing activity (Fig. 3).
The cross-neutralization tests with the hamster serum pools suggested that if neutralizing antibodies could predict protective immunity, then vaccination with either pWRG/SEO-M or pWRG/HTN-M would protect against SEOV, HTNV, and DOBV, but not PUUV and this we found, in general, to be true. The data in Fig. 3 indicate that the presence of cross-neutralizing antibodies correlated with a protective effect with a single exception. Hamster 2119 exhibited cross-neutralizing antibodies, but was not protected by definition because there was a detectable anti-N response after challenge. However, the absence of detectable levels of cross-neutralizing antibodies did not necessarily predict a lack of protection. Examples of the latter case can be found in Fig. 3, hamsters 1437, 1434, 2122, and 2133. It is possible that cross-neutralizing antibodies are present but are not detected due to limitations of the assay or, more likely, that responses other than neutralizing antibody are also protective.
Whether the neutralizing antibodies elicited by DNA vaccination is necessary and/or sufficient to confer protection, or only a surrogate marker to predict protection, will require passive-transfer experiments involving sera from DNA-vaccinated animals. We have not evaluated the cell-mediated immune response elicited by DNA vaccination with pWRG/SEO-M or pWRG/HTN-M, but we suspect that there is a response that plays a role in protection. In support of this, another study demonstrated that a lymphoproliferative response was elicited in mice injected i.m. with DNA encoding ~166 amino acids of the SNV G1 or G2 proteins, indicating that a cell-mediated response to epitopes of both G1 and G2 can occur (5). The cell-mediated response to DNA vaccination with the full-length G1 and G2 proteins and its role in protection remain to be determined.
In this study, we demonstrated that vaccination with either pWRG/SEO-M or pWRG/HTN-M cross-protected against SEOV, HTNV, and DOBV. Other experimental hantavirus vaccines can cross-protect. For example, a vaccinia virus recombinant expressing the HTNV G1, G2, and N (rVV/HTN-M+S) cross-protected against infection with SEOV but not PUUV (8), and vaccinia virus recombinants expressing the SEOV G1 and G2, or N, cross-protected against HTNV (27). Ours is the first report of any vaccine protecting against DOBV.
All previous data concerning the immunogenicity and protective efficacy
of DNA vaccines against hantaviruses have been performed in rodents.
Here, were report for the first time, the results of experiments
performed in nonhuman primates. The hantavirus M gene-based DNA
vaccines administered by gene gun not only elicited positive responses
in rhesus macaques but also elicited levels of neutralizing antibodies
that were very high. When we combined the serological data from the
SEOV and HTNV M gene DNA thrice-vaccinated monkeys, the
PRNT80 GMT was 1,470. This neutralizing antibody response
was almost 10 times greater than that elicited by the recombinant
vaccinia virus vaccine (PRNT80 GMT = 160, PRNT50 GMT = 320), which was similar to the
neutralizing antibody responses previously reported for humans
(PRNT50 GMT = 160) (17). In China, where
several killed virus vaccines against hantaviruses have been developed
and tested in humans, the PRNT assay is used to evaluate the potency of
the vaccine (28, 30). Most of the inactivated virus
vaccines made in cell culture elicit neutralizing antibodies in 90 to
100% of the human vaccinees after three doses (GMT 100). and
the percentage of seropositive individuals drops to ~50% 6 months
after the final boost.
Eight months after the final gene gun vaccination, neutralizing
antibodies could still be detected in all of the monkeys vaccinated with either pWRG/SEO-M(x) or pWRG/HTN-M(x). In comparison, monkeys vaccinated with the recombinant vaccinia virus vaccine had low or
undetectable levels of neutralizing antibodies after 4 months (Fig.
5). We plan to monitor the kinetics of
the decline in antibody levels of the vaccinated monkeys to determine
if a low level of neutralizing antibodies is maintained beyond 8 months
or if the levels fall below our level of detection in a definable
period of time.
|
We have directed our efforts toward the development of a recombinant hantavirus vaccine(s) that is intended to be safer and more immunogenic than the killed-virus vaccines currently being tested in Asia. Our data suggest that it might be possible to elicit a more robust and longer-lasting neutralizing antibody response using a vaccine platform that entails the expression of G1 and G2 within the cells of the vaccinee (e.g., DNA vaccine) rather than as exogenous proteins (e.g., beta-propiolactone-treated virions combined with adjuvant). In support of this, others have reported that a DNA vaccine containing the Japanese encephalitis virus (JEV) envelope gene elicted a stronger and longer-lasting anti-envelope antibody response than the currently used inactivated JEV vaccine (6).
In summary, we have demonstrated that gene gun vaccination of hamsters with DNA vaccines containing the hantavirus M gene confers sterilizing immunity against three of the four hantaviruses that cause HFRS and elicits very high levels of neutralizing antibodies in monkeys. Because a neutralizing antibody response is considered a surrogate marker for protective immunity in humans, our protection data in hamsters combined with the immunogenicity data in monkeys suggest that hantavirus M gene-based DNA vaccines could protect humans against the most severe forms of HFRS.
| |
ACKNOWLEDGMENTS |
|---|
The gene gun (Powderject Delivery Device) and pWRG7077 were kindly provided by Powderject Vaccine, Inc. The plasmids used to prepare N-specific ELISA antigen, pSEOSXdelta and pPUUSXdelta, were kindly provided by Fredrik Elgh. The negative control ELISA antigen was kindly provided by Colleen Jonsson.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Virology Division, U.S. Army Medical Research Institute of Infectious Diseases, Ft. Detrick, MD 21702. Phone: (301) 619-4101. Fax: (301) 619-2439. E-mail: Jay.Hooper{at}det.amedd.army.mil.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. |
Arikawa, J.,
A. L. Schmaljohn,
J. M. Dalrymple, and C. S. Schmaljohn.
1989.
Characterization of Hantaan virus envelope glycoprotein antigenic determinants defined by monoclonal antibodies.
J. Gen. Virol.
70:615-624 |
| 2. | Arikawa, J., J. S. Yao, K. Yoshimatsu, I. Takashima, and N. Hashimoto. 1992. Protective role of antigenic sites on the envelope protein of Hantaan virus defined by monoclonal antibodies. Arch. Virol. 126:271-281[CrossRef][Medline]. |
| 3. |
Asada, H.,
K. Balachandra,
M. Tamura,
K. Kondo, and K. Yamanishi.
1989.
Cross-reactive immunity among different serotypes of virus causing haemorrhagic fever with renal syndrome.
J. Gen. Virol.
70:819-25 |
| 4. | Avsic-Zupanc, T., S. Y. Xiao, R. Stojanovic, A. Gligic, G. van der Groen, and J. W. LeDuc. 1992. Characterization of Dobrava virus: a hantavirus from Slovenia, Yugoslavia. J. Med. Virol. 38:132-137[Medline]. |
| 5. | Bharadwaj, M., C. R. Lyons, I. A. Wortman, and B. Hjelle. 1999. Intramuscular inoculation of Sin Nombre hantavirus cDNAs induces cellular and humoral immune responses in BALB/c mice. Vaccine 17:2836-2843[CrossRef][Medline]. |
| 6. |
Chen, H. W.,
C. H. Pan,
M. Y. Liau,
R. Jou,
C. J. Tsai,
H. J. Wu,
Y. L. Lin, and M. H. Tao.
1999.
Screening of protective antigens of Japanese encephalitis virus by DNA immunization: a comparative study with conventional viral vaccines.
J. Virol.
73:10137-10145 |
| 7. | Chu, Y. K., G. Jennings, A. Schmaljohn, F. Elgh, B. Hjelle, H. W. Lee, S. Jenison, T. Ksiazek, C. J. Peters, P. Rollin, et al. 1995. Cross-neutralization of hantaviruses with immune sera from experimentally infected animals and from hemorrhagic fever with renal syndrome and hantavirus pulmonary syndrome patients. J. Infect. Dis. 172:1581-1584[Medline]. |
| 8. | Chu, Y. K., G. B. Jennings, and C. S. Schmaljohn. 1995. A vaccinia virus-vectored Hantaan virus vaccine protects hamsters from challenge with Hantaan and Seoul viruses but not Puumala virus. J. Virol. 69:6417-6423[Abstract]. |
| 9. | Dantas, J. R., Y. Okuno, H. Asada, M. Tamura, M. Takahashi, O. Tanishita, Y. Takahashi, T. Kurata, and K. Yamanishi. 1986. Characterization of glycoproteins of viruses causing hemorrhagic fever with renal syndrome (HFRS) using monoclonal antibodies. Virology. 151:379-384[CrossRef][Medline]. |
| 10. | Elgh, F., A. Lundkvist, O. A. Alexeyev, H. Stenlund, T. Avsic-Zupanc, B. Hjelle, H. W. Lee, K. J. Smith, R. Vainionpaa, D. Wiger, G. Wadell, and P. Juto. 1997. Serological diagnosis of hantavirus infections by an enzyme-linked immunosorbent assay based on detection of immunoglobulin G and M responses to recombinant nucleocapsid proteins of five viral serotypes. J. Clin. Microbiol. 35:1122-1130[Abstract]. |
| 11. | Hooper, J. W., K. I. Kamrud, F. Elgh, D. Custer, and C. S. Schmaljohn. 1999. DNA vaccination with hantavirus M segment elicits neutralizing antibodies and protects against seoul virus infection. Virology 255:269-278[CrossRef][Medline]. |
| 12. | Kamrud, K. I., J. W. Hooper, F. Elgh, and C. S. Schmaljohn. 1999. Comparison of the protective efficacy of naked DNA, DNA-based Sindbis replicon, and packaged Sindbis replicon vectors expressing Hantavirus structural genes in hamsters. Virology 263:209-219[CrossRef][Medline]. |
| 13. | Kitamura, T., C. Morita, T. Komatsu, K. Sugiyama, J. Arikawa, S. Shiga, H. Takeda, Y. Akao, K. Imaizumi, A. Oya, N. Hashimoto, and S. Urasawa. 1983. Isolation of virus causing hemorrhagic fever with renal syndrome (HFRS) through a cell culture system. Jpn. J. Med. Sci. Biol. 36:17-25[Medline]. |
| 14. | Lee, H. W., P. W. Lee, and K. M. Johnson. 1978. Isolation of the etiologic agent of Korean hemorrhagic fever. J. Infect. Dis. 137:298-308[Medline]. |
| 15. |
Lee, P. W.,
C. J. Gibbs,
D. C. Gajdusek, and R. Yanagihara.
1985.
Serotypic classification of hantaviruses by indirect immunofluorescent antibody and plaque reduction neutralization tests.
J. Clin. Microbiol.
22:940-944 |
| 16. | Lundkvist, A., M. Hukic, J. Horling, M. Gilljam, S. Nichol, and B. Niklasson. 1997. Puumala and Dobrava viruses cause hemorrhagic fever with renal syndrome in Bosnia-Herzegovina: evidence of highly cross-neutralizing antibody responses in early patient sera. J. Med. Virol. 53:51-59[CrossRef][Medline]. |
| 17. | McClain, D. J., P. L. Summers, S. A. Harrison, A. L. Schmaljohn, and C. S. Schmaljohn. 2000. Clinical evaluation of a vaccinia-vectored Hantaan virus vaccine. J. Med. Virol. 60:77-85[CrossRef][Medline]. |
| 18. | Niklasson, B., M. Jonsson, A. Lundkvist, J. Horling, and E. Tkachenko. 1991. Comparison of European isolates of viruses causing hemorrhagic fever with renal syndrome by a neutralization test. Am. J. Trop. Med. Hyg. 45:660-665. |
| 19. | Peters, C. J., G. L. Simpson, and H. Levy. 1999. Spectrum of hantavirus infection: hemorrhagic fever with renal syndrome and hantavirus pulmonary syndrome. Annu. Rev. Med. 50:531-45[CrossRef][Medline]. |
| 20. | Schmaljohn, C., and B. Hjelle. 1997. Hantaviruses: a global disease problem. Emerg. Infect. Dis. 3:95-104[Medline]. |
| 21. | Schmaljohn, C. S. 1996. Molecular biology of hantaviruses, p. 63-90. In R. M. Elliott (ed.), The Bunyaviridae. Plenum Press, Inc., New York, N.Y. |
| 22. | Schmaljohn, C. S., J. Arikawa, J. M. Dalrymple, and A. L. Schmaljohn. 1989. Expression of the envelope glycoproteins of Hantaan virus with vaccinia and baculovirus recombinants, p. 58-66. In D. Kolakofsky, and B. Mahy (ed.), Genetics and pathogenicity of negative strand viruses. Elsevier Press, Amsterdam, The Netherlands. |
| 23. | Schmaljohn, C. S., S. E. Hasty, and J. M. Dalrymple. 1992. Preparation of candidate vaccinia-vectored vaccines for haemorrhagic fever with renal syndrome. Vaccine 10:10-13[CrossRef][Medline]. |
| 24. |
Schmaljohn, C. S.,
Y. K. Chu,
A. L. Schmaljohn, and J. M. Dalrymple.
1990.
Antigenic subunits of Hantaan virus expressed by baculovirus and vaccinia virus recombinants.
J. Virol.
64:3162-3170 |
| 25. | Schmaljohn, C., L. Vanderzanden, M. Bray, D. Custer, B. Meyer, D. Li, C. Rossi, D. Fuller, J. Fuller, J. Haynes, and J. Huggins. 1997. Naked DNA vaccines expressing the prM and E genes of Russian spring summer encephalitis virus and Central European encephalitis virus protect mice from homologous and heterologous challenge. J. Virol. 71:9563-9569[Abstract]. |
| 26. | Tkachenko, E. A., V. N. Bashkirtsev, G. van der Groen, T. K. Dzagurova, A. P. Ivanov, and E. V. Ryltseva. 1984. Isolation in Vero-E6 cells of hantavirus from Clethrionomys glareolus captured in the Bashkiria area of the U.S.S.R. Ann. Soc. Belg. Med. Trop. 64:425-426[Medline]. |
| 27. | Xu, X., S. L. Ruo, J. B. McCormick, and S. P. Fisher-Hoch. 1992. Immunity to hantavirus challenge in Meriones unguiculatus induced by vaccinia-vectored viral proteins. Am. J. Trop. Med. Hyg. 47:397-404. |
| 28. | Yu, Y., Z. Zhu, Z. Yao, and G. Dong. 1999. Inactivated cell-culture Hantavirus vaccine developed in China, p. 157-161. In J. F. Saluzzo, and B. Dodet (ed.), Factors in the emergence and control of rodent-borne viral diseases (hantavirus and arenal diseases). Elsevier Press, Paris, France. |
| 29. | Zhang, X.-K., I. Takashima, and N. Hashimoto. 1989. Characteristics of passive immunity against hantavirus infection in rats. Arch. Virol. 105:235-246[CrossRef][Medline]. |
| 30. | Zhu, Z. Y., H. Y. Tang, Y. J. Li, J. Q. Weng, Y. X. Yu, and R. F. Zeng. 1994. Investigation on inactivated epidemic hemorrhagic fever tissue culture vaccine in humans. Chin. Med. J. 107:167-170[Medline]. |
Journal of Virology, September 2001, p. 8469-8477, Vol. 75, No. 18
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.18.8469-8477.2001
This article has been cited by other articles:
-
Wang, H., Strandin, T., Hepojoki, J., Lankinen, H., Vaheri, A.
(2009). Degradation and aggresome formation of the Gn tail of the apathogenic Tula hantavirus. J. Gen. Virol.
90: 2995-3001
[Abstract] [Full Text] -
Taylor, S. L., Frias-Staheli, N., Garcia-Sastre, A., Schmaljohn, C. S.
(2009). Hantaan Virus Nucleocapsid Protein Binds to Importin {alpha} Proteins and Inhibits Tumor Necrosis Factor Alpha-Induced Activation of Nuclear Factor Kappa B. J. Virol.
83: 1271-1279
[Abstract] [Full Text] -
Hooper, J. W., Ferro, A. M., Wahl-Jensen, V.
(2008). Immune Serum Produced by DNA Vaccination Protects Hamsters against Lethal Respiratory Challenge with Andes Virus. J. Virol.
82: 1332-1338
[Abstract] [Full Text] -
Muranyi, W., Bahr, U., Zeier, M., van der Woude, F. J.
(2005). Hantavirus Infection. J. Am. Soc. Nephrol.
16: 3669-3679
[Full Text] -
Hooper, J. W., Thompson, E., Wilhelmsen, C., Zimmerman, M., Ichou, M. A., Steffen, S. E., Schmaljohn, C. S., Schmaljohn, A. L., Jahrling, P. B.
(2004). Smallpox DNA Vaccine Protects Nonhuman Primates against Lethal Monkeypox. J. Virol.
78: 4433-4443
[Abstract] [Full Text] -
Custer, D. M., Thompson, E., Schmaljohn, C. S., Ksiazek, T. G., Hooper, J. W.
(2003). Active and Passive Vaccination against Hantavirus Pulmonary Syndrome with Andes Virus M Genome Segment-Based DNA Vaccine. J. Virol.
77: 9894-9905
[Abstract] [Full Text] -
Ogino, M., Ebihara, H., Lee, B.-H., Araki, K., Lundkvist, A., Kawaoka, Y., Yoshimatsu, K., Arikawa, J.
(2003). Use of Vesicular Stomatitis Virus Pseudotypes Bearing Hantaan or Seoul Virus Envelope Proteins in a Rapid and Safe Neutralization Test. CVI
10: 154-160
[Abstract] [Full Text] -
de Carvalho Nicacio, C., Gonzalez Della Valle, M., Padula, P., Bjorling, E., Plyusnin, A., Lundkvist, A.
(2002). Cross-Protection against Challenge with Puumala Virus after Immunization with Nucleocapsid Proteins from Different Hantaviruses. J. Virol.
76: 6669-6677
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»