Previous Article | Next Article 
Journal of Virology, September 2001, p. 8400-8406, Vol. 75, No. 18
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.18.8400-8406.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Differential Regulation of Hepatitis B Virus Gene
Expression by the Sp1 Transcription Factor
Jie
Li and
Jing-hsiung
Ou*
Department of Molecular Microbiology and
Immunology, Keck School of Medicine, University of Southern
California, Los Angeles, California 90033
Received 2 March 2001/Accepted 1 June 2001
 |
ABSTRACT |
The expression of hepatitis B virus (HBV) genes is regulated by a
number of transcription factors. One such factor, Sp1, has two binding
sites in the core promoter and one in its upstream regulatory element,
which is also known as the ENII enhancer. In this study, we have
analyzed the effects of these three Sp1 binding sites on the expression
of HBV genes. Our results indicate that both Sp1 binding sites in the
core promoter are important for the transcription of the core RNA and
the precore RNA. Moreover, while the downstream Sp1 site (the Sp1-1
site) in the core promoter did not affect the transcription of the S
gene and the X gene, the upstream Sp1 site (the Sp1-2 site) in the core
promoter was found to negatively regulate the transcription of the S
gene and the X gene, as removal of the latter led to enhancement of
transcription of these two genes. The Sp1 binding site in the ENII
enhancer (the Sp1-3 site) positively regulates the expression of all of the HBV genes, as its removal by mutation suppressed the expression of
all of the HBV genes. However, the suppressive effect of the Sp1-3 site
mutation on the expression of the S gene and the X gene was abolished
if the two Sp1 sites in the core promoter were also mutated. These
results indicate that Sp1 can serve both as a positive regulator and as
a negative regulator for the expression of HBV genes. This dual
activity may be important for the differential regulation of HBV gene expression.
 |
INTRODUCTION |
Hepatitis B virus (HBV) is an
important human pathogen that can cause severe liver diseases,
including acute and chronic hepatitis. This virus has a small, circular
DNA genome with a size of about 3.2 kb. The viral genome carries four
genes named the C, S, X, and P genes (Fig.
1). The C gene codes for the viral core
protein that packages the viral genome and also for a related protein named precore protein. The precore protein is the precursor of the
secreted e antigen, which may be important for the establishment of
persistent infection following neonatal infection (for a review, see
reference 20). The S gene codes for three
co-carboxy-terminal envelope proteins named the pre-S-1, pre-S-2, and
major S proteins. These S gene products are also known as surface
antigens. The X gene codes for a transcriptional transactivator, and
the P gene codes for the viral DNA polymerase, which is also a reverse
transcriptase.

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 1.
The HBV genome and Sp1 binding sites. (A) Schematic
illustration of the HBV genome. P, S, X, and C, the four HBV genes. E1
and E2, ENI and ENII enhancers, respectively. Xp, Cp, pS1p, and mSp, X
promoter, core promoter, pre-S-1 promoter, and major S promoter,
respectively. The arrow indicates the unique poly(A) site. (B) The Sp1
binding sites in the core promoter and the ENII enhancer. The
nucleotide numbers in the HBV genome are indicated. PC and C,
transcription start sites of the precore RNA and the core RNA,
respectively. The mutations introduced into the three Sp1 sites are
also indicated.
|
|
The expression of the HBV genes is regulated by four different
promoters and two enhancer elements (Fig. 1A) (34). The
core promoter regulates the transcription of the precore RNA and the core RNA, the pre-S-1 promoter regulates the expression of the pre-S-1
RNA, the major S promoter regulates the transcription of the pre-S-2
RNA and the major S RNA, and the X promoter regulates the transcription
of the X RNA (Fig. 1). The precore RNA and the core RNA are larger than
the genome length. However, only the latter is used as the mRNA for the
synthesis of the viral DNA polymerase (17, 21). The ENI
enhancer partially overlaps the X promoter, and the ENII enhancer is
located upstream of the core promoter (12, 28, 32, 33,
38). Both enhancers can upregulate the activities of all four
HBV gene promoters (1, 33). Only one of the HBV DNA
strands is coding, and therefore the transcription of the HBV genes is
unidirectional. All of the HBV RNA transcripts terminate at the same
poly(A) site in the viral genome (Fig. 1A). It has been demonstrated
that cis-acting elements as well as the distance between the
promoter and the poly(A) site play important roles in determining
whether the poly(A) site should be used or bypassed for polyadenylation
of the viral RNA (9, 13, 26). For example, as this site is
located less than 200 bp from the core promoter, the C gene transcripts
bypass this site the first time and become polyadenylated at this site
only after they have circled around the genome once and encounter the
site the second time. In contrast, this poly(A) site is located
approximately 2 kbp away from the S gene promoters and is therefore
used efficiently by the S gene transcripts for polyadenylation when the
site is first encountered during transcription. The X promoter is
located about 700 bp upstream of the poly(A) site, and therefore the X gene transcripts bypass this poly(A) site with an intermediate efficiency of approximately 50% (13). This leads to the
production of two different X gene transcripts: one with a subgenomic
size of 700 nucleotides (nt) and the other with a larger-than-genome size of 3.9 kb (13).
Many cellular protein factors that may regulate HBV gene expression
have been identified. These factors include liver-enriched factors such
as HNF1, HNF3, and C/EBP and ubiquitous factors such as Sp1, RFX1,
NF-Y, and AP1 (4, 7, 15-19, 22, 24, 25, 30, 31, 35-37, 39,
40). In addition, members of the nuclear receptor superfamily
such as HNF4, RXR
, PPAR
, and COUP-TFs have also been found to
regulate the expression of HBV genes (5, 6, 8, 11, 14, 23,
35). Despite extensive studies that have been conducted to study
cis- and trans-acting factors that may regulate
HBV gene expression, how these factors may interact with each other to
allow differential expression of HBV genes remains largely unknown.
Sp1 is a ubiquitous transcription factor that binds to the GC-rich
elements (3). Several Sp1 binding sites have been
identified in the HBV genome, including one in the ENII enhancer, two
in the core promoter, and four in the major S promoter (24, 25, 36, 40, 41). Previous studies indicate that the Sp1 sites in the
core promoter are important for the core promoter activity and that
those in the major S promoter are important for the major S promoter
activity. However, those studies were conducted by using either
subgenomic HBV DNA fragments or reporter DNA constructs (24, 25,
36, 40, 41). The possible effects of Sp1 on HBV gene expression
in the context of the entire HBV genome were not studied. In this
study, we have focused our attention on the two Sp1 sites in the core
promoter and the Sp1 site in its upstream ENII enhancer and have
examined their effects on HBV gene expression in the context of the
entire HBV genome. Our results indicate that while these three Sp1
binding sites are important for the optimal activities of the core
promoter, they have different effects on the activities of the S
promoter and the X promoter.
 |
MATERIALS AND METHODS |
DNA plasmids.
pWTD contains the head-to-tail dimer of the
wild-type HBV genome of the adw2 subtype (30) (Fig. 1).
pHBV
Sp1-1 is identical to pWTD with the exception that it contains a
G-to-A mutation at nt 1748 in the Sp1-1 site (Fig. 1). pHBV
Sp1-2 is
identical to pWTD except that the G residue at nt 1736 in the Sp1-2
site has been deleted. pHBV
Sp1-3 is also identical to pWTD with the exception that it contains a C-to-A mutation at nt 1630 in the Sp1-3
site. pHBV
Sp1-1,2 contains both the G-to-A mutation at nt 1748 and a
deletion of nt 1736. Similarly, pHBV
Sp1-1,2,3 contains all three
nucleotide mutations in the Sp1-1, Sp1-2, and Sp1-3 sites. All of the
mutants were created by PCR-based mutagenesis procedures as previously
described (10). pXGH5 (Nichols Diagnostics) contains the
human growth hormone (hGH) reporter under the control of the mouse
metallothionein promoter.
Cell culture and DNA transfection.
Huh7 hepatoma cells were
maintained in Dulbecco modified Eagle medium containing 10%
fetal bovine serum. Cells were plated in a 10-cm-diameter petri dish
the day before transfection and transfected when they were 80%
confluent. Each plate of cells was transfected with 20 µg of DNA
using the calcium phosphate precipitation method. In all cases, pXGH5
was included in the transfection procedures to serve as an internal
control to monitor the transfection efficiency. Cells were lysed
48 h after transfection, and the RNA was isolated using our
previously described procedures (14).
Northern blot analysis.
In general, 10 µg of total RNA was
used for Northern blot analysis by our previous procedures
(14). The linearized 3.2-kb HBV EcoRI DNA
fragment was nick translated and labeled with 32P
to serve as a probe. For the analysis of the 0.7-kb X RNA, the 550-bp
BamHI-BglII HBV DNA fragment containing the X
protein-coding sequence was used as the probe, as it increases the
sensitivity of detection of the short X RNA (13).
EMSA.
The preparation of Huh7 nuclear extracts and
procedures for electrophoretic mobility shift assay (EMSA) and
supershift assay have been previously described (5, 14).
The sequences of the oligonucleotide probes used for the EMSA are as
follows: Sp1-1: wt 5' GAGGAGCTGGGGGAGGAGATTA 3'
3'
CTCGACCCCCTCCTCTAATCCA 5'
mt 5'
GAGGAGCTGGGAGAGGAGATTA 3'
3'
CTCGACCCTCTCCTCTAATCCA 5'
Sp1-2: wt 5'
TGTTTAAGGACTGGGAGGAGCTGGGGG 3'
3'
AATTCCTGACCCTCCTCGACCCCCTCC 5'
mt 5'
TGTTTAAGGACTGG-AGGAGCTGGGGG 3'
3'
AATTCCTGACC-TCCTCGACCCCCTCC 5'
Sp1-3: wt 5'
ACCACCGTGAACGCCCATCAGATCCTG 3'
3'
TGGCACTTGCGGGTAGTCTAGGACGGG 5'
mt 5'
ACCACCGTGAACGCACATCAGATCCTG 3'
3'
TGGCACTTGCGTGTAGTCTAGGACGGG 5'
Primer extension analysis.
The sequence of the antisense
primer used for analyzing the C gene transcripts is
5'GGTGAGCAATGCTCAGGAGACTCTAAGG3', which corresponds to nt
2051 to 2024 of the HBV genome. The antisense primer sequence used for
analyzing the S gene transcripts is
5'CCATGTTCGTCACAGGGTCCCCAGTCCTCGCGGAGATTG3', which
corresponds to nt 123 to 161 of the HBV genome (30).
The antisense primer sequence used for analyzing the hGH transcript is
5'GCCACTGCAGCTAGGTGAGCGTCC3'. The primer extension reaction was carried out as previously described (14).
 |
RESULTS |
Mutagenesis of the Sp1 sites in the ENII enhancer and C
promoter.
The three Sp1 sites located in the core promoter and the
ENII enhancer are illustrated in Fig. 1B. Sp1-1 and Sp1-2 are located in the core promoter, and Sp1-3 is in the ENII enhancer. As shown in
Fig. 2A, a synthetic DNA probe containing
the Sp1-1 sequence could be bound by a protein factor in the nuclear
extracts of Huh7 hepatoma cells to form a complex with a lower
electrophoretic mobility on the EMSA gel. The signal of this complex
was significantly reduced by the anti-Sp1 antibody but not by a control
antibody, indicating that this complex was caused by the binding of Sp1 to the DNA probe. Similar results were obtained with the Sp1-2 DNA
probe and the Sp1-3 DNA probe. These results confirm that the Sp1-1,
Sp1-2, and Sp1-3 sites can indeed be bound by Sp1. In order to
understand the functions of these Sp1 bindings sites in the expression
of HBV genes, they were individually mutated to prevent the binding of
Sp1 (Fig. 1). As shown in Fig. 2, the G-to-A mutation at nt 1748 prevented binding of Sp1 to the Sp1-1 DNA probe. Similarly, a
single-nucleotide deletion at nt 1736 and a C-to-A mutation at nt 1630 (Fig. 1) also prevented binding of Sp1 to the Sp1-2 site and the Sp1-3
site, respectively. Head-to-tail dimers of the HBV genome containing
these mutations were then constructed and transfected into Huh7 cells
for gene expression studies.

View larger version (66K):
[in this window]
[in a new window]
|
FIG. 2.
EMSA analysis of the Sp1 binding sites. The preparation
of Huh7 nuclear extracts (N.E.), the procedures for EMSA, and the
sequences of the DNA probes used are described in Materials and
Methods. The monoclonal anti-Sp1 antibody ( -Sp1) used for the
supershift assay was purchased from Santa Cruz Biochemicals, and the
control monoclonal anti-p53 antibody ( -p53) was purchased from
Calbiochem. (A) Sp1-1 probe. (B) Sp1-2 probe. (C) Sp1-3 probe. WT,
probe containing the wild-type sequence; MT, probe containing the
mutated sequence. The arrows mark the locations of the Sp1-DNA
complex.
|
|
Effects of Sp1-1 and Sp1-2 mutations on HBV gene expression.
HBV RNAs expressed in Huh7 cells were extracted and analyzed by
Northern blotting using the 32P-labeled 3.2-kb
HBV genomic DNA fragment. As shown in Fig.
3A, the mutation introduced at the Sp1-1
binding site reduced the HBV C gene transcripts to an almost
undetectable level. This mutation had little effect on the levels of
the S RNA and the 3.9-kb X RNA. The mutation introduced at the Sp1-2
site also reduced the C gene transcripts to an almost undetectable
level. Interestingly, while the Sp1-1 mutation had no apparent effects
on the transcription of the S RNA and the 3.9-kb X RNA, the Sp1-2
mutation increased the level of the S RNA approximately threefold and
the level of the 3.9-kb X RNA approximately sevenfold (Fig. 3A and C).
The Sp1-1 and Sp1-2 double mutation also similarly reduced the C RNA level and increased the S RNA and the 3.9-kb X RNA levels (Fig. 3A and
C). In all of our transfection experiments, we have included an hGH
reporter plasmid for cotransfection to serve as an internal control to
monitor the transfection efficiency (Fig. 3). The
32P-labeled hGH cDNA probe and the 3.2-kb HBV DNA
probe were included in the hybridization buffer for Northern blotting.
Unfortunately, the hGH internal control obscured the signal of the
0.7-kb X RNA, which migrated only slightly faster than the hGH mRNA on
the gel. For this reason, an identical Northern blot experiment was
repeated, and the hGH cDNA probe was used separately for the
hybridization. In this experiment, the
32P-labeled 0.6-kb
BamHI-BglII HBV DNA fragment containing sequences derived mostly from the X region was used as the probe. Based on our
experience in the past, this X region-specific probe significantly enhanced the 0.7-kb X RNA signal (13). As shown in Fig.
3B, similar to the case for the 3.9-kb X RNA, the 0.7-kb X RNA level was increased six- to sevenfold by either the Sp1-2 single mutation or
the Sp1-1 and Sp1-2 double mutation. This result indicates that the
increase of the 3.9-kb X RNA level was not due to an increase of
efficiency in bypassing the unique poly(A) site during RNA
transcription but rather was most likely due to an increase of the X
promoter activity.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 3.
(A and B) Northern blot analysis of the HBV RNAs. Huh7
cells transfected with pWTD (lanes 1), pHBV Sp1-1 (lanes 2),
pHBV Sp1-2 (lanes 3), and pHBV Sp1-1,2 (lanes 4) genomic DNA
constructs were lysed 48 h after transfection for RNA isolation.
(A) Northern blot analysis using the 32P-labeled 3.2-kb HBV
DNA probe and the hGH cDNA probe together. X, C, and S mark the
locations of the 3.9-kb X RNA (13), the C gene
transcripts, and the S gene transcripts, respectively. The location of
the hGH RNA internal control is also indicated. (B) Northern blot
analysis using the 32P-labeled HBV X region-specific DNA
probe and the hGH cDNA probe separately. X, C, and S mark the locations
of the X, C, and S gene transcripts, respectively. (C) Relative RNA
levels expressed by various HBV DNA constructs. X, C, and S indicate
the 3.9-kb X gene transcript, the C gene transcripts, and the S gene
transcripts, respectively. The RNA bands shown in panel A were measured
with a PhosphorImager (Molecular Dynamics, Sunnyvale, Calif.) and
normalized against the hGH RNA internal control. The X, C, and S RNA
levels expressed by the wild-type genome, pWTD, were arbitrarily set as
1. Error bars indicate standard deviations.
|
|
Since the resolution of the Northern blot gel is not high enough to
resolve precore and core RNAs, we also conducted primer
extension
analysis to analyze the effects of Sp1-1 and Sp1-2 mutations
on the
transcription of these two RNAs. As shown in Fig.
4A, the
mutation of the Sp1-1 site
significantly reduced both precore
and core RNA levels, which is
consistent with the Northern blot
results. Similarly, the Sp1-2
mutation also significantly reduced
both precore RNA and core RNA
levels, which is again consistent
with the Northern blot result. The
Sp1-1 and Sp1-2 double mutation
appeared to have an additive effect and
further reduced the precore
RNA and core RNA levels. Note that although
the wild-type HBV
genome expressed the precore RNA and core RNA at
similar levels,
the Sp1-1 and Sp1-2 double mutation reduced the core
RNA to an
almost undetectable level without totally abolishing the
expression
of the precore RNA (Fig.
4A). This result indicates that the
double
mutation had a greater effect on expression of the core RNA than
on that of the precore RNA. Similar primer extension experiments
were
also conducted to analyze the S gene transcripts. As shown
in Fig.
4B,
five major S gene transcripts could be detected. These
bands were
consistent with those previously reported (
19,
29);
the
uppermost band represented the pre-S-2 RNA, and the four lower
bands
were the major S RNAs (
19,
29). In agreement with the
Northern blot results, the Sp1-1 mutation had no effect on the
pre-S-2
RNA and major S RNA levels, but the Sp1-2 single mutation
or the Sp1-1
and Sp1-2 double mutation increased both pre-S-2
and major S RNA levels
approximately twofold (Fig.
4B).

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 4.
Primer extension analysis of HBV RNAs. HBV RNA isolated
from Huh7 cells was analyzed by primer extension as described in
Materials and Methods. (A) Primer extension analysis of the C gene
transcripts. The locations of the precore RNA, core RNA, and hGH RNA
are indicated. (B) Primer extension analysis of the S gene transcripts.
The locations of the pre-S-2 RNA, major S RNA, and hGH RNA are
indicated. Lanes 1, cells transfected with pWTD; lanes 2, cells
transfected with pHBV Sp1-1; lanes 3, cells transfected with
pHBV Sp1-2; lanes 4, cells transfected with pHBV Sp1-1,2. Lanes M,
DNA markers and their sizes (in kilodaltons).
|
|
Lack of effects of the X protein on HBV gene expression in Huh7
cells.
Both the Sp1-1 site and the Sp1-2 site reside in the X
protein-coding region. The nt 1748 G-to-A mutation in the Sp1-1 site is
a silent mutation for the X protein and thus should not affect its
expression. Our attempts to find a silent mutation for the X protein in
the Sp1-2 site that would abolish the binding of Sp1 have been
unsuccessful (data not shown). For that reason, the G residue at nt
1736 in the Sp1-2 site was deleted. This deletion created a frameshift
in the X protein sequence, which might be responsible for the observed
increase of the S gene and X gene levels. To rule out this possibility,
two new mutations were introduced into the X gene coding sequence. The
first mutation converted nt 1376 from A to C. This mutation removed the
initiation codon of the X protein-coding sequence (Fig.
5A). The second mutation is a C-to-T
mutation at nt 1397. This mutation created a premature termination
codon in the X protein sequence. These two mutations would abolish the
expression of the 16.5-kDa X protein. As shown in Fig. 5B, in agreement
with a previous report (2), these two mutations, when
introduced into the HBV genome, had no apparent effect on HBV gene
expression in Huh7 cells. These two mutations were then introduced into
pHBV
Sp1-2, the HBV genomic construct that carried the Sp1-2
mutation, to abolish the expression of the frameshifted X protein. As
shown in Fig. 5C, pHBV
Sp1-2 with and without the two additional
mutations that abolished the frameshifted X protein expression produced
indistinguishable viral RNA phenotypes (Fig. 5C). These results
indicate that the enhancement of the S gene and X gene expression by
the Sp1-2 mutation was not due to the frameshifted X protein.

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 5.
Northern blot analysis of HBV RNA expressed by the
X-negative HBV DNA constructs. (A) Schematic illustration of the
mutations introduced into the X protein-coding sequence. The locations
of the three Sp1 binding sites are indicated by arrowheads. ENII, ENII
enhancer; CP, C promoter; X protein, X protein-coding sequence; PC and
C, transcription start sites of precore and core RNAs, respectively.
(B) HBV RNA expressed in Huh7 cells by pWTD without (lane 1) or with
(lane 2) the mutations that abolished the expression of the 16.5-kDa X
protein. C, S, and X mark the locations of the C RNA, the S RNA, and
the 0.7-kb X RNA, respectively. (C) HBV RNA expressed in Huh7 cells by
pHBV Sp1-2 without (lane 1) or with (lane 2) the additional mutations
in the X protein-coding sequence. X, C, S, and hGH mark the locations
of the 3.9-kb X RNA, the C RNA, the S RNA, and the hGH RNA,
respectively. In both panels B and C, the 3.2-kb HBV genomic DNA was
used as the probe.
|
|
Role of the Sp1 binding site in the ENII enhancer.
As
mentioned above (Fig. 1), upstream from the core promoter is another
Sp1 binding site, which we named Sp1-3. This site is located in the
ENII enhancer. To investigate the possible role of this Sp1 binding
site in HBV gene expression, a C-to-A mutation at nt 1630 was
introduced into this site. This nucleotide mutation created a silent
mutation in the X protein-coding sequence. As discussed above, this
mutation abolished the binding of Sp1 (Fig. 2C). The mutation was
introduced into the HBV genome, which was then transfected into Huh7
cells. As shown in Fig. 6, the removal of
the Sp1-3 binding site resulted in an approximately two- to threefold
reduction of the levels of all of the HBV RNAs (Fig. 6C). This result
suggests that the optimal activity of the ENII enhancer is dependent on
Sp1, and hence abolishing Sp1 binding to this enhancer element results
in the suppression of all of the HBV promoter activities. When the Sp1
binding sites in the ENII enhancer and the core promoter were mutated
simultaneously, the C RNA level was further reduced, but interestingly,
the S RNA and 3.9-kb X RNA levels were increased by nearly twofold and fivefold, respectively (Fig. 6A and C). The 0.7-kb X RNA level also
showed a similar increase (Fig. 6B). The Northern blot results were
again verified by primer extension experiments. As shown in Fig.
7A, the mutation of the Sp1-3 site
reduced precore and core RNA levels, and the mutations of all three Sp1
sites further reduced the expression levels of these two RNAs, with a
greater effect on the core RNA. In contrast, while the mutation of the Sp1-3 site reduced the pre-S-2 RNA and major S RNA levels, the mutation
of all three Sp1 sites slightly increased the levels of pre-S-2 and
major S RNAs. These results indicate that the Sp1-3 site in the ENII
enhancer is a positive regulator for the expression of all of the HBV
genes, and its mutation reduces the expression levels of all of the HBV
genes. The suppressive effect of this mutation on the expression of S
and X genes, however, can be compensated for and further enhanced by
the mutation of the downstream Sp1 sites in the core promoter.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 6.
(A and B) Northern blot analysis of HBV RNAs expressed
by the HBV genomic construct carrying the Sp1-3 mutation. Huh7 cells
transfected by the HBV DNA constructs were lysed 48 h after
transfection for RNA isolation. The HBV RNA was then analyzed by
Northern blotting using the HBV DNA probe and the hGH cDNA probe either
together (A) or separately (B). Lanes 1, Huh7 cells transfected by
pWTD; lanes 2, Huh7 cells transfected by pHBV Sp1-3; lanes 3, Huh7
cells transfected by pHBV Sp1-1,2,3. The locations of the X, C, S,
and hGH RNAs are marked. (C) Relative RNA levels quantified with a
PhosphorImager. The gel shown in panel A was used for measurements
based on the procedures described in the legend to Fig. 3C. X, C, and S
indicate the 3.9-kb X gene transcript, the C gene transcripts, and the
S gene transcripts, respectively. Error bars indicate standard
deviations.
|
|

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 7.
Primer extension analysis of HBV RNA expressed from the
HBV DNA constructs carrying the Sp1-3 mutation. (A) Primer extension
analysis of the C gene transcripts. The locations of the precore RNA,
the core RNA, and the hGH RNA are marked. (B) Primer extension analysis
of the S gene transcripts. The locations of the pre-S-2 RNA, the major
S RNA, and the hGH RNA are marked. Lanes 1, Huh7 cells transfected by
the wild-type HBV DNA; lanes 2, Huh7 cells transfected by the HBV DNA
genome carrying the Sp1-3 mutation; lanes 3, Huh7 cells transfected by
the HBV DNA genome carrying the mutations of all three Sp1 sites.
|
|
 |
DISCUSSION |
The HBV DNA genome is circular and contains four transcription
units. Due to its compact genome size, these four transcription units
extensively overlap. Significant progress has been made during the past
15 years toward identifying cis- and trans-acting factors that may regulate the activities of these four transcription units. One of the trans-acting factors is the ubiquitous
transcription factor Sp1. Sp1 has two binding sites in the HBV core
promoter and one in its upstream ENII enhancer (36, 40,
41). Our results demonstrate that both Sp1 sites in the core
promoter are important for the transcription of the precore RNA and the
core RNA, although their effects on the core RNA appear to be more prominent (Fig. 4A). These results are consistent with a report by Yu
and Mertz (36), who found that Sp1 had a greater effect on
core RNA transcription than on precore RNA transcription in their in
vitro transcription experiments.
A surprising finding of ours is that the removal of the Sp1-2 site
resulted in the enhancement of transcription of the S gene and the X
gene. The enhancement for the S gene ranged from two- to threefold, and
that for the X gene ranged from five- to sevenfold, in different
experiments. Due to the low expression level of the pre-S-1 RNA, the
possible effect of the Sp1-2 site on the transcription of this RNA was
not investigated. Previous studies have shown that when the four HBV
promoters were analyzed individually, the X promoter was found to
display a very strong transcriptional activity (1, 12).
However, in the context of the entire HBV genome, this promoter is
relatively weak (e.g., see Fig. 3B, 5B, and 6B). The results shown in
this report indicate that the suppression of the X promoter activity in
the entire HBV genome could be at least partially attributed to the
Sp1-2 site.
The enhancement of S gene and X gene transcription by the mutation of
the Sp1-2 site cannot be simply due to suppression of the core promoter
activity, as the mutation of the Sp1-1 site, which similarly suppressed
the core promoter activity, did not enhance the transcription of the S
and X genes. How Sp1 that binds to the Sp1-2 site suppresses the
transcription of the S and X genes remains unclear. It does not appear
likely that this binding or mutation affects the RNA stability, as Sp1
is a DNA binding protein and the mutation is located in a region not
known to be involved in the regulation of RNA stability. It is perhaps
more likely that this Sp1 interacts with other transcription factors binding to the S promoter and the X promoter to suppress their activities. Alternatively, since the Sp1-2 site is located within the
transcription units of the S and X genes, Sp1 binding to this site may
suppress the process of elongation of S and X gene transcripts. In
either case, it is rather intriguing that Sp1 binding to the adjacent
Sp1-1 site fails to do so. It will be interesting to determine whether
this is due to the subtle difference between the Sp1-1 and Sp1-2
sequences (Fig. 1) or to their respective locations on the core
promoter. Experiments are being conducted to resolve these issues. Our
results are reminiscent of recent findings which indicate that Sp1 can
serve both as a positive regulator and as a negative regulator for gene
expression (27, 39).
The Sp1-3 site in the ENII enhancer is apparently important for the
transcription of all of the HBV genes, as the removal of this site by
mutagenesis led to the suppression of expression of all of the HBV
genes (Fig. 6). If the mutation of this site is also accompanied by
mutations of the Sp1-1 and Sp1-2 sites, then the expression level of
the C RNAs is further reduced (Fig. 6 and 7). However, in this case,
the S RNA and X RNA levels are increased rather than reduced (Fig. 6
and 7). This result indicates that the negative activity of the Sp1
factor binding to the Sp1-2 site likely plays a more prominent role
than the positive activity of the Sp1 factor binding to the Sp1-3 site
in the regulation of S gene and X gene expression.
In summary, in this report we demonstrate that the two Sp1 binding
sites in the core promoter and the Sp1 site in the ENII enhancer are
required for optimal activities of the core promoter, and while the
Sp1-2 site is a positive regulator of the core promoter, it is a
negative regulator of the major S promoter and the X promoter. The dual
activities of Sp1 may be important for the differential regulation of
HBV gene expression during natural HBV infection.
 |
ACKNOWLEDGMENTS |
We thank Jinah Choi for help with the preparation of some of the
figures and Jinah Choi and T. S. Benedict Yen for critical reading
of the manuscript.
This work was supported by a research grant from the National
Institutes of Health.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Microbiology and Immunology, University of Southern
California Keck School of Medicine, 2011 Zonal Ave., HMR-401, Los
Angeles, CA 90033. Phone: (323) 442-1720. Fax: (323) 442-1721. E-mail: jamesou{at}hsc.usc.edu.
 |
REFERENCES |
| 1.
|
Antonucci, T. K., and W. J. Rutter.
1989.
Hepatitis B virus (HBV) promoters are regulated by the HBV enhancer in a tissue-specific manner.
J. Virol.
63:579-583[Abstract/Free Full Text].
|
| 2.
|
Blum, H. E.,
Z. S. Zhang,
E. Galun,
F. von Weizsacker,
B. Garner,
T. J. Liang, and J. R. Wands.
1992.
Hepatitis B virus X protein is not central to the viral life cycle in vitro.
J. Virol.
66:1223-1227[Abstract/Free Full Text].
|
| 3.
|
Briggs, M. R.,
J. T. Kadonaga,
S. P. Bell, and R. Tjian.
1986.
Purification and biochemical characterization of the promoter-specific transcription factor, Sp1.
Science
234:47-52[Abstract/Free Full Text].
|
| 4.
|
Buckwold, V. E.,
M. Chen, and J. H. Ou.
1997.
Interaction of transcription factors RFX1 and MIBP1 with the gamma motif of the negative regulatory element of the hepatitis B virus core promoter.
Virology
227:515-518[CrossRef][Medline].
|
| 5.
|
Buckwold, V. E.,
Z. Xu,
M. Chen,
T. S. Yen, and J. H. Ou.
1996.
Effects of a naturally occurring mutation in the hepatitis B virus basal core promoter on precore gene expression and viral replication.
J. Virol.
70:5845-5851[Abstract].
|
| 6.
|
Buckwold, V. E.,
Z. Xu,
T. S. Yen, and J. H. Ou.
1997.
Effects of a frequent double-nucleotide basal core promoter mutation and its putative single-nucleotide precursor mutations on hepatitis B virus gene expression and replication.
J. Gen. Virol.
78:2055-2065[Abstract].
|
| 7.
|
Chen, M.,
S. Hieng,
X. Qian,
R. Costa, and J. H. Ou.
1994.
Regulation of hepatitis B virus ENI enhancer activity by hepatocyte-enriched transcription factor HNF3.
Virology
205:127-132[CrossRef][Medline].
|
| 8.
|
Chen, M., and J. H. Ou.
1995.
Cell type-dependent regulation of the activity of the negative regulatory element of the hepatitis B virus core promoter.
Virology
214:198-206[CrossRef][Medline].
|
| 9.
|
Cherrington, J.,
R. Russnak, and D. Ganem.
1992.
Upstream sequences and cap proximity in the regulation of polyadenylation in ground squirrel hepatitis virus.
J. Virol.
66:7589-7596[Abstract/Free Full Text].
|
| 10.
|
Ge, L., and P. Rudolph.
1997.
Simultaneous introduction of multiple mutations using overlap extension PCR.
BioTechniques
22:28-30[Medline].
|
| 11.
|
Guidotti, L. G.,
C. M. Eggers,
A. K. Raney,
S. Y. Chi,
J. M. Peters,
F. J. Gonzalez, and A. McLachlan.
1999.
In vivo regulation of hepatitis B virus replication by peroxisome proliferators.
J. Virol.
73:10377-10386[Abstract/Free Full Text].
|
| 12.
|
Guo, W. T.,
K. D. Bell, and J. H. Ou.
1991.
Characterization of the hepatitis B virus EnhI enhancer and X promoter complex.
J. Virol.
65:6686-6692[Abstract/Free Full Text].
|
| 13.
|
Guo, W. T.,
J. Wang,
G. Tam,
T. S. Yen, and J. S. Ou.
1991.
Leaky transcription termination produces larger and smaller than genome size hepatitis B virus X gene transcripts.
Virology
181:630-636[CrossRef][Medline].
|
| 14.
|
Li, J.,
V. E. Buckwold,
M. W. Hon, and J. H. Ou.
1999.
Mechanism of suppression of hepatitis B virus precore RNA transcription by a frequent double mutation.
J. Virol.
73:1239-1244[Abstract/Free Full Text].
|
| 15.
|
Li, M.,
Y. Xie,
X. Wu,
Y. Kong, and Y. Wang.
1995.
HNF3 binds and activates the second enhancer, ENII, of hepatitis B virus.
Virology
214:371-378[CrossRef][Medline].
|
| 16.
|
Lopez-Cabrera, M.,
J. Letovsky,
K. Q. Hu, and A. Siddiqui.
1991.
Transcriptional factor C/EBP binds to and transactivates the enhancer element II of the hepatitis B virus.
Virology
183:825-829[CrossRef][Medline].
|
| 17.
|
Nassal, M.,
M. Junker-Niepmann, and H. Schaller.
1990.
Translational inactivation of RNA function: discrimination against a subset of genomic transcripts during HBV nucleocapsid assembly.
Cell
63:1357-1363[CrossRef][Medline].
|
| 18.
|
Ori, A., and Y. Shaul.
1995.
Hepatitis B virus enhancer binds and is activated by the hepatocyte nuclear factor 3.
Virology
207:98-106[CrossRef][Medline].
|
| 19.
|
Ou, J., and W. J. Rutter.
1985.
Hybrid hepatitis B virus-host transcripts in a human hepatoma cell Proc.
Natl. Acad. Sci. USA
82:83-87[Abstract/Free Full Text].
|
| 20.
|
Ou, J. H.
1997.
Molecular biology of hepatitis B virus e antigen.
J. Gastroenterol. Hepatol.
12:S178-S187[Medline].
|
| 21.
|
Ou, J. H.,
H. Bao,
C. Shih, and S. M. Tahara.
1990.
Preferred translation of human hepatitis B virus polymerase from core protein- but not from precore protein-specific transcript.
J. Virol.
64:4578-4581[Abstract/Free Full Text].
|
| 22.
|
Pei, D. Q., and C. H. Shih.
1990.
Transcriptional activation and repression by cellular DNA-binding protein C/EBP.
J. Virol.
64:1517-1522[Abstract/Free Full Text].
|
| 23.
|
Raney, A. K.,
J. L. Johnson,
C. N. Palmer, and A. McLachlan.
1997.
Members of the nuclear receptor superfamily regulate transcription from the hepatitis B virus nucleocapsid promoter.
J. Virol.
71:1058-1071[Abstract].
|
| 24.
|
Raney, A. K.,
H. B. Le, and A. McLachlan.
1992.
Regulation of transcription from the hepatitis B virus major surface antigen promoter by the Sp1 transcription factor.
J. Virol.
66:6912-6921[Abstract/Free Full Text].
|
| 25.
|
Raney, A. K.,
D. R. Milich,
A. J. Easton, and A. McLachlan.
1990.
Differentiation-specific transcriptional regulation of the hepatitis B virus large surface antigen gene in human hepatoma cell lines.
J. Virol.
64:2360-2368[Abstract/Free Full Text].
|
| 26.
|
Russnak, R., and D. Ganem.
1990.
Sequences 5' to the polyadenylation signal mediate differential poly(A) site use in hepatitis B viruses.
Genes Dev.
4:764-776[Abstract/Free Full Text].
|
| 27.
|
Sasahara, R. M.,
C. Takahashi, and M. Noda.
1999.
Involvement of the Sp1 site in ras-mediated downregulation of the RECK metastasis suppressor gene.
Biochem. Biophys. Res. Commun.
264:668-675[CrossRef][Medline].
|
| 28.
|
Shaul, Y.,
W. J. Rutter, and O. Laub.
1985.
A human hepatitis B viral enhancer element.
EMBO J.
4:427-430[Medline].
|
| 29.
|
Standring, D. N.,
W. J. Rutter,
H. E. Varmus, and D. Ganem.
1984.
Transcription of the hepatitis B surface antigen gene in cultured murine cells initiates within the presurface region.
J. Virol.
50:563-571[Abstract/Free Full Text].
|
| 30.
|
Valenzuela, P.,
M. Quriroga,
J. Zaldivar,
P. Gray, and W. J. Rutter.
1980.
The nucleotide sequence of the hepatitis B viral genome and the identification of the major genes, p. 57-70.
In
B. N. Fields, R. Jaenisch, and C. F. Fox (ed.), Animal virus genetics. Academic Press, New York, N.Y.
|
| 31.
|
Wang, W. X.,
M. Li,
X. Wu,
Y. Wang, and Z. P. Li.
1998.
HNF1 is critical for the liver-specific function of HBV enhancer II.
Res. Virol.
149:99-108[CrossRef][Medline].
|
| 32.
|
Wang, Y.,
P. Chen,
X. Wu,
A. L. Sun,
H. Wang,
Y. A. Zhu, and Z. P. Li.
1990.
A new enhancer element, ENII, identified in the X gene of hepatitis B virus.
J. Virol.
64:3977-3981[Abstract/Free Full Text].
|
| 33.
|
Yee, J. K.
1989.
A liver-specific enhancer in the core promoter region of human hepatitis B virus.
Science
246:658-661[Abstract/Free Full Text].
|
| 34.
|
Yen, T. S. B.
1993.
Regulation of hepatitis B virus gene expression.
Semin. Virol.
4:33-42.
|
| 35.
|
Yu, X., and J. E. Mertz.
1997.
Differential regulation of the pre-C and pregenomic promoters of human hepatitis B virus by members of the nuclear receptor superfamily.
J. Virol.
71:9366-9374[Abstract].
|
| 36.
|
Yu, X., and J. E. Mertz.
1996.
Promoters for synthesis of the pre-C and pregenomic mRNAs of human hepatitis B virus are genetically distinct and differentially regulated.
J. Virol.
70:8719-8726[Abstract].
|
| 37.
|
Yuh, C. H., and L. P. Ting.
1991.
C/EBP-like proteins binding to the functional box-alpha and box-beta of the second enhancer of hepatitis B virus.
Mol. Cell. Biol.
11:5044-5052[Abstract/Free Full Text].
|
| 38.
|
Yuh, C. H., and L. P. Ting.
1990.
The genome of hepatitis B virus contains a second enhancer: cooperation of two elements within this enhancer is required for its function.
J. Virol.
64:4281-4287[Abstract/Free Full Text].
|
| 39.
|
Zaid, A.,
R. Li,
K. Luciakova,
P. Barath,
S. Nery, and B. D. Nelson.
1999.
On the role of the general transcription factor Sp1 in the activation and repression of diverse mammalian oxidative phosphorylation genes J.
Bioenerg. Biomembr.
31:129-135[CrossRef][Medline].
|
| 40.
|
Zhang, P., and A. McLachlan.
1994.
Differentiation-specific transcriptional regulation of the hepatitis B virus nucleocapsid gene in human hepatoma cell lines
Virology
202:430-440[CrossRef][Medline].
|
| 41.
|
Zhang, P.,
A. K. Raney, and A. McLachlan.
1993.
Characterization of functional Sp1 transcription factor binding sites in the hepatitis B virus nucleocapsid promoter.
J. Virol.
67:1472-1481[Abstract/Free Full Text].
|
Journal of Virology, September 2001, p. 8400-8406, Vol. 75, No. 18
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.18.8400-8406.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Zheng, Y., Li, J., Ou, J.-h.
(2004). Regulation of Hepatitis B Virus Core Promoter by Transcription Factors HNF1 and HNF4 and the Viral X Protein. J. Virol.
78: 6908-6914
[Abstract]
[Full Text]
-
Zheng, Y., Li, J., Johnson, D. L., Ou, J.-h.
(2003). Regulation of Hepatitis B Virus Replication by the Ras-Mitogen-Activated Protein Kinase Signaling Pathway. J. Virol.
77: 7707-7712
[Abstract]
[Full Text]
-
Reddy, S. P. M., Vuong, H., Adiseshaiah, P.
(2003). Interplay between Proximal and Distal Promoter Elements Is Required for Squamous Differentiation Marker Induction in the Bronchial Epithelium: ROLE FOR ESE-1, Sp1, AND AP-1 PROTEINS. J. Biol. Chem.
278: 21378-21387
[Abstract]
[Full Text]
-
Lin, W.-J., Li, J., Lee, Y.-F., Yeh, S.-D., Altuwaijri, S., Ou, J.-H., Chang, C.
(2003). Suppression of Hepatitis B Virus Core Promoter by the Nuclear Orphan Receptor TR4. J. Biol. Chem.
278: 9353-9360
[Abstract]
[Full Text]
-
Won, J., Yim, J., Kim, T. K.
(2002). Sp1 and Sp3 Recruit Histone Deacetylase to Repress Transcription of Human Telomerase Reverse Transcriptase (hTERT) Promoter in Normal Human Somatic Cells. J. Biol. Chem.
277: 38230-38238
[Abstract]
[Full Text]