Previous Article | Next Article ![]()
Journal of Virology, September 2001, p. 8449-8460, Vol. 75, No. 18
Department of Biochemistry and Molecular
Biology, Oregon Health Sciences University, Portland, Oregon
97201-30981; Laboratoire de
Retrovirologie, Institut Pasteur de Dakar, Dakar,
Senegal2; Institut Pasteur de Bangui,
Bangui, Central African Republic3; and
Unité de Biologie des Rétrovirus, Institut Pasteur,
Paris Cedex 15, France4
Received 15 February 2001/Accepted 8 June 2001
In contrast to humans, several primate species are believed to have
harbored simian immunodeficiency viruses (SIVs) since ancient times. In
particular, the geographically dispersed species of African green
monkeys (AGMs) are all infected with highly diversified SIVagm viruses
at high prevalences (greater than 50% of sexually mature individuals)
without evident diseases, implying that the progenitor monkeys were
infected prior to their dispersal. If this is correct, AGMs would be
expected to have accumulated frequent resistance-conferring
polymorphisms in host genes that are important for SIV replication.
Accordingly, we analyzed the coding sequences of the CCR5 coreceptors
from 26 AGMs (52 alleles) in distinct populations of the four species.
These samples contained 29 nonsynonymous coding changes and only 15 synonymous nucleotide substitutions, implying intense functional
selection. Moreover, 24 of the resulting amino acid substitutions were
tightly clustered in the CCR5 amino terminus (D13N in the vervets and
Y14N in the tantalus species) or in the first extracellular loop (Q93R
and Q93K in all species). The Y14N substitution was extremely frequent
in the 12 wild-born African tantalus, with 7 monkeys being homozygous
for this substitution and 4 being heterozygous. Although two of these
heterozygotes and the only wild-type homozygote were naturally infected
with SIVagm, none of the Y14N homozygotes were naturally infected. A
focal infectivity assay for SIVagm indicated that all five tested SIVagms efficiently use CCR5 as a coreceptor and that they also use
CXCR6 (STRL33/Bonzo) and GPR15 (BOB) with lower efficiencies but not
CXCR4. Interestingly, the D13N, Y14N, Q93R, and Q93K substitutions in
AGM CCR5 all strongly inhibited infections by the SIVagm isolates in
vitro. The Y14N substitution eliminates a tyrosine sulfation site that
is important for infections and results in partial N-linked glycosylation (i.e., 60% efficiency) at this position. Nevertheless, the CCR5(Y14N) component that lacks an N-linked oligosaccharide binds
the chemokine MIP-l Although human immunodeficiency
virus type 1 (HIV-1) and HIV-2 have become prevalent only during the
last few decades and probably arose by zoonoses from chimpanzees
(11, 20) and sooty mangabeys (21, 28),
respectively, there is evidence that several primate species have been
infected since ancient times. For example, African green monkeys (AGMs)
consist of four major species, i.e., vervets (Chlorocebus
pygerythrus), tantalus (C. tantalus), grivets (C. aethiops), and sabaeus (C. sabaeus), that are
geographically segregated and dispersed throughout Africa (2, 5,
50, 56). All tested populations are heavily infected (greater
than 50% of sexually mature adults) by distantly related strains of the simian immunodeficiency virus SIVagm (2, 5, 26, 30-33, 41,
50). These results have implied that the AGM progenitor population was infected prior to its speciation and geographic dispersal (2, 5, 30, 31). Moreover, the highly evolved endemic infections of AGMs and sooty mangabeys have not been associated with diseases, whereas the emergent infections of humans and the experimental transfers of SIVs into naive primate species have resulted
in immunodeficiencies (25, 27, 38, 56).
The latter observations are consistent with the hypothesis that
prolonged coevolution of AGMs with SIVagm viruses may have resulted in
selection for mutations in host genes that control susceptibility to
virus-induced immunodeficiency. Indeed, it is well known that
attenuations of infectious diseases often result from selection for
resistance alleles of host genes, with classic examples being the
resistances to malaria conferred by high-frequency polymorphisms for
sickle cell hemoglobin and thalassemia (55, 64).
Accordingly, genes that mediate host resistances, including those
involved in immune responses, are generally extraordinarily polymorphic
(55). The resulting diversity of the host species may also
select for a corresponding diversity of the infectious agent, which can
further decrease the likelihood that any single infection is highly pathogenic.
There has been great interest in identifying human genes that cause
resistance to HIV-1 infections and to AIDS progression. A major focus
has concerned alleles of the HIV-1 coreceptor CCR5 and other
coreceptors or chemokines that may modulate HIV-1 pathogenesis (24, 29, 35, 42, 45, 47-49, 53, 61, 63, 65). However,
since HIV infections are relatively recent and occur at low frequencies
in most populations, the resistance alleles that have been found
evolved independently of HIV and may have been selected by other
infections. For example, the To address this, we previously analyzed CCR5-coding sequences derived
from five AGMs (37). Four of these AGMs were heterozygous for nonsynonymous CCR5 mutations that caused amino acid substitutions D13N, Y14N, Q93R, and Q93K, and one was homozygous for the wild-type allele. These substitutions all inhibited AGM CCR5 function as a
coreceptor for different R5 strains of HIV-1. We also found several
substitution mutations in a study of four other AGM CCR5 alleles
(51). We have now extended these analyses by studying the
CCR5-coding sequences of 26 AGM DNAs (52 alleles), including samples
from different species living in Africa. The latter monkeys had known
histories, and some were naturally or experimentally infected with
SIVagm. Moreover, we developed a focal infectivity assay for
quantitatively determining titers of SIVagm infections, and we
used it to study the coreceptor requirements and effects of AGM CCR5
polymorphisms on these infections. In addition, we quantitatively
analyzed signal transduction by the wild-type and mutant CCR5 proteins.
Our results support the hypothesis that CCR5 substitution polymorphisms
are prevalent in AGMs and that they have resulted from prolonged
selection pressures caused by the large reservoirs of SIVagm and by the
countervailing pressure to preserve chemokine-dependent CCR5 signaling
activity. An important corollary is that AGMs are likely to contain a
repository of mechanistically informative polymorphisms in different
genes that are critical for infections and pathogenesis of
immunodeficiency viruses.
Cells and viruses.
AGM cell lines CV-1, BS-C-1, and Vero
were from the American Type Culture Collection (Manassas, Va.). BS-C-1
and Vero cells were maintained in minimum essential medium (MEM) with
10% fetal bovine serum (FBS) and 0.1 mM MEM nonessential amino acids
(Life Technologies, Inc., Grand Island, N.Y.). HeLa-CD4 (clone HI-J) cells were previously described (33). CV-1-CD4 (clone
CB.14) cells were generated by transduction with the SFF-CD4 retroviral vector and limiting-dilution cloning as previously described for HeLa-CD4 cells (33). HeLa and CV-1 cells were grown in
Dulbecco MEM (DMEM) supplemented with 10% FBS (Life Technologies).
Molt4-8 cells infected with SIVagm strains from vervets (strains 12, Cpa266, and Cpa27) (12, 34) were obtained from the
AIDS Research and Reference Reagent Program, Division of AIDS, National
Institute of Allergy and Infectious Diseases (NIAID), National
Institutes of Health (NIH) (contributed by Ronald Desrosiers). Molt4-8
cells were grown in RPMI 1640 medium supplemented with 10% FBS (Life Technologies). Supernatants were harvested every 3 or 4 days over a
period of 2 weeks in culture and filtered through a 0.45-µm-pore-size filter. The grivet SIVagm strain gri-1 (19) and the
sabaeus SIVagm strain sab-2 (2) were obtained as
cell-free-virus-containing tissue culture supernatants (AIDS Research
and Reference Reagent Program, Division of AIDS, NIAID, NIH
[contributed by Jonathan Allan]), which were incubated with
approximately 2 × 106 uninfected Molt 4-8 cells (AIDS Research and Reference Reagent Program, Division of AIDS,
NIAID, NIH [contributed by Ronald Desrosiers]) for 2 h at
37°C, washed, and placed into culture. Supernatants from the infected
Molt4-8 cells were then harvested as described above.
AGM genomic DNA.
We analyzed DNAs from peripheral blood
mononuclear cells (PBMC) of the four AGM species and from the three AGM
cell lines (CV-1 [ATCC CCL-70], BS-C-1 [ATCC CCL-26], and Vero
[ATCC CCL-81]). The genomic DNA samples from sabaeus monkeys 9308, 9310, 9312, and 9314 and vervet monkeys 6243, 9648, and 9649 were
kindly provided by Jonathan Allan (Department of Virology and
Immunology, Southwest Foundation for Biomedical Research, San Antonio,
Tex.). PBMC were isolated from our other sabaeus monkeys that were wild
born in Senegal (Table 1). One was
uninfected, two were naturally infected, and one was experimentally
infected by wild-type virus SIVagm.sab92018 according to a previously
described protocol (14). PBMC were also isolated from 12 tantalus AGMs wild born in distinct geographic regions of the Central
African Republic. One was uninfected, three were naturally infected by
SIVagm.tan, and eight were experimentally infected (Table 1).
Experimental infection of tantalus B87 by intravenous inoculation of
SIVagm.tanB14 (50) was previously described
(52). The other seven tantalus monkeys were similarly infected either by SIVagm.tanB14 (tantalus B85, B126, B127, and B143)
or by three other wild-type SIVagm viruses (tantalus B111, B133, and
B142). Genomic DNAs were prepared by standard methods (4).
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.18.8449-8460.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Frequent Substitution Polymorphisms in African Green Monkey CCR5
Cluster at Critical Sites for Infections by Simian Immunodeficiency
Virus SIVagm, Implying Ancient Virus-Host Coevolution
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
with a normal affinity and is fully active in
signal transduction. Similarly, D13N and Q93R substitutions did not
interfere with signal transduction. Thus, the common substitution polymorphisms in AGM CCR5 strongly inhibit SIVagm infections while substantially preserving chemokine signaling. In contrast,
polymorphisms of human CCR5 are relatively infrequent, and the amino
acid substitutions are randomly situated and generally without effects
on coreceptor function. These results support an ancient coevolution of
AGMs and SIVagm viruses and establish AGMs as a highly informative model for learning about host proteins that play critical roles in
immunodeficiency virus infections.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
32 CCR5 human resistance allele occurs
in approximately 13% of Caucasians and may have been selected for
resistance to poxvirus (3, 39, 42, 53, 61, 63) or to
rheumatoid arthritis (22). It is a null allele, and the
encoded protein is absent from cell surfaces (6, 42, 59,
61). Similarly, amino acid substitutions in human CCR5 occur at
low frequencies and at random positions in the protein, and they have
generally not been shown to cause resistances to HIV-1 infections
(3, 6, 10, 66). In contrast, we would anticipate that AGM
CCR5 polymorphisms might occur at relatively high frequencies and that
the prevalent amino acid substitutions would cluster at critical sites
that are required for infections by immunodeficiency viruses but are of
lesser importance for chemokine reception.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
CCR5 polymorphisms and natural histories of AGMs used in
this investigation
Sequence analysis of CCR5-coding regions.
Two approximately
600-bp PCR products were generated by amplifying the genomic DNA with
the Pfu proofreading thermostable DNA polymerase
(Stratagene, La Jolla, Calif.). Conditions for the PCRs were as
previously described (37). Briefly, Pfu was used according to the manufacturer's recommendations in 100-µl reaction mixtures, with 500 ng of genomic DNA as a template. An initial
denaturing step of 95°C for 45 s was followed by 25 cycles of
95°C for 45 s, 55°C for 45 s, and 72°C for 2.5 min;
this was followed by a final extension step of 72°C for 10 min. The
5' half of the CCR5-coding region was amplified with the primers CCR5F
(5' cggcggggatccGGGTGGAACAAGATGGATTATC 3') and AGMR (5' ACTGTATGGAAAATGAGAGCTGC 3'). The 3' half was amplified with the primers AGMF2 (5' CTCCCAAGAATCATCTTTACCAG 3') and CCR5R
(5' gccgccctcgagCCACTTGAGTCCGTGTCACAAG 3'), where the
lowercase letters indicate 5' extensions which are not derived from
CCR5 sequences. The PCR products were then purified by agarose gel
electrophoresis and gel extraction using a Qiaquick gel extraction kit
(Qiagen Inc., Valencia, Calif.). Purified PCR products (20 ng) were
sequenced in both directions using the same primers used for the PCRs
by automated fluorescent dye-terminator sequencing in the Microbiology
and Molecular Immunology Core Facility at Oregon Health Sciences
University on a 377 DNA sequencer (PE Applied Biosystems, Foster City,
Calif.). Because the PCR products overlap, this analysis allowed for
the sequence of the entire CCR5-coding region to be determined from
both strands for all except the 5' and 3' ends of approximately 20 bp,
which were determined from only one strand. For DNA samples from CV-1 cells, the cloning of the full-length CCR5-coding sequences was as
previously described (37). In this study the full-length coding region was amplified from sample 6243 using the CCR5F and CCR5R
primers. These
1.1-kb PCR products were subcloned into pBluescript
II (KS+) (Stratagene) and sequenced as previously described
(37). For both the CV-1 and 6243 DNA samples, the analysis
of the full-length alleles confirmed the sequencing of the 600-bp PCR
products and allowed for determination of the linkage of the
polymorphisms in these monkeys. The PCR and sequencing results reported
in this study were unambiguous and reproducible.
Coreceptor expression vectors. The plasmid encoding CXCR4 cDNA (pcDNA3-LESTR) was provided by Marcal Loetscher (Theodor Kocher Institute, University of Bern, Bern, Switzerland). pcDNA3 expression vectors containing human, NIH/Swiss mouse, wild-type AGM, AGM(D13N), AGM(Q93R), and AGM(Y14N, L352F) CCR5-coding sequences were previously described (37). pcDNA3-AGM(S38T, Q93K) was constructed by subcloning the AGM(S38T, Q93K) (from AGM sample 6243 [see above]) coding sequence from pBluescript II (KS+)-AGM(S38T, Q93R) into pcDNA3 (Invitrogen, Carlsbad, Calif.) using the BamHI and XhoI restriction sites flanking the CCR5-coding region. The AGM(S38T)-coding sequence was generated by splicing the BamHI-to-MscI fragment from pBluescript II (KS+)-AGM(S38T, Q93K) into pBluescript II (KS+)-wild-type AGM digested with the same enzymes. Likewise, the AGM(Q93K)-coding sequence was generated by splicing the MscI-to-BglII fragment from pBluescript II (KS+)-AGM(S38T, Q93K) into pBluescript II (KS+)-wild-type AGM digested with the same enzymes. The resulting AGM(S38T) and AGM(Q93K) CCR5-coding sequences were then subcloned into pcDNA3 using the BamHI and XhoI restriction sites flanking the CCR5-coding region. The pcDNA3-CXCR6 and pcDNA3-BOB plasmids were generated by PCR amplification of the human CXCR6 (46)- and BOB-coding sequences from pBABE-Bonzo and pBABE-BOB vectors (AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH [contributed by Dan Littman]) using primers specific to these coreceptors and containing BamHI and XhoI restriction sites flanking the coding region. The resulting PCR products were then subcloned into pcDNA3 as described above.
Coreceptor activity assays. Coreceptor activity assays using SIVagm virus isolates were performed by the immunoperoxidase focal infectivity method essentially as described previously for HIV-1 (9, 37). Briefly, coreceptors were transiently expressed in HeLa-CD4 (clone HI-J) or CV-1-CD4 (clone CB.14) cells by transfection by the calcium phosphate method as previously described (37). At 48 h after transfection, cells were seeded at 2 × 104 cells/well in 24-well cluster plates. The cells were infected 24 h after seeding by incubating the cells with various dilutions of the SIVagm stocks in DMEM supplemented with 0.1% FBS in the presence of 8 µg of DEAE-dextran per ml for 2 h at 37°C, after which time the cells were fed with DMEM supplemented with 10% FBS. Seventy-two hours later, cells were fixed and stained as previously described for HIV-1 (9), except that a 1:1,000 dilution of the pooled heat-inactivated sera from four SIVagm-seropositive AGMs (kindly provided by Ronald C. Desrosiers, New England Regional Primate Research Center) was used as the primary antibody and a horseradish peroxidase-conjugated goat anti-monkey immunoglobulin G antibody which cross-reacted with AGM immunoglobulin G (Sigma, St. Louis, Mo.) was used as the second antibody. Controls with no SIVagm and with serial dilutions of SIVagm stocks showed that the resulting immunoperoxidase staining was specific to SIVagm infections (results not shown).
Flow cytometry. HeLa-CD4 (clone HI-J) cells and HEK293T cells were transiently transfected as described above with the pcDNA3-CCR5 expression vectors. Cells were reseeded into new flasks at 24 h posttransfection and were removed 24 h later with 8 mM EDTA-150 mM NaCl (pH 8.0). Approximately 5 × 105 cells were resuspended in 100 µl of DMEM containing 10% FBS and 0.125 µg of phycoerythrin (PE)-conjugated mouse anti-human CCR5 monoclonal antibody (clone 3A9; B-D PharMingen, San Diego, Calif.). Clone 3A9 was used to detect AGM CCR5 because it cross-reacts with rhesus CCR5 (60) and with AGM CCR5. Cells were incubated with the 3A9 conjugate for 30 min at 37°C, washed three times with DMEM containing 10% FBS, and resuspended in the same medium lacking phenol red. The live stained cells were then analyzed for PE fluorescence using a FACScan flow cytometer (BD Immunocytochemistry Systems, San Jose, Calif.). The gating was set so that only 0.4% of the mock-transfected cells were in the positive window, and we recorded the fluorescence intensity of each cell. Based on the results with both cell types, we concluded that within each experiment the transfection efficiencies for all pcDNA3-CCR5 expression vectors were the same within experimental error. Although not a significant issue in this analysis, CCR5 mutants that are expressed relatively poorly on cell surfaces or that bind the 3A9 antibody weakly can appear to have been transfected less efficiently by this analytical method.
Signal transduction assays.
For expression of cRNA in
Xenopus laevis oocytes, cRNAs encoding the CCR5 receptor and
the G
K-channel Kir 3.1 were transcribed in vitro with T7 RNA
polymerase from the oocyte expression vector as previously described
(43). Collagenase-treated, defolliculated stage IV or V
oocytes were injected with 50 ng of cRNA and were incubated at 18°C
with oocyte Ringer solution ND96 (5 mM HEPES [pH 7.5], 96 mM NaCl, 2 mM KCl, 1.8 mM CaCl2, 1 mM
MgCl2). Experiments were performed at 25°C 3 to
4 days after injection. Potassium currents were measured by
two-electrode voltage clamping using a Geneclamp 500 amplifier (Axon
Instruments, Foster City, Calif.). Current-voltage protocols were
performed with the pClamp 6.0 program (Axon Instruments) run on an
IBM-compatible PC interfaced with a Digidata 1200 A/D. Microelectrodes
were filled with 3 mM KCl (resistances were <2.5 M
), and recordings
from voltage-clamped oocytes held at
30 mV were performed with
constant perfusion of ND96 containing 100 mM KCl in the presence and
absence of different concentrations of ligand. Raw current recordings
and current-voltage data were prepared and exported by the pClamp 6.0 software (Axon Instruments). Imported data were analyzed on a Macintosh
PowerPC using the analysis software. Data are presented as mean
values ± standard errors of the means (SEM). Dose-response
curves were fitted to the Michaelis-Menten equation by least squares,
and 50% effective concentrations (EC50s) were calculated.
| |
RESULTS |
|---|
|
|
|---|
Polymorphisms in the CCR5 genes of AGM species.
To identify
polymorphisms in the CCR5 genes of AGMs and their possible roles in
natural transmission of SIVagm viruses, we analyzed the CCR5-coding
sequences of 23 AGMs and three cell lines (CV-1, BS-C-1, and Vero) (see
Materials and Methods). Based on its high frequency in these samples
and its presence in all four AGM species, we defined a consensus CCR5
nucleic acid sequence, which we consider to be the common wild-type
sequence of AGMs. It differs from the previously reported CCR5 clone 2 allele of CV-1 cells (37) by only one synonymous
nucleotide substitution, T300C. The corresponding wild-type CCR5
protein was encoded by at least 23 of the 52 alleles analyzed in this
investigation. Figure 1 shows a synopsis
of the nucleotide polymorphisms detected in these samples relative to
the consensus nucleotide sequence, mapped onto a topological model of
the wild-type AGM CCR5 amino acid sequence. Table 1 summarizes the
properties of each monkey, including its species, its geographic
origin, its specific polymorphism(s), and its infection status.
|
Coreceptor dependencies of SIVagm infections.
To evaluate the
coreceptor requirements of SIVagm isolates, we adapted a focal
infectivity assay (9) in which dilutions of the viruses
were incubated with CD4-positive adherent cell cultures, followed
72 h later by immunoperoxidase staining using pooled sera from
SIVagm-infected AGMs. As shown by the representative data in Table
2, the five tested SIVagm isolates showed
strongly stained discrete foci of infection in monolayer cultures of
HeLa-CD4 cells that had been previously transiently transfected with
the pcDNA3-human CCR5 expression vector. However, in contrast to
previous studies using R5 strains of HIV-1, the background levels of
infection in the control cultures transfected with vector alone were
significant, ranging from approximately 3 to 6% for Cpa27 to
approximately 91% for the sab-2 isolate of SIVagm.
|
|
0.001; n = 12). In other studies we have shown that the rare L352F substitution,
which affects the intracellular carboxyl-terminal region of CCR5, has
no effect on these infectivity assays (37). Moreover, we
have previously shown that coreceptors are overexpressed in these
transient-transfection assays and that weak coreceptors become much
more efficient when they are overexpressed (36). We
conclude that the Y14N and Q93R substitutions in AGM CCR5 severely attenuate infections by all of the SIVagm strains that we employed.
|
|
Effects of AGM CCR5 polymorphisms on natural and experimental
SIVagm infections.
Table 1 summarizes our evidence concerning the
infection status of the monkeys used in this investigation. Some of the
AGMs were naturally infected, and some of the seronegative monkeys were
experimentally infected after their capture in different regions of
Senegal or the Central African Republic. Interestingly, among the
tantalus the naturally infected monkeys included one Q93R heterozygote
that lacked any Y14 substitution (Tan B57) and two of the four Y14N
heterozygotes (Tan B83 and Tan B141). In contrast, none of the seven
Y14N tantalus homozygotes was naturally infected at the time of
capture, although several were later experimentally infected. These
experimentally infected monkeys are all seropositive and appear to
contain continuously replicating SIVagm viruses, suggesting that the
viruses may have become adapted to the severe Y14N lesion. This
distribution of the natural infections in the 12 tantalus monkeys would
be expected to occur at random with a low probability
(P
0.02), implying that monkeys homozygous for
CCR5(Y14N) are probably resistant to natural transmission of SIVagm.
However, analyses of additional tantalus monkeys caught in the wild
will be necessary to definitively evaluate this hypothesis and to
determine the degree of resistance to infection and to viral replication.
Biochemical effects of the CCR5(Y14N) mutation.
Previous
evidence has established that tyrosine sulfation occurs at the Y3, Y10,
Y14, and Y15 positions, which are common to human and AGM CCR5s, and
that these sulfations are important for HIV-1 infections
(17). Thus, Y-to-A substitutions at these sites severely
inhibit coreceptor activity (36, 58). Although the Y14A
mutation was not individually analyzed, simultaneous Y-to-A mutations
at several of these tyrosines also severely attenuated chemokine-dependent signal transduction (17). In addition,
as illustrated in Fig. 1, the CCR5(Y14N) mutation converts a YYT sequence common to human and AGM CCR5s into an NYT consensus sequence for potential N-linked glycosylation. Consistent with this, we have
previously shown that the CCR5(Y14N) mutation results in incomplete
N-linked glycosylation of human CCR5, with approximately 60% of the
molecules acquiring this modification (36). Interestingly, however, the remaining 40% of CCR5(Y14N) molecules that lacked this
N-linked oligosaccharide bound 125I-labeled
MIP-l
with the same affinity as wild-type CCR5 (36).

-coupled potassium channel, which enables
signal transduction through heterotrimeric G protein-coupled receptors
to be monitored by two-electrode voltage clamp recording
(43). As shown in Fig. 4A,
the chemokine concentration dependencies (EC50s)
for activations of wild-type and Y14N mutant versions of human CCR5s
were not significantly different. However, in agreement with our
evidence that only 40% of the CCR5(Y14N) is unglycosylated and able to bind 125I-labeled MIP-1
, the quantity of
signaling was approximately 40% as high for CCR5(Y14N) as for
wild-type CCR5. This evidence suggests that the CCR5(Y14N) molecules
that lack an N-linked oligosaccharide are fully active in MIP-1
binding and in signal transduction. Thus, the unglycosylated asparagine
side chain at position 14 severely inhibits infections while preserving
substantial chemokine receptor function. Similarly, Fig. 4B shows that
wild-type and Q93R mutant AGM CCR5s have very similar signal
transduction properties. Since wild-type human and AGM CCR5s contain
N13 and D13 residues, respectively, and are both active in
chemokine-mediated signaling (Fig. 4) (62), this sequence
difference also does not significantly perturb signal transduction in
this assay system.
|
| |
DISCUSSION |
|---|
|
|
|---|
These results substantiate previous preliminary evidence which suggested that nonsynonymous substitution polymorphisms might occur relatively frequently in AGM CCR5 genes and that these polymorphisms might often cause amino acid substitutions at the critical sites required for infections by immunodeficiency viruses (37). Thus, in a previous analysis of DNAs derived from five AGMs, we found heterozygosity for linked Y14N and L352F substitutions in CV-1 cells, heterozygosity for a D13N substitution in vervet 6243, heterozygosity for a Q93R substitution in sabaeus 9312, heterozygosity for a Q93K substitution in BS-C-1 cells derived from a grivet, and homozygosity for the wild-type allele in Vero cells from a vervet (37). Furthermore, the D13N substitution was also detected in another vervet (16). The two AGM monkeys used in our previous study were derived from populations that became established in the Caribbean islands in the 17th to 18th centuries, and it was unclear whether those samples would be representative of outbred African AGMs. Consequently, in the present investigation we supplemented our earlier data by analyzing DNAs from 21 additional AGMs, most of which were tantalus and sabaeus monkeys that were wild born and independently captured between 1988 and 1995 in at least three distinct regions of the Central African Republic or in distinct regions of Senegal (see additional information concerning monkey origins in Table 1). As summarized in Fig. 1 and Table 1, the composite data from the 26 AGM DNAs (52 CCR5 alleles) include 29 nonsynonymous nucleotide substitutions, of which 24 are predicted to cause tightly clustered D13N or Y14N substitutions in the CCR5 amino terminus or Q93R and Q93K substitutions in ECL1. Thus, the overall frequency of nonsynonymous substitutions in these alleles is 0.56 per allele. A high frequency of nonsynonymous substitutions was also detected by other methods in our previous study of four AGM CCR5 alleles (51).
Although data concerning polymorphisms in human CCR5-coding sequences
have been somewhat variable in different studies (3, 10,
66), a relatively comprehensive analysis of the CCR5-coding regions of 50 DNA samples from each of five ethnic groups implied that
the frequency of nonsynonymous substitutions is in the range of
approximately 0.07 to 0.16 per allele in these groups (3). In Caucasians the
32 CCR5 deletion allele has a null phenotype and
occurs at a frequency of approximately 0.05 to 0.13 (3, 42, 53,
59, 61, 63). Moreover, the ratio of nonsynonymous to synonymous
nucleotide sequence changes has been approximately 1.0 throughout
evolution of the CCR5-coding region of primates (54),
whereas it is approximately 1.9 for the AGM sequences in our study.
Considered together, this evidence supports the hypothesis that the AGM
CCR5-coding sequences have evolved under relatively intense selection
pressure caused by the high-frequency SIVagm infections (greater than
50% of sexually mature adults [26, 31, 41, 50]) that
occur in the AGM subspecies.
A corollary of this hypothesis that is supported by this investigation is that the AGM substitution polymorphisms would be expected to frequently modify critical sites required for SIVagm infections. Accordingly, the D13N, Y14N, Q93R, and Q93K substitutions in AGM CCR5 all strongly inhibit infections by SIVagm isolates within the context of AGM CCR5 as indicated by our focal infectivity assay for these viruses (Fig. 2 and 3). As determined using the 3A9 monoclonal antibody, none of these mutations altered cell surface expression of the CCR5 proteins in human cells. Moreover, these mutations did not substantially perturb cell surface expression or chemokine-stimulated signaling by these CCR5s in Xenopus oocytes (Fig. 4). Consequently, we conclude that these mutations specifically inhibit coreceptor activities of AGM CCR5s. In contrast, the nonsynonymous substitutions found in human CCR5 are randomly situated throughout the protein (3, 6, 10, 66). Moreover, extensive alanine scanning mutagenesis studies of human CCR5 have demonstrated that very few substitutions cause significant losses of coreceptor function (15, 23, 58). Thus, the AGM CCR5 substitutions not only are comparatively frequent but also are exceptionally informative concerning the critical sites required for immunodeficiency virus infections.
Further studies will be required to determine whether these alleles influence transmission or outcome of infections by the SIVagm viruses found in the same AGM populations as the mutations. In particular, it is possible that during their coevolution specific SIVagm strains have become adapted to specific mutations in CCR5, either by altered interactions with CCR5 or by utilizing another coreceptor, and these adaptations could conceivably change the pattern of virus transmission or replication in these monkey populations. In addition, it will be interesting to learn whether viruses that are present in experimentally infected monkeys carrying these mutant CCR5 alleles have adapted to the mutations. Presumably, mutations that attenuate virus interactions with CCR5 would selectively eliminate infections of cells that express low levels of CD4 or CCR5 on their surfaces (36, 57).
We emphasize that the active sites identified in this study are relevant to the AGM CCR5 protein and that somewhat different results can occur when these substitutions are incorporated into human CCR5. For example, AGM(D13N) CCR5 is attenuated as a coreceptor for SIVagm, whereas these same viruses efficiently use human CCR5, which also contains N at position 13 (Fig. 2 and 3). Similarly, Q93R and Q93K substitutions strongly inhibit SIVagm (Fig. 2 and 3) or R5 HIV-1 infections (37) in the context of AGM CCR5 but have reduced effects on HIV-1 infections in the context of human CCR5 (data not shown). These results are consistent with other evidence that weakened interactions of immunodeficiency viruses with one region of CCR5 can be compensated for by strong interactions with other sites in the coreceptor (E. Platt, S. E. Kuhmann, and D. Kabat, unpublished data). Specifically, we found that forced passaging of the R5 HIV-1 isolate JR-CSF in HeLa-CD4/CCR5(Y14N) cultures resulted in outgrowth of adapted viruses that are less dependent on the amino-terminal region of CCR5 and more reliant on increased interactions with the ECL2 region.
A limitation in our present investigation derives from the small number of SIVagm isolates that we were able to analyze. This is a significant issue in all studies, in part because SIVagm viruses are ancient and separated into four genetic subtypes, each specific for its natural AGM host (2, 5, 26, 30, 31, 41, 50), and in part because the available SIVagm strains have all been isolated following their replication in human Molt4-8 cells (1, 12, 19, 34). These cells, which have been uniquely useful for growing stocks of SIVagm (1, 12, 19, 34), contain a low concentration of CCR5 (40), and it is conceivable that the viruses have become altered by this passage (8). However, we believe that such adaptations must have been limited, because the SIVagm strains all efficiently utilize wild-type AGM CCR5 (Fig. 2 and 3), which is a poor coreceptor for HIV-1 (37, 62). A thorough analysis of this issue would require studies of numerous SIVagm samples derived directly from naturally infected AGMs of distinct species.
Additional studies will also be required to test our preliminary evidence that tantalus monkeys homozygous for the severe Y14N CCR5 substitution may be resistant to natural infections by SIVagm variants that are endemic in their environment. Although our evidence supports this hypothesis and is consistent with the prevalence of SIVagm infections determined in a survey of tantalus monkeys of all ages (50), we cannot exclude the possibility that naturally occurring SIVagm strains in tantalus monkey populations might have become adapted to use CCR5(Y14N) or another cell surface component as a coreceptor. The possibility of viral adaptation is supported by the fact that several of these Y14N homozygous tantalus monkeys were experimentally infected with SIVagm after their capture (see Table 1) and have maintained low viral loads (reference 52 and unpublished results). Similarly, a SIVrcm from a red-capped mangabey homozygous for a partially deleted CCR5 null allele adapted to this mutation of its host and exclusively uses the alternative coreceptor CCR2b (7).
Despite its severely debilitating effect on CCR5 coreceptor activity, the Y14N mutation has only a minor quantitative effect on its function in chemokine binding (36) and in signal transduction (Fig. 4). This mutation eliminates a tyrosine sulfation site that is critical for coreceptor activity (17) and creates an NYT sequence that is partially (ca. 60%) modified by N-linked glycosylation (36). Although these N-glycosylated CCR5 molecules are inactive in both signaling and coreceptor function, our results imply that the ungylcosylated CCR5(Y14N) component (i.e., 40% of the total) is fully active in chemokine binding (62) and in signal transduction (Fig. 4). Thus, the Y14N substitution appears to cause an ideal combination of resistance to SIVagm with retention of substantially normal chemokine signaling. Similarly, the Q93R substitution has no effect on chemokine signaling by CCR5 (Fig. 4), and the D13 and N13 residues are also both fully compatible with CCR5 chemokine signaling (Fig. 4) (62). These results support the hypothesis that the AGM CCR5 polymorphisms were selected for their resistance to SIVagm infections and for their preservation of CCR5 signaling.
In summary, our results support previous evidence that AGMs have been infected at high frequencies by SIVagm viruses since ancient times (2, 5, 26, 30, 31, 41, 50). As a consequence of this prolonged virus-host coevolution, the AGM CCR5-coding sequence has become highly polymorphic, with relatively frequent nonsynonymous nucleotide substitutions that strongly inhibit coreceptor activity but have only minor effects on chemokine binding or signaling.
Our study thus provides strong initial evidence for a true coevolution of SIVs with their natural hosts. The evident consequence of this coevolution is a balance between viruses that persist at high frequency and hosts that do not progress to disease. An important corollary of this interpretation is that AGMs are likely to contain a repository of abundant polymorphisms in other genes that have important roles in controlling infections and in limiting pathogenesis of immunodeficiency viruses. As in the example of CCR5, these polymorphisms would be expected to specifically alter the sites that are critical for the resistance properties of the encoded proteins. From this perspective, further analyses of AGMs and other endemically infected primates may be exceptionally helpful for identifying protein targets relevant to disease reduction and for developing treatments to counteract immunodeficiency viruses, including HIV-1.
| |
ACKNOWLEDGMENTS |
|---|
This research was supported by NIH grant CA67358 and by the French Agency for AIDS Research (ANRS).
We thank Jonathan Allen for donation of DNA samples from several AGMs derived from colony monkey populations and Ronald Desrosiers for generously providing us with pooled sera from SIVagm-infected AGMs. The SIVagm strains 12, Cpa266, and Cpa27 used in this study were obtained from the AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH (contributed by Ronald Desrosiers), as was the Molt4-8 cell line. The SIVagm strains gri-1 and sab-2 were obtained from the AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH (contributed by Jonathan Allan). The CXCR6- and GPR15 (BOB)-coding regions were amplified from plasmids obtained from the AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH (contributed by Dan Littman).
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Biochemistry and Molecular Biology, Oregon Health Sciences University, 3181 S.W. Sam Jackson Park Rd., Portland, OR 97201-3098. Phone: (503) 494-8442. Fax: (503) 494-8393. E-mail: kabat{at}ohsu.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Allan, J. S., P. Kanda, R. C. Kennedy, E. K. Cobb, M. Anthony, and J. W. Eichberg. 1990. Isolation and characterization of simian immunodeficiency viruses from two subspecies of African green monkeys. AIDS Res. Hum. Retroviruses 6:275-285[Medline]. |
| 2. |
Allan, J. S.,
M. Short,
M. E. Taylor,
S. Su,
V. M. Hirsch,
P. R. Johnson,
G. M. Shaw, and B. H. Hahn.
1991.
Species-specific diversity among simian immunodeficiency viruses from African green monkeys.
J. Virol.
65:2816-2828 |
| 3. | Ansari-Lari, M. A., X.-M. Liu, M. L. Metzker, A. R. Rut, and R. A. Gibbs. 1997. The extent of genetic variation in the CCR5 gene. Nat. Genet. 16:221-222[CrossRef][Medline]. |
| 4. | Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.). 1994. Current protocols in molecular biology. John Wiley & Sons, Inc., New York, N.Y. |
| 5. | Bibollet-Ruche, F., C. Brengues, A. Galat-Luong, G. Galat, X. Pourrut, N. Vidal, F. Veas, J. P. Durand, and G. Cuny. 1997. Genetic diversity of simian immunodeficiency viruses from West African green monkeys: evidence of multiple genotypes within populations from the same geographical locale. J. Virol. 71:307-313[Abstract]. |
| 6. |
Blanpain, C.,
B. Lee,
M. Tackoen,
B. Puffer,
A. Boom,
F. Libert,
M. Sharron,
V. Wittamer,
G. Vassart,
R. W. Doms, and M. Parmentier.
2000.
Multiple nonfunctional alleles of CCR5 are frequent in various human populations.
Blood
96:1638-1645 |
| 7. |
Chen, Z.,
D. Kwon,
Z. Jin,
S. Monard,
P. Telfer,
M. S. Jones,
C. Y. Lu,
R. F. Aguilar,
D. D. Ho, and P. A. Marx.
1998.
Natural infection of a homozygous delta24 CCR5 red-capped mangabey with an R2b-tropic simian immunodeficiency virus.
J. Exp. Med.
188:2057-2065 |
| 8. | Cheng-Mayer, C., D. Seto, and J. A. Levy. 1991. Altered host range of HIV-1 after passage through various human cell types. Virology 181:288-294[CrossRef][Medline]. |
| 9. |
Chesebro, B., and K. Wehrly.
1988.
Development of a sensitive quantitative focal assay for human immunodeficiency virus infectivity.
J. Virol.
62:3779-3788 |
| 10. |
Cohen, O. J.,
S. Paolucci,
S. M. Bende,
M. Daucher,
H. Moriuchi,
M. Moriuchi,
C. Cicala,
R. T. Davey, Jr.,
B. Baird, and A. S. Fauci.
1998.
CXCR4 and CCR5 genetic polymorphisms in long-term nonprogressive human immunodeficiency virus infection: lack of association with mutations other than CCR5-Delta32.
J. Virol.
72:6215-6217 |
| 11. |
Corbet, S.,
M. C. Muller-Trutwin,
P. Versmisse,
S. Delarue,
A. Ayouba,
J. Lewis,
S. Brunak,
P. Martin,
F. Brun-Vezinet,
F. Simon,
F. Barre-Sinoussi, and P. Mauclere.
2000.
env sequences of simian immunodeficiency viruses from chimpanzees in Cameroon are strongly related to those of human immunodeficiency virus group N from the same geographic area.
J. Virol.
74:529-534 |
| 12. |
Daniel, M. D.,
Y. Li,
Y. M. Naidu,
P. J. Durda,
D. K. Schmidt,
C. D. Troup,
D. P. Silva,
J. J. MacKey,
H. W. Kestler III,
P. K. Sehgal, et al.
1988.
Simian immunodeficiency virus from African green monkeys.
J. Virol.
62:4123-4128 |
| 13. | Deng, H. K., D. Unutmaz, V. N. KewalRamani, and D. R. Littman. 1997. Expression cloning of new receptors used by simian and human immunodeficiency viruses. Nature 388:296-300[CrossRef][Medline]. |
| 14. |
Diop, O. M.,
A. Gueye,
M. Dias-Tavares,
C. Kornfeld,
A. Faye,
P. Ave,
M. Huerre,
S. Corbet,
F. Barre-Sinoussi, and M. C. Muller-Trutwin.
2000.
High levels of viral replication during primary simian immunodeficiency virus SIVagm infection are rapidly and strongly controlled in African green monkeys.
J. Virol.
74:7538-7547 |
| 15. |
Dragic, T.,
A. Trkola,
S. W. Lin,
K. A. Nagashima,
F. Kajumo,
L. Zhao,
W. C. Olson,
L. Wu,
C. R. Mackay,
G. P. Allaway,
T. P. Sakmar,
J. P. Moore, and P. J. Maddon.
1998.
Amino-terminal substitutions in the CCR5 coreceptor impair gp120 binding and human immunodeficiency virus type 1 entry.
J. Virol.
72:279-285 |
| 16. |
Edinger, A. L.,
C. Blanpain,
K. J. Kunstman,
S. M. Wolinsky,
M. Parmentier, and R. W. Doms.
1999.
Functional dissection of CCR5 coreceptor function through the use of CD4-independent simian immunodeficiency virus strains.
J. Virol.
73:4062-4073 |
| 17. | Farzan, M., T. Mirzabekov, P. Kolchinsky, R. Wyatt, M. Cayabyab, N. P. Gerard, C. Gerard, J. Sodroski, and H. Choe. 1999. Tyrosine sulfation of the amino terminus of CCR5 facilitates HIV-1 entry. Cell 96:667-676[CrossRef][Medline]. |
| 18. | Feng, Y., C. C. Broder, P. E. Kennedy, and E. A. Berger. 1996. HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane, G protein-coupled receptor. Science 272:872-877[Abstract]. |
| 19. | Fomsgaard, A., V. M. Hirsch, J. S. Allan, and P. R. Johnson. 1991. A highly divergent proviral DNA clone of SIV from a distinct species of African green monkey. Virology 182:397-402[CrossRef][Medline]. |
| 20. | Gao, F., E. Bailes, D. L. Robertson, Y. Chen, C. M. Rodenburg, S. F. Michael, L. B. Cummins, L. O. Arthur, M. Peeters, G. M. Shaw, P. M. Sharp, and B. H. Hahn. 1999. Origin of HIV-1 in the chimpanzee Pan troglodytes troglodytes. Nature 397:436-441[CrossRef][Medline]. |
| 21. | Gao, F., L. Yue, A. T. White, P. G. Pappas, J. Barchue, A. P. Hanson, B. M. Greene, P. M. Sharp, G. M. Shaw, and B. H. Hahn. 1992. Human infection by genetically diverse SIVSM-related HIV-2 in west Africa. Nature 358:495-499[CrossRef][Medline]. |
| 22. | Garred, P., H. O. Madsen, J. Petersen, H. Marquart, T. M. Hansen, S. Freiesleben Sorensen, B. Volck, A. Svejgaard, and V. Andersen. 1998. CC chemokine receptor 5 polymorphism in rheumatoid arthritis. J. Rheumatol. 25:1462-1465[Medline]. |
| 23. |
Genoud, S.,
F. Kajumo,
Y. Guo,
D. Thompson, and T. Dragic.
1999.
CCR5-mediated human immunodeficiency virus entry depends on an amino-terminal gp120-binding site and on the conformational integrity of all four extracellular domains.
J. Virol.
73:1645-1648 |
| 24. |
Gonzalez, E.,
M. Bamshad,
N. Sato,
S. Mummidi,
R. Dhanda,
G. Catano,
S. Cabrera,
M. McBride,
X. H. Cao,
G. Merrill,
P. O'Connell,
D. W. Bowden,
B. I. Freedman,
S. A. Anderson,
E. A. Walter,
J. S. Evans,
K. T. Stephan,
R. A. Clark,
S. Tyagi,
S. S. Ahuja,
M. J. Dolan, and S. K. Ahuja.
1999.
Race-specific HIV-1 disease-modifying effects associated with CCR5 haplotypes.
Proc. Natl. Acad. Sci. USA
96:12004-12009 |
| 25. |
Hartung, S.,
K. Boller,
K. Cichutek,
S. G. Norley, and R. Kurth.
1992.
Quantitation of a lentivirus in its natural host: simian immunodeficiency virus in African green monkeys.
J. Virol.
66:2143-2149 |
| 26. | Hayami, M., E. Ido, and T. Miura. 1994. Survey of simian immunodeficiency virus among nonhuman primate populations. Curr. Top. Microbiol. Immunol. 188:1-20[Medline]. |
| 27. | Hirsch, V. M., G. Dapolito, P. R. Johnson, W. R. Elkins, W. T. London, R. J. Montali, S. Goldstein, and C. Brown. 1995. Induction of AIDS by simian immunodeficiency virus from an African green monkey: species-specific variation in pathogenicity correlates with the extent of in vivo replication. J. Virol. 69:955-967[Abstract]. |
| 28. | Hirsch, V. M., R. A. Olmsted, M. Murphey-Corb, R. H. Purcell, and P. R. Johnson. 1989. An African primate lentivirus (SIVsm) closely related to HIV-2. Nature 339:389-392[CrossRef][Medline]. |
| 29. | Ioannidis, J. P., T. R. O'Brien, P. S. Rosenberg, D. G. Contopoulos-Ioannidis, and J. J. Goedert. 1998. Genetic effects on HIV disease progression. Nat. Med. 4:536[CrossRef][Medline]. (Letter.) |
| 30. | Jin, M. J., H. Hui, D. L. Robertson, M. C. Müller, F. Barré-Sinoussi, V. M. Hirsch, J. S. Allan, G. M. Shaw, P. M. Sharp, and B. H. Hahn. 1994. Mosaic genome structure of simian immunodeficiency virus from west African green monkeys. EMBO J. 13:2935-2947[Medline]. |
| 31. |
Johnson, P. R.,
A. Fomsgaard,
J. Allan,
M. Gravell,
W. T. London,
R. A. Olmsted, and V. M. Hirsch.
1990.
Simian immunodeficiency viruses from African green monkeys display unusual genetic diversity.
J. Virol.
64:1086-1092 |
| 32. | Jolly, C., J. E. Phillips-Conroy, T. R. Turner, S. Broussard, and J. S. Allan. 1996. SIVagm incidence over two decades in a natural population of Ethiopian grivet monkeys (Cercopithecus aethiops aethiops). J. Med. Primatol. 25:78-83[Medline]. |
| 33. |
Kabat, D.,
S. L. Kozak,
K. Wehrly, and B. Chesebro.
1994.
Differences in CD4 dependence for infectivity of laboratory-adapted and primary patient isolates of human immunodeficiency virus type 1.
J. Virol.
68:2570-2577 |
| 34. |
Kikukawa, R.,
Y. Koyanagi,
S. Harada,
N. Kobayashi,
M. Hatanaka, and N. Yamamoto.
1986.
Differential susceptibility to the acquired immunodeficiency syndrome retrovirus in cloned cells of human leukemic T-cell line Molt-4.
J. Virol.
57:1159-1162 |
| 35. |
Kostrikis, L. G.,
A. U. Neumann,
B. Thomson,
B. T. Korber,
P. McHardy,
R. Karanicolas,
L. Deutsch,
Y. Huang,
J. F. Lew,
K. McIntosh,
H. Pollack,
W. Borkowsky,
H. M. Spiegel,
P. Palumbo,
J. Oleske,
A. Bardeguez,
K. Luzuriaga,
J. Sullivan,
S. M. Wolinsky,
R. A. Koup,
D. D. Ho, and J. P. Moore.
1999.
A polymorphism in the regulatory region of the CC-chemokine receptor 5 gene influences perinatal transmission of human immunodeficiency virus type 1 to African-American infants.
J. Virol.
73:10264-10271 |
| 36. |
Kuhmann, S. E.,
E. J. Platt,
S. L. Kozak, and D. Kabat.
2000.
Cooperation of multiple CCR5 coreceptors is required for infections by human immunodeficiency virus type 1.
J. Virol.
74:7005-7015 |
| 37. | Kuhmann, S. E., E. J. Platt, S. L. Kozak, and D. Kabat. 1997. Polymorphisms in the CCR5 genes of African green monkeys and mice implicate specific amino acids in infections by simian and human immunodeficiency viruses. J. Virol. 71:8642-8656[Abstract]. |
| 38. | Kurth, R., and S. Norley. 1994. Simian immunodeficiency viruses of African green monkeys. Curr. Top. Microbiol. Immunol. 188:21-33[Medline]. |
| 39. |
Lalani, A. S.,
J. Masters,
W. Zeng,
J. Barrett,
R. Pannu,
H. Everett,
C. W. Arendt, and G. McFadden.
1999.
Use of chemokine receptors by poxviruses.
Science
286:1968-1971 |
| 40. |
Lee, B.,
M. Sharron,
L. J. Montaner,
D. Weissman, and R. W. Doms.
1999.
Quantification of CD4, CCR5, and CXCR4 levels on lymphocyte subsets, dendritic cells, and differentially conditioned monocyte-derived macrophages.
Proc. Natl. Acad. Sci. USA
96:5215-5220 |
| 41. |
Li, Y.,
Y. M. Naidu,
M. D. Daniel, and R. C. Desrosiers.
1989.
Extensive genetic variability of simian immunodeficiency virus from African green monkeys.
J. Virol.
63:1800-1802 |
| 42. | Liu, R., W. A. Paxton, S. Choe, D. Ceradini, S. R. Martin, R. Horuk, M. E. MacDonald, H. Stuhlmann, R. A. Koup, and N. R. Landau. 1996. Homozygous defect in HIV-1 coreceptor accounts for resistance of some multiply-exposed individuals to HIV-1 infection. Cell 86:367-377[CrossRef][Medline]. |
| 43. |
Madani, N.,
S. L. Kozak,
M. P. Kavanaugh, and D. Kabat.
1998.
gp120 envelope glycoproteins of human immunodeficiency viruses competitively antagonize signaling by coreceptors CXCR4 and CCR5.
Proc. Natl. Acad. Sci. USA
95:8005-8010 |
| 44. |
Martin, K. A.,
R. Wyatt,
M. Farzan,
H. Choe,
L. Marcon,
E. Desjardins,
J. Robinson,
J. Sodroski,
C. Gerard, and N. P. Gerard.
1997.
CD4-independent binding of SIV gp120 to rhesus CCR5.
Science
278:1470-1473 |
| 45. |
Martin, M. P.,
M. Dean,
M. W. Smith,
C. Winkler,
B. Gerrard,
N. L. Michael,
B. Lee,
R. W. Doms,
J. Margolick,
S. Buchbinder,
J. J. Goedert,
T. R. O'Brien,
M. W. Hilgartner,
D. Vlahov,
S. J. O'Brien, and M. Carrington.
1998.
Genetic acceleration of AIDS progression by a promoter variant of CCR5.
Science
282:1907-1911 |
| 46. | Matloubian, M., A. David, S. Engel, J. E. Ryan, and J. G. Cyster. 2000. A transmembrane CXC chemokine is a ligand for HIV-coreceptor Bonzo. Nat. Immunol. 1:298-304[CrossRef][Medline]. |
| 47. | McDermott, D. H., P. A. Zimmerman, F. Guignard, C. A. Kleeberger, S. F. Leitman, and P. M. Murphy. 1998. CCR5 promoter polymorphism and HIV-1 disease progression. Multicenter AIDS Cohort Study (MACS). Lancet 352:866-870[CrossRef][Medline]. |
| 48. | Michael, N. L., G. Chang, L. G. Louie, J. R. Mascola, D. Dondero, D. L. Birx, and H. W. Sheppard. 1997. The role of viral phenotype and CCR-5 gene defects in HIV-1 transmission and disease progression. Nat. Med. 3:338-340[CrossRef][Medline]. |
| 49. | Michael, N. L., L. G. Louie, A. L. Rohrbaugh, K. A. Schultz, D. E. Dayhoff, C. E. Wang, and H. W. Sheppard. 1997. The role of CCR5 and CCR2 polymorphisms in HIV-1 transmission and disease progression. Nat. Med. 3:1160-1162[CrossRef][Medline]. |
| 50. |
Müller, M. C.,
N. K. Saksena,
E. Nerrienet,
C. Chappey,
V. M. Hervé,
J.-P. Durand,
P. Legal-Campodonico,
M. C. Lang,
J. P. Digoutte,
A. J. Georges,
M.-C. Georges-Courbot,
P. Sonigo, and F. Barré-Sinoussi.
1993.
Simian immunodeficiency viruses from central and western Africa: evidence for a new species-specific lentivirus in tantalus monkeys.
J. Virol.
67:1227-1235 |
| 51. | Muller-Trutwin, M. C., S. Corbet, J. Hansen, M. C. Georges-Courbot, O. Diop, J. Rigoulet, F. Barre-Sinoussi, and A. Fomsgaard. 1999. Mutations in CCR5-coding sequences are not associated with SIV carrier status in African nonhuman primates. AIDS Res. Hum. Retroviruses 15:931-939[CrossRef][Medline]. |
| 52. | Muller-Trutwin, M. C., S. Corbet, M. D. Tavares, V. M. Herve, E. Nerrienet, M. C. Georges-Courbot, W. Saurin, P. Sonigo, and F. Barre-Sinoussi. 1996. The evolutionary rate of nonpathogenic simian immunodeficiency virus (SIVagm) is in agreement with a rapid and continuous replication in vivo. Virology 223:89-102[CrossRef][Medline]. |
| 53. | Mummidi, S., S. S. Ahuja, E. Gonzalez, S. A. Anderson, E. N. Santiago, K. T. Stephan, F. E. Craig, P. O'Connell, V. Tryon, R. A. Clark, M. J. Dolan, and S. K. Ahuja. 1998. Genealogy of the CCR5 locus and chemokine system gene variants associated with altered rates of HIV-1 disease progression. Nat. Med. 4:786-793[CrossRef][Medline]. |
| 54. |
Mummidi, S.,
M. Bamshad,
S. S. Ahuja,
E. Gonzalez,
P. M. Feuillet,
K. Begum,
M. C. Galvis,
V. Kostecki,
A. J. Valente,
K. K. Murthy,
L. Haro,
M. J. Dolan,
J. S. Allan, and S. K. Ahuja.
2000.
Evolution of human and non-human primate CC chemokine receptor 5 gene and mRNA. Potential roles for haplotype and mRNA diversity, differential haplotype-specific transcriptional activity, and altered transcription factor binding to polymorphic nucleotides in the pathogenesis of HIV-1 and simian immunodeficiency virus.
J. Biol. Chem.
275:18946-18961 |
| 55. | Murphy, P. M. 1993. Molecular mimicry and the generation of host defense protein diversity. Cell 72:823-826[CrossRef][Medline]. (Letter.) |
| 56. | Norley, S. G. 1996. SIVagm infection of its natural African green monkey host. Immunol. Lett. 51:53-58[CrossRef][Medline]. |
| 57. |
Platt, E. J.,
K. Wehrly,
S. E. Kuhmann,
B. Chesebro, and D. Kabat.
1998.
Effects of CCR5 and CD4 cell surface concentrations on infections by macrophagetropic isolates of human immunodeficiency virus type 1.
J. Virol.
72:2855-2864 |
| 58. |
Rabut, G. E.,
J. A. Konner,
F. Kajumo,
J. P. Moore, and T. Dragic.
1998.
Alanine substitutions of polar and nonpolar residues in the amino-terminal domain of CCR5 differently impair entry of macrophage- and dualtropic isolates of human immunodeficiency virus type 1.
J. Virol.
72:3464-3468 |
| 59. |
Rana, S.,
G. Besson,
D. G. Cook,
J. Rucker,
R. J. Smyth,
Y. Yi,
J. D. Turner,
H. H. Guo,
J. G. Du,
S. C. Peiper,
E. Lavi,
M. Samson,
F. Libert,
C. Liesnard,
G. Vassart,
R. W. Doms,
M. Parmentier, and R. G. Collman.
1997.
Role of CCR5 in infection of primary macrophages and lymphocytes by macrophage-tropic strains of human immunodeficiency virus: resistance to patient-derived and prototype isolates resulting from the ccr5 mutation.
J. Virol.
71:3219-3227[Abstract].
|
| 60. | Rottman, J. B., K. P. Ganley, K. Williams, L. Wu, C. R. Mackay, and D. J. Ringler. 1997. Cellular localization of the chemokine receptor CCR5. Correlation to cellular targets of HIV-1 infection. Am. J. Pathol. 151:1341-1351[Abstract]. |
| 61. | Samson, M., F. Libert, B. J. Doranz, J. Rucker, C. Liesnard, C. M. Farber, S. Saragosti, C. Lapoumeroulie, J. Cognaux, C. Forceille, G. Muyldermans, C. Verhofstede, G. Burtonboy, M. Georges, T. Imai, S. Rana, Y. Yi, R. J. Smyth, R. G. Collman, R. W. Doms, G. Vassart, and M. Parmentier. 1996. Resistance to HIV-1 infection in caucasian individuals bearing mutant alleles of the CCR-5 chemokine receptor gene. Nature 382:722-725[CrossRef][Medline]. |
| 62. |
Siciliano, S. J.,
S. E. Kuhmann,
Y. Weng,
N. Madani,
M. S. Springer,
J. E. Lineberger,
R. Danzeisen,
M. D. Miller,
M. P. Kavanaugh,
J. A. DeMartino, and D. Kabat.
1999.
A critical site in the core of the CCR5 chemokine receptor required for binding and infectivity of human immunodeficiency virus type 1.
J. Biol. Chem.
274:1905-1913 |
| 63. |
Smith, M. W.,
M. Dean,
M. Carrington,
C. Winkler,
G. A. Huttley,
D. A. Lomb,
J. J. Goedert,
T. R. O'Brien,
L. P. Jacobson,
R. Kaslow,
S. Buchbinder,
E. Vittinghoff,
D. Vlahov,
K. Hoots,
M. W. Hilgartner, and S. J. O'Brien.
1997.
Contrasting genetic influence of CCR2 and CCR5 variants on HIV-1 infection and disease progression. Hemophilia Growth and Development Study (HGDS), Multicenter AIDS Cohort Study (MACS), Multicenter Hemophilia Cohort Study (MHCS), San Francisco City Cohort (SFCC), ALIVE Study.
Science
277:959-965 |
| 64. |
Weatherall, D.,
J. Clegg, and D. Kwiatkowski.
1997.
The role of genomics in studying genetic susceptibility to infectious disease.
Genome Res.
7:967-973 |
| 65. |
Winkler, C.,
W. Modi,
M. W. Smith,
G. W. Nelson,
X. Wu,
M. Carrington,
M. Dean,
T. Honjo,
K. Tashiro,
D. Yabe,
S. Buchbinder,
E. Vittinghoff,
J. J. Goedert,
T. R. O'Brien,
L. P. Jacobson,
R. Detels,
S. Donfield,
A. Willoughby,
E. Gomperts,
D. Vlahov,
J. Phair, and S. J. O'Brien.
1998.
Genetic restriction of AIDS pathogenesis by an SDF-1 chemokine gene variant. ALIVE Study, Hemophilia Growth and Development Study (HGDS), Multicenter AIDS Cohort Study (MACS), Multicenter Hemophilia Cohort Study (MHCS), San Francisco City Cohort (SFCC).
Science
279:389-393 |
| 66. | Zhang, L., C. D. Carruthers, T. He, Y. Huang, Y. Cao, G. Wang, B. Hahn, and D. D. Ho. 1997. HIV type 1 subtypes, coreceptor usage, and CCR5 polymorphism. AIDS Res. Hum. Retroviruses 13:1357-1366[Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»