Previous Article | Next Article ![]()
Journal of Virology, September 2001, p. 8147-8157, Vol. 75, No. 17
Department of Microbiology-Immunology,
Northwestern University Medical School, Chicago, Illinois 606113
Received 20 March 2001/Accepted 25 May 2001
The L1 and L2 capsid genes of human papillomavirus type 31 (HPV-31)
are expressed upon keratinocyte differentiation from a promoter located
in the E7 open reading frame (ORF) of the early region. Late
transcripts must therefore pass through and ignore the early
polyadenylation sequences to use the downstream late AAUAAA element
located at the end of the L1 ORF. To identify sequences which modulate
downstream capsid gene expression, a variety of substitution mutations
were introduced into the early polyadenylation signal and studied first
in the context of polycistronic luciferase reporter constructs. Removal
of the G/U-rich cleavage stimulation factor (CstF) binding sites and
the degenerate cleavage and polyadenylation specificity factor
binding sites, UAUAUA, had minimal effect on downstream expression as
defined by luciferase activities. This is in contrast to the deletion
of the HPV-31 early AAUAAA element, which resulted in a dramatic
increase in downstream expression. Additional sequences within the
first 800 bp of the L2 ORF were also found to negatively regulate
capsid expression in luciferase assays. To determine how these
mutations influence gene expression in the context of the complete
HPV-31 genome, recombinant genomes were constructed that contained a
substitution in the AAUAAA sequence, an inserted strong CstF binding
site, an inserted simian virus 40 (SV40) late poly(A) signal, or a
substitution of the 5'-most 800 nucleotides of the L2 ORF. Reductions
in both transient and stable replication were observed with the
recombinant genomes containing the strong CstF site or the late SV40
signal, suggesting that alterations in the strength of the upstream
poly(A) signal influence expression of viral replication factors.
Similarly, disruption of the L2 ORF resulted in a significant reduction
in genome replication and an inability to be maintained stably. In contrast, genomes containing a substitution of the AAUAAA sequence had
increased levels of transient and stable replication. Quantitation of
late transcripts following keratinocyte differentiation in methylcellulose also showed a reduction in downstream capsid gene expression in lines containing genomes with the strong CstF site or the
late SV40 signal mutations, while a significant increase in expression
was detected in the lines with genomes lacking the AAUAAA sequence.
These studies demonstrate that capsid gene expression in HPV-31
requires an inefficient early poly(A) signal which is defined primarily
by the AAUAAA element as well as a major negative regulatory element
located within the L2 ORF.
Human papillomaviruses (HPVs)
are small double-stranded DNA viruses that target cutaneous or mucosal
epithelium for infection. The productive HPV life cycle is dependent
upon epithelial differentiation (19, 30). Upon entry into
the basal cells, viruses establish and maintain their viral DNA as
autonomously replicating nuclear plasmids at a low copy number per
cell. HPV genomes are transcribed into polycistronic messages through
the use of multiple promoters, two polyadenylation signals, and
extensive splicing (Fig. 1)
(21). In the lower portion of infected epithelia, HPV-16
and -31 messages initiate primarily at the early promoter P97 and use a
polyadenylation signal, AAUAAA, located downstream of the E5 ORF
(21, 35, 36, 39, 49). In suprabasal cells, late messages
initiate at the differentiation-dependent promoter located within the
E7 open reading frame (ORF) and use a polyadenylation site at the end of either the E5 gene or the L1 gene (17, 21, 22, 34). The
nature and the location of these polyadenylation elements are conserved
among most papillomaviruses (3, 24).
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.17.8147-8157.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Early Polyadenylation Signals of Human
Papillomavirus Type 31 Negatively Regulate Capsid Gene
Expression

and
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

View larger version (23K):
[in a new window]
FIG. 1.
Map of the HPV-31 genome showing the major early and
late transcripts. Late messages terminate either near
pAEarly or at a downstream consensus hexanucleotide
element, pALate.
Papillomavirus capsid expression is restricted to the most differentiated layers of the epithelium (2). Transcripts encoding capsid genes initiate at the late promoter, P742, and must bypass the early polyadenylation signal to preferentially use the downstream poly(A) site (21, 22, 35). Differentiation promotes an increase in readthrough of the early signal which is in part due to changes in the activities and levels of polyadenylation factors (46). Downstream capsid gene expression is also influenced by numerous inhibitory elements located within the late coding region. cis-Acting negative regulatory elements have been identified through reporter assays in the 3' untranslated region (UTR) of bovine papillomavirus type 1 (BPV-1) and HPV-16 late mRNAs (12, 13, 25, 28). In BPV-1, this element inhibits late polyadenylation site usage through the binding of U1 small nuclear ribonucleoprotein to an unutilized 5' splice site (15). Additional inhibitory elements have been found in the HPV-16 L1 and L2 ORFs (42). It is, however, unclear what functions, if any, these elements have in the productive viral life cycle.
Due to the complexity of the vegetative life cycle of papillomaviruses, the requirements for a productive infection have been largely studied through the use of heterologous systems. With recent advances in cell culture techniques allowing the use of cell lines containing recombinant viral genomes, the requirements for a productive HPV infection are beginning to be elucidated. The in vitro synthesis of HPV can be accomplished through cotransfection of recircularized viral genomes with a drug resistance marker into normal human foreskin keratinocytes and has been successfully demonstrated for HPV-16, -18, and -31 (8, 10, 11, 32). In HPV-31, these methods have led to the identification of cis elements and trans-acting factors required for the productive viral life cycle (20, 27, 43-45, 47). Studies using recombinant HPV genomes have determined that late-gene expression requires episome maintenance, DNA amplification, and induction of the late promoter P742 (11). However, the cis elements and trans-acting factors involved in the differentiation-dependent induction of capsid gene expression remain largely unknown. The studies presented here examine the role of the HPV-31 early polyadenylation signal in regulating downstream capsid gene expression in recombinant HPV-31 genomes. In addition, the role of the early polyadenylation signal in the establishment and maintenance of the viral genome within the host keratinocyte was investigated.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Cell lines and cell culture. Normal human keratinocytes (NHKs) were derived from neonatal human foreskin epithelium as previously described and maintained in serum-free Keratinocyte Growth Medium (Clonetics) (16). The keratinocyte line LKP-31 maintains the HPV-31 genome in an episomal form and has been described previously (41). The CIN-612 line was derived from a cervical biopsy (5). SCC13 cells are a human squamous cell carcinoma line (38). LKP-31, CIN-612, and SCC13 cells were maintained in E medium with mitomycin C (Boehringer Mannheim)-treated fibroblast feeders (31). To induce differentiation, cells were suspended in semisolid medium containing 1.6% methylcellulose as previously described (41). For transient-expression assays, CIN-612 or LKP-31 cells were transfected with 0.5 µg of each reporter construct and 2.5 µg of pSP72 (Promega) using Lipofectamine (Gibco-BRL) in Opti-MEM (Gibco-BRL) according to the manufacturer's instructions. At 24 h after transfection, fibroblast feeders were removed with phosphate-buffered saline containing 0.5 mM EDTA, and keratinocytes were split either into semisolid medium or onto freshly treated fibroblasts. After 24 h, luciferase activities were determined through the Dual Luciferase Reporter Assay System (Promega) according to the manufacturer's instructions.
Transfection of NHKs. Transfection of viral DNA into NHKs has been described by Frattini et al. (11). Briefly, to remove the bacterial vector sequences, 10.0 µg of the p599-HPV31 plasmid and mutants were digested with HindIII overnight, followed by heat inactivation. Plasmids were ligated at a concentration of 10 ng/µl using T4 DNA ligase (10 U/900 µl) at 16°C overnight (Gibco-BRL). The DNA was precipitated with isopropyl alcohol and resuspended in TE buffer (10 mM Tris-Cl [pH 7.4rsqb], 1.0 mM EDTA). The entire precipitated ligation was cotransfected with 2.0 µg of pSV2Neo into NHKs with Lipofectace (Gibco-BRL) according to the manufacturer's instructions. Transfected cells were plated onto mitomycin-treated J2 fibroblast feeders in E medium 1 day after transfection. Selection began 2 days after transfection with G418 (200 µg/ml) (Gibco-BRL) every 2 days for a total of 4 days, and then G418 at 100 µg/ml every 2 days for 4 more days. After selection, pooled populations were expanded for analysis.
Recombinant plasmids.
Plasmid p599-31WT is a derivative of
pBR322-HPV31 containing a modified version of pBR322 (11,
14). pBR322 was digested with ClaI and
Eco47III, filled in with Klenow fragment, and ligated. The
resulting minimal pBR322 was digested with EcoRI and a
custom EcoRI and HindIII adapter linker
(5'-AATTTTAAGCTTAA) was inserted. The HPV-31 genome was
obtained from pBR322-HPV31 by digestion with EcoRI, ligated,
and inserted into the HindIII site of the modified
pBR322 plasmid. p599-31CP (CP) was created by PCR mutagenesis, replacing the early AAUAAA element with the sequence GGATCC. The 5'
product was obtained by PCR amplification using an upstream primer at nucleotide (nt) 3361 of HPV-31
(5'-cgggtaccgagctcGAATTCC) containing an
EcoRI site and a downstream primer at nt 4170 (5'-GGTAATAATAAAAAAAAAGTAAAAAAGggatccATACCAATACCA), where
capital letters indicate HPV-31 sequence and lowercase letters denote
restriction enzyme sites or random sequence. The 3' product was
obtained by PCR amplification using an upstream primer at nt 4121 (5'-GGTATTGGTATTGGTATggatccCTTTACTTTTTTTTTATTATTACC)
and a downstream primer at nt 4697 (5'-ggagatctGCAGGTGTAGGAGGCTGC). The products were combined
and amplified using the original primers at nt 3361 and 4697, with the
final species being inserted into the EcoRI and
PpuMI sites of p599-HPV31. p599-31CP also lacks one of six
repeated sequences, GGTATT, immediately upstream of the AAUAAA
substitution which does not appear to influence readthrough activity
when multiple repeats were substituted in pPolyA Luc-C15.2. Plasmid
p599-31LD (LD) was made through the same approach, making a 5' product
using a downstream primer at nt 4195 (5'-caacatacacaacacacaccCGCATGGTAATAATAAAA) and a 3' product
using an upstream primer at nt 4177 (5'-gtgtgtgttgtgtatgttgGCACTAACGTGCGTC). Plasmid p599-31SV
(SV) was constructed by cloning the simian virus 40 (SV40) late
polyadenylation signal from pGL3-Basic (Promega) into p599-31WT using
AvrII at nt 4071 and BglII at nt 4165. The AvrII and BglII sites in HPV-31WT were created by
PCR mutagenesis. Plasmid p599-31BL (BL) was constructed by PCR
mutagenesis, replacing nt 4219 to 5022 of p599-31WT with sequence from
the
-galactosidase gene. The 5' product was obtained from PCR
amplification using p599-31WT, the upstream primer at nt 3361, and a
downstream primer at nt 4217 (5'-cactccaggatccGTAGCAGACGCACGTTTAGTG). The 3' product was
produced as described below in the construction of the luciferase reporter plasmid pPolyA Luc-BL8. The products were combined, amplified using the outer primers, and inserted into the EcoRI and
StuI sites of p599-31WT. All sequences produced through PCR
amplification for recombinant genomes were sequenced in their entirety
(Northwestern University Biotechnology Center). Plasmid p599-BL also
contains an inadvertent substitution at nt 3448 which is silent in E2
but alters the E4 coding sequence. Studies have shown that mutations in
E4 have no effect on transient replication (D. J. Klumpp and L. A. Laimins, unpublished data). The HPV-31 E1 and E2
expression vectors pSG-E1 and -E2, respectively, are based on pSG5
(Stratagene) and have been described by Frattini and Laimins
(9). Plasmid pSL1-2 contains the
E1
E4,L1 cDNA from CIN-612 cells between nt 877 and
5760 of HPV-31 (21).
Luciferase reporter plasmids. (i) Poly(A) site mutations. Plasmid pPolyA Luc-Control has been described previously (46). Plasmid pPolyA Luc-1500 was created by PCR amplification of p599-31WT using an upstream primer at nt 3797 containing an EcoRI site (5'-atagaattcATATGACTATTTAGCCTAATG) and a downstream primer at nt 5679 containing a BglII site (5' ggagatctAGCAGCCTAGCACTGCCTG). The amplicon was cloned into the EcoRI and BamHI sites of pPolyA Luc-Control. Plasmids containing mutations in the early polyadenylation signal and L2 ORF were constructed using the pPolyA Luc-1500 reporter. pPolyA Luc-P15.1 was created by PCR amplification of p599-31CP, which lacks the AAUAAA element at nt 4138. The reporter pPolyA Luc-P15.2 was produced through PCR mutagenesis using p599-31WT and contains substitutions in both UAUAUA elements to CGGCCG at nt 3999 and CCCGGG at nt 4014. pPolyA Luc-C15.1 was constructed by replacing the sequence GGTATTGGTATTGGTATTGGT between nt 4103 and 4123 with ACGTAACCGTACACCTACAGCA. The plasmid pPolyA Luc-C15.2 was constructed by replacing ACTTTTTTTTT at nt 4151 to 4161 with CGAACACCCAT. pPolyA Luc-C15.3 was made by substituting AACGTGCGTCTGCT with GTCAAACCACAACC at nt 4202 to 4215. pPolyA Luc-L15 and pPolyA Luc-SV15 contain the late CstF binding site and SV40 late polyadenylation signal, respectively, as previously described, produced by PCR amplification and cloned into pPolyA Luc-1500.
(ii) Luciferase reporter plasmids with L2 substitution
mutations.
The plasmid pPolyA Luc-E15 was created by PCR
amplification of the HPV-31 E1 ORF between nt 901 and 2350 using
primers containing BamHI and EagI sites. The PCR
product was cloned into the BamHI and EagI sites
of pPolyA Luc-1500. The BamHI site was created in pPolyA
Luc-1500 by PCR mutagenesis at nt 4218. pPolyA Luc-EL8 contains
sequence from nt 901 to 1695 of E1 ORF between the BamHI and
StuI sites of pPolyA Luc-1500. The reporter pPolyA Luc-LE8 was made by PCR amplification of E1 nt 1724 to 2350, containing StuI and EagI sites, and cloned into the
StuI and EagI sites of pPolyA Luc-1500. pPolyA
Luc-EL4 was made by a two-step PCR amplification reaction. The E1
sequence was obtained by PCR amplification of nt 901 to 1296 (downstream primer, 5'-CATGTGTGCTACTGTACCATCTGCTGC). The L2
sequence was made by PCR amplification of nt 4620 to 5128 (upstream
primer, 5'-ATGGTACAGTAGCACACATGAAAATCCTAC). The PCR products
were then amplified using primers in E1 at nt 901 and in L2 at nt 5128 which contained BamHI and StuI sites and created an E1-L2 hybrid sequence. The sequence was cloned into the
BamHI and StuI sites of pPolyA Luc-1500. Plasmid
pPolyA Luc-LE4 was created by PCR amplification of L2 at nt 4018 to
4620 (downstream primer,
5'-GTTGTTTGTTGCTCCTCTAGAACACTTGTTACATCTAAAAGT) and of E1 at
nt 1298 to 1695 (upstream primer, 5'-TAGAGGAGCAACAAACAAC). PCR products were combined and amplified using primers in L2 at nt
4018 containing a BamHI site and in E1 at nt 1695 containing a StuI site. The L2-E1 hybrid PCR product was cloned into
the BamHI and StuI sites of pPolyA Luc-1500. The
reporter pPolyA Luc-BL8 was constructed by PCR amplification of the
-galactosidase gene at nt 906 to 1701 from pSV-
-galactosidase
(Promega) using primers that contained BamHI and
StuI sites. The product was cloned into the BamHI
and StuI sites of pPolyA Luc-1500. Plasmid pPolyA Luc-CPB was created by a two-step PCR amplification reaction. The 5' product was obtained by PCR amplification of nt 3797 to 4223 from pPolyA Luc-P15.1, while the 3' product was obtained by PCR amplification of nt
4211 to 5022 from pPolyA Luc-BL8. The products were PCR amplified with
primers at nt 3797 and nt 5022, containing BamHI and
StuI sites, respectively, and inserted into the
BamHI and StuI sites of pPolyA Luc-1500.
Transient-replication assays. Transient-replication assays were completed as previously described (20). Briefly, viral DNA was digested with HindIII and unimolecularly ligated. Samples were combined with carrier DNA and equimolar amounts of E1 and E2 expression plasmids (pSG-E1 and pSG-E2). SCC13 cells were transfected by electroporation at 250 V, 960 µF (Bio-Rad GenePulser) and plated onto mitomycin C-treated fibroblast feeders. At 5 days posttransfection, low-molecular-weight DNA was isolated through Hirt extraction (18). Samples were digested with DpnI to remove residual methylated DNA and with BanII to linearize viral genomes. After agarose gel electrophoresis and blotting to a nylon membrane (Magna; Micron Separations), DNA was detected with a radiolabeled HPV-31 DNA probe (HpaI-EcoRI fragment) and examined by autoradiography.
Southern blot analysis. Total genomic DNA of transfectants was isolated by resuspending cell pellets in lysis buffer (400 mM NaCl, 10 mM Tris-Cl [pH 7.4], 10 mM EDTA). Samples were incubated overnight at 37°C with 50 µg of proteinase K per ml and 0.2% sodium dodecyl sulfate (SDS). DNA was sheared by passage through an 18-gauge needle 10× and extracted with phenol-chloroform. Samples were treated with RNase A (50 µg/ml) at 37°C for 1 h, followed by phenol-chloroform extraction and ethanol precipitation. Southern blots were completed using 10.0 µg of total DNA digested with DpnI and/or BlpI. Digested samples were run on an 0.8% agarose gel overnight and alkaline transferred to GeneScreen Plus nylon membranes (NEN). Membranes were prehybridized in 50% (vol/vol) formamide-4× standard saline phosphate (0.18 M NaCl, 10 mM phosphate [pH 7.4], 1.0 mM EDTA)-5× Denhardt's solution (0.02% polyvinylpyrollidone, 0.02% Ficoll, 0.02% bovine serum albumin)-1.0% SDS-10% (vol/vol) dextran sulfate-0.1 mg of denatured herring sperm DNA per ml for 1 h at 42°C. The HPV-31 probe was prepared by gel purification of an XbaI-HindIII fragment and labeled with the Ready-to-go DNA labeling kit (Amersham Pharmacia). Labeled probe was purified with Probe Quant G-50 microcolumns (Amersham Pharmacia), denatured, and added to fresh hybridization solution, which was incubated overnight at 42°C. The membrane was washed twice with 2× SSC (1× SSC is 0.15 M NaCl plus 0015 M sodium citrate)-0.1% SDS for 15 min at room temperature, twice with 0.5× SSC-0.1% SDS for 15 min at room temperature, and once with 0.1× SSC-1.0% SDS for 30 min at 50°C. Membranes were visualized by autoradiography and quantitated through phosphorimaging.
Real-time RT-PCR analysis.
Quantitative reverse
transcription (RT)-PCR was completed using the LightCycler Instrument
(Roche) and the RNA amplification kit SYBR Green I (Roche) according to
the manufacturer's instructions. The RNA standards were made by in
vitro transcription reactions using the linearized plasmid pSL1-2 and
the Riboprobe Combination System T3/T7 (Promega) according to the
manufacturer's instructions. In vitro transcription reactions were
treated with DNase I to remove template DNA, phenol-chloroform
extracted, and ethanol precipitated prior to use. Transcripts
containing the E1
E4 splice site were amplified by
using an upstream primer at nt 770 (5'-AGCACACAAGTAGATATTCGC) and a downstream primer at nt
3487 (5'-GTCGCCTCGCAACAACTTG), amplifying a 301-nt product
from spliced RNA. Transcripts containing the E4
L1
splice site were amplified by an upstream primer at nt 3408 (5'-CGACGACGTCTACTAAGCG) and a downstream primer at nt 5696 (5'-ATGGATGGCCTACTGTAAGC), amplifying a 328-nt product from
spliced RNA. Template RNA was prepared as described above. RT-PCR was
completed using 2.0 µg of total cellular RNA unless otherwise noted.
The cycle profile was as follows, using a slope of 20°C/s: reverse
transcription, 55°C for 10 min, denaturation at 95°C for 30 s,
and amplification at 95°C for 1 s, 58°C for 10 s, and
72°C for 14 s (slope, 2°C/s) for 45 cycles; and melting curve,
97°C for 0 s, 65°C for 20 s, and 99°C for 0 s
(slope, 0.1°C/s). Acquisition of fluorescence was completed as a
single reading following each amplification cycle and as a continuous
reading during the melting curve. Product specificity was determined by
both melting-peak analysis and agarose gel electrophoresis (data not shown).
| |
RESULTS |
|---|
|
|
|---|
Readthrough activity is regulated by the early AAUAAA element.
For the majority of RNA polymerase II transcripts, efficient
polyadenylation requires a canonical AAUAAA element and a downstream GU- or U-rich (G/U-rich) sequence that binds the cleavage stimulatory factor (CstF) (7). Analysis of HPV-31 sequence around the
site of early polyadenylation identified a single early AAUAAA element and two degenerative upstream polyadenylation elements, UAUAUA, in
addition to several G/U-rich elements (46). In order to
examine the regulatory elements within the early polyadenylation signal of HPV-31 that influence readthrough, we first took advantage of a dual
luciferase reporter plasmid, pPolyA Luc-Control, that was used
previously to show that the early polyadenylation signal allows a
significant amount of readthrough to downstream expression (46). The reporter plasmid contains a cytomegalovirus
promoter driving expression of the Renilla luciferase gene
as well as the firefly luciferase gene, separated by the
encephalomyocarditis virus internal ribosome entry site (IRES) (Fig.
2A). This reporter assay examines
steady-state RNA levels and therefore indirectly measures
polyadenylation site usage and downstream expression.
|
Elements within the 5'-most 800 nt of L2 influence readthrough
activity.
Sequences within the L2 ORFs of both HPV-16 and BPV-1
have been implicated as negative regulators of papillomavirus late gene expression through the use of reporter assays (4, 42). We next investigated if such elements exist in HPV-31 and if these have a
role in modulating late gene expression. For these studies, a series of
substitutions were introduced into the L2 ORF in pPolyA Luc-1500 (Fig.
3A). The reporter pPolyA Luc-E15 was made
by replacing the L2 ORF with sequence from the HPV-31 E1 ORF, which
lacks any known cis-acting regulatory elements,
including splice sites, and, as such, functions as a neutral
spacer sequence (Fig. 3A). The substitutions were made to ensure that
the effects we were observing were not due to the changes in the number
of nucleotides separating the reporter genes. As shown in Fig. 3A,
transfection of pPolyA Luc-E15 into LKP-31 cells resulted in
a 6.0-fold increase in readthrough compared to the
parental pPolyA Luc-1500 plasmid. These observations confirm the
presence of inhibitory elements within the HPV-31 L2 coding region.
|
-galactosidase gene
were used as spacers. As in pPolyA Luc-EL8, we replaced the complete
800 nt at the 5' end of the L2 ORF with sequence from the
-galactosidase gene, making pPolyA Luc-BL8. In transient assays, a
similar level of downstream expression was observed with pPolyA Luc-BL8
and with the E1 substitution (Fig. 3B).
We next investigated whether altering the AAUAAA element in combination
with the 5'-most 800 nt of L2 would further modulate downstream
expression. For these studies, substitutions were made in both elements
to generate plasmid pPolyA Luc-CPB. Transfection of pPolyA Luc-CPB into
LKP-31 cells resulted in an increase in downstream expression
similar to that seen with pPolyA Luc-BL8 (Fig. 3B). We conclude that a
primary determinant regulating readthrough expression exists within
the 5'-most 800 nt of the L2 ORF and that this region negatively
regulates downstream capsid gene expression.
Mutations within HPV-31 early polyadenylation region influence
genome replication.
It was next important to examine the role of
the early polyadenylation signal in regulating downstream capsid gene
expression under more physiological conditions during the life cycle of
the virus. Since reporter assays identified the AAUAAA element and sequences within the L2 ORF as major regulators of early and late gene
expression, we mutated these elements in the context of the complete
HPV-31 genome. The AAUAAA element was disrupted in plasmid p599-31CP,
and the 5'-most 800 nt of the L2 ORF were replaced with sequence from
the
-galactosidase gene in p599-31BL (Fig. 4C). We also constructed genomes into
which we inserted a high-affinity CstF binding site as well as the SV40
late polyadenylation signal in place of the HPV-31 early
poly(A) signal (Fig. 4C). Previous studies using reporter assays
demonstrated that insertion of such strong elements into the early
polyadenylation signal significantly reduced readthrough into the
late region (46).
|
Recombinant genomes containing altered polyadenylation signals are
stably maintained within NHKs.
The productive HPV life cycle
requires stable maintenance of the viral genome as extrachromosomal
elements within the host keratinocyte. It was therefore important to
determine whether genomes containing mutations within the HPV-31 early
polyadenylation signal could be stably maintained. Wild-type and mutant
genomes were excised from the vector backbone, unimolecularly ligated, and cotransfected with the pSV2neo plasmid into normal NHKs. After selection of the cells with G418, colonies were pooled and expanded. Four to six weeks after transfection, total cellular DNA was extracted from the cells, digested with DpnI to remove any residual
input DNA, and analyzed by Southern blotting. As shown in Fig.
5 (lane 9), several prominent HPV-31
species were detected in lanes containing DNA from wild-type genome
transfections corresponding to supercoiled, open-circle, and linear
forms of DNA. Sample DNA isolated from wild-type, 31CP, 31LD, and 31SV
mutant transfections all contained episomal forms of DNA consistent
with extrachromosomal maintenance of the viral genome (Fig. 5, lanes 9 to 12). In contrast, the 31BL mutant was unable to be stably maintained
within primary keratinocytes (data not shown). A low level of
high-molecular-weight HPV DNA corresponding to integrated copies was
seen in all transfected cell lines and is most likely due to incomplete
religation of viral genomes prior to transfection.
|
Levels of early gene expression are similar between 31WT, 31CP,
31LD, and 31SV cell lines.
Since the mutations within the early
poly(A) signal may alter early gene expression in addition to modifying
readthrough into the late region, we investigated whether the
levels of early gene expression varied significantly between the cell
lines through the use of quantitative real-time RT-PCR. Quantitative
real-time RT-PCR allows an accurate measure of transcript levels, as
opposed to approximations obtained through RNase protection assays. For these studies, total RNA was isolated from the cell lines described above, and RT-PCR was performed using a set of primers which span the
splice donor at nt 877 and the acceptor at nt 3295. These primers allow
quantitation of E1
E4-containing transcripts, which are present in most early transcripts (Fig.
6B). RNA standards were synthesized
through in vitro transcription reactions using a linearized
plasmid template containing the E1
E4,L1 cDNA.
RT-PCR products were quantitated using SYBR green dye, which
incorporates into double-stranded DNA. After each round of cycling, the
dye binds to the PCR product, which can then be detected by
fluorescence. From these experiments, the concentration of
E1
E4-containing transcripts was determined from a
standard curve (Fig. 6A). Amplification of the correct mRNA target
sequence was then confirmed by melting-curve analysis and visualized by
ethidium bromide staining following agarose gel electrophoresis (data
not shown).
|
E4-containing transcripts in 2.0 µg of total
RNA (Fig. 6A). Similar concentrations were observed for the 31CP.1, 31LD.1, and 31SV.1 cell lines, with approximately 11.7 × 106, 6.7 × 106, and
7.7 × 106 copies per 2.0 µg of RNA,
respectively (Fig. 6A). The results are summarized in Table
1. An additional cell line, LKP-31, was included as a control; it contains the wild-type HPV-31 genome. The
LKP-31 cell line maintains a high episome copy number with few
integrated species. The expression levels in LKP-31 cells were slightly
elevated, with approximately 46.6 × 106
copies of E1
E4-containing transcripts in 2.0 µg
of total RNA (Table 1). Analysis of transfectants obtained
using a different primary NHK background cell line showed levels of
E1
E4-containing transcripts of approximately
12.7 × 105, 6.8 × 105, and 24.5 × 105
copies per 2.0 µg RNA for 31WT.2, 31CP.2, and 31LD.2-transfected lines, respectively (Table 1). These cell lines maintained fewer episomal copies per cell than the cell lines described above. However,
the relative ratio of early transcripts to wild-type genomes was
similar to that seen in the previous set of cell lines. We conclude
that the HPV-31 early poly(A) mutant genomes express similar levels of
viral early transcripts relative to wild-type genomes.
|
Activation of differentiation-dependent promoter P742 occurs in
polyadenylation mutant cell lines.
The induction of the late
promoter P742 results in an increase in late transcripts encoding
E1
E4,E5 and E1
E4,L1
(22). These two transcripts utilize alternative
polyadenylation signals at the end of E5 and L1, respectively. To
determine the levels of transcripts which contain the
E1
E4 splice site upon differentiation, quantitative
RT-PCR was performed using total RNA isolated from undifferentiated and
differentiated keratinocytes. Epithelial differentiation and induction
of late viral functions occur upon suspension of HPV-positive
keratinocytes in semisolid medium (26, 40, 41). Primers
which span the splice donor at nt 877 and splice acceptor at nt 3295 were used in this reaction. The results are summarized in Table 1.
Real-time RT-PCR analysis demonstrated an approximately 11.3-fold
induction of E1
E4-containing transcripts following
24 h in methylcellulose in a cell line containing wild-type genomes (LKP-31). When the keratinocytes harboring mutant genomes were
examined, comparable levels of induction were observed for the 31LD.1
and 31SV.1 cell lines at 12.8- and 8.0-fold, respectively (Fig. 6).
Interestingly, the 31CP.1 line showed a 26.7-fold induction of
E1
E4 transcripts, which is greater than that
observed in the other mutant or wild-type lines. Similar trends were
observed using cells from a second NHK donor (Table 1). The level of
induction observed in the 31WT.1 line was reduced, but we believe that
this is not representative and was not seen in two other wild-type lines (Table 1). We also observed that the levels of DNA amplification were similar in both wild-type and mutant cell lines (data not shown).
From these experiments, we conclude that the levels of differentiation-dependent induction of the P742 promoter were similar
in cells with wild-type, LD, and SV genomes. The cells containing the genomes with substitutions of the AAUAAA sequence generally induced to a slightly higher level.
Mutations within HPV-31 early polyadenylation signal alter
downstream capsid expression levels.
The experiments shown in Fig.
2 using a heterologous reporter system indicated that HPV-31
capsid gene expression requires an inefficient early polyadenylation
signal. We next investigated whether alterations within the HPV-31
early polyadenylation signal influence capsid gene
expression in cell lines containing recombinant genomes. For
these studies, the levels of
E4
L1-containing transcripts were
determined by real-time RT-PCR using a primer set that spans the
E4
L1 splice site (Fig.
7B). This primer set will detect the major late transcript, E1
E4,L1 (Fig. 1)
(21). Total RNA was isolated from cell lines placed in
semisolid medium for 24 h to induce keratinocyte differentiation.
A standard curve was made using RNA produced through an in vitro
transcription reaction using a DNA template containing the
E1
E4,L1 cDNA (Fig. 7A).
|
L1-containing transcripts and
E1
E4-containing transcripts, or readthrough
activity, between cell lines are presented in Table 1. Quantitation of
late transcripts from LKP-31 cells determined the ratio of
E4
L1- to E1
E4-containing
transcripts to be 7.9 × 10
4. Similar
results were observed in the 31WT.1 cell line, with a ratio of
expression of 3.9 × 10
4. The 31CP.1 cells
demonstrated a 32.9-fold increase in downstream expression compared to
31WT.1 cells (Fig. 8). This is in
contrast to the dramatic decreases in capsid gene expression levels
seen in 31LD.1 and 31SV.1 lines, where downstream expression decreased by approximately 67 and 95%, respectively (Fig. 8). In
undifferentiated cells, E4
L1-containing transcripts
were not detectable, and the levels of late transcripts expressed upon
differentiation are consistent with those seen in previous studies
(21). A similar pattern of capsid gene expression was
observed in cell lines using NHK cells from a different foreskin donor,
though the overall levels were reduced (Table 1, Fig. 8).
|
| |
DISCUSSION |
|---|
|
|
|---|
In this study, we determined that the early polyadenylation sequence AAUAAA as well as sequences within the first 800 nt of L2 are major regulators of both early and late gene expression in HPV-31. Since late HPV transcripts initiate in the early region, mechanisms must exist to prevent inappropriate readthrough into the late region during the early phases of the viral life cycle but allow it to occur following differentiation. Disruption of the early AAUAAA element resulted in significant increases in readthrough activity and downstream gene expression in the context of both the reporter system and recombinant HPV-31 genomes. Our observations are consistent with studies demonstrating the tight association between readthrough and polyadenylation at the early AAUAAA site (37). Additional regulatory elements such as the degenerative polyadenylation signal UAUAUA as well as putative G/U-rich CstF binding sites had only a modest effect on downstream expression. Studies in BPV-1 identified the degenerative signal UAUAUA, which functions in early polyadenylation, as disruption of this element altered the site of poly(A) addition (1). Our studies show that these degenerative sites have little effect in the context of a wild-type hexanucleotide sequence.
The ultimate test of the importance of these polyadenylation
elements is to examine their roles in regulating capsid gene expression during the vegetative life cycle. Quantitation of
E1
E4- and E4
L1-containing
transcripts isolated from differentiated keratinocytes containing
wild-type genomes demonstrated a significant amount of readthrough
activity from the early to late region. In contrast, introduction of
the strong late HPV-31 CstF binding site or the SV40 late
polyadenylation signal into the early polyadenylation region resulted
in dramatic decreases in capsid gene expression upon keratinocyte
differentiation. Such an effect would be anticipated if a weak
polyadenylation signal is required for efficient late gene expression.
Surprisingly, introduction of this strong polyadenylation signal into
the complete HPV-31 genome also resulted in decreased levels of
replication in both transient and stable replication studies. Wild-type
levels of replication were restored for both mutant genomes upon
cotransfection with expression vectors for the replication factors E1
and E2. These data suggest that introducing the late CstF binding site
and SV40 late signal into the HPV-31 early polyadenylation signal
reduced the levels of expression of viral replication proteins. It had
been anticipated that introduction of signals for efficient early
polyadenylation would result in increased levels of transcripts
encoding the replication factors E1 and E2 since any readthrough
transcripts would now be expected to terminate at the early site.
Studies using HPV-31 genomes containing mutations within splice donor
and acceptor sites demonstrated the importance of specific splicing
patterns in early expression through the loss of genome replication and
stable maintenance (27, 44, 47). We suspect that making
the early polyadenylation signal more efficient may result in altered
splicing patterns, leading to a reduction in transcripts expressing
replication factors, and studies examining this point have been initiated.
Our studies also demonstrated that removal of the HPV-31 early AAUAAA element from the early polyadenylation signal resulted in an increase in genome copy number in both transient replication and stable maintenance assays. While our previous experiments suggested that efficient HPV-31 replication requires an inefficient early polyadenylation signal, we had anticipated that further mutation of the polyadenylation signal would lead to reduced replication. In fact, we observed higher levels of replication with the more inefficient signal. It is possible that an alternative noncanonical poly(A) signal is used in these mutants, as seen previously in BPV-1 (1). Studies in HPV-16 have demonstrated that altering early polyadenylation through viral genome integration resulted in the loss of an instability element within the early 3' UTR and an increase in early viral gene expression (23). The early AAUAAA element is conserved in most papillomavirus types with the exception of HPV-6 and -11, which contain degenerative signals, AGUAAA (6). These HPVs are the predominant HPV types in an infected population and are efficient replicators (29). The lack of a consensus AAUAAA polyadenylation signal may provide an advantage for the low-risk viral types by possibly allowing a higher copy number per cell as well as increased levels of expression of viral capsid proteins. The question arises as to why the high-risk types have evolved to include elements that result in reduced viral expression and copy number. It is possible that this reduced level of expression is more beneficial for the long-term persistence of high-risk HPV types. Alternatively, the presence of a consensus hexanucleotide sequence may modulate splicing patterns in a manner that provides an advantage in vivo but is not scored in our tissue culture assays.
In addition to the hexanucleotide sequence, we also identified sequences within 800 nt of the L2 ORF that significantly influence downstream expression. In fact, we believe that this L2 element may be a primary determinant for regulating early as well as late expression. As attempts at identifying smaller elements within this region were unsuccessful, we believe that this inhibitory region functions either as a single large element or cooperatively through multiple redundant elements. In the context of the complete HPV-31 genome, disruption of these sequences resulted in a significant reduction in genome replication and loss of stable maintenance in primary foreskin keratinocytes. Our observations are consistent with studies in BPV-1, which have identified transcription termination sites within the L2 gene (4). A close association between polyadenylation and transcription termination has been demonstrated in other systems, and we suspect that both processes may play important roles in HPV-31 pathogenesis (33). Reporter-based assays examining HPV-16 identified a similar inhibitory element within the 5' end of the L2 ORF which influenced mRNA stability (42). It remains unclear whether RNA stability, termination, or a combination play a role in the action of the HPV-31 L2 element.
In BPV-1 and HPV-16, a second negative regulatory element has been
identified at the end of the L1 gene and has been postulated to make
transcripts that traverse L1 unstable in undifferentiated cells
(12, 25, 28). It is possible that such an element exists
in HPV-31 and that it acts to augment the action of the L2 element. The
L1 element could act by destabilizing any transcripts that escape the
action of the L2 sequences. However, our studies suggest that the
majority of transcripts that pass through the early polyadenylation
sequence terminate or are rendered unstable by sequences within the L2
element. Upon differentiation, the negative regulatory effect of the L2
element is abrogated. This could be accomplished through the action of
a virally encoded factor or a cellular protein, and efforts to identify
these regulators have been initiated. In summary, our studies suggest
that the differentiation-specific regulation of capsid gene expression in HPV-31 requires the coordinated action of a least four processes: (i) initiation of transcription at the late P742 promoter, (ii) abrogation of the negative posttranscriptional regulatory effects of
the L2 element, (iii) polyadenylation of early transcripts directed by
the AAUAAA sequence, and (iv) alternative splicing to generate the
E4
L1 transcripts.
| |
ACKNOWLEDGMENTS |
|---|
We thank members of the Seifert Lab for technical advice on use of the LightCycler and quantitative RT-PCR. In addition, we thank Richard Longnecker, Pat Hindmarsh, and Stephen Oh for critical reading of the manuscript.
This work was supported by a grant from the National Cancer Institute to L.A.L.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology-Immunology, Northwestern University Medical School, 303 E. Chicago Ave., Chicago, IL 60611. Phone: (312) 503-0650. Fax: (312) 503-0649. E-mail: l-laimins{at}northwestern.edu.
Present address: Department of Dermatology, University of Arkansas
for Medical Sciences, Little Rock, AR 72205.
Present address: Department of Biology, Belmont University,
Nashville, TN 37121.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Andrews, E. M., and D. DiMaio.
1993.
Hierarchy of polyadenylation site usage by bovine papillomavirus in transformed mouse cells.
J. Virol.
67:7705-7710 |
| 2. | Baker, C. C. 1997. Post-transcriptional regulation of papillomavirus gene expression., p. III-11-III-16. In G. Myers, C. Baker, K. Munger, F. Sverdrup, A. McBride, H.-U. Bernard, and J. Meissner (ed.), Human papillomaviruses. Theoretical Biology and Biophysics Group, Los Alamos National Laboratory, Los Alamos, N.Mex. |
| 3. | Baker, C. C., and P. M. Howley. 1987. Differential promoter utilization by the bovine papillomavirus in transformed cells and productively infected wart tissues. EMBO J. 6:1027-1035[Medline]. |
| 4. |
Baker, C. C., and J. S. Noe.
1989.
Transcriptional termination between bovine papillomavirus type 1 (BPV-1) early and late polyadenylation sites blocks late transcription in BPV-1-transformed cells.
J. Virol.
63:3529-3534 |
| 5. | Bedell, M. A., J. B. Hudson, T. R. Bolub, M. E. Turek, M. Hoskin, G. D. Wilbanks, and L. A. Laimins. 1991. Amplification of human papillomavirus genomes is dependent on epithelial differentiation. J. Virol. 63:1247-1255. |
| 6. |
Chow, L. T.,
M. Nasseri,
S. M. Wolinsky, and T. R. Broker.
1987.
Human papillomavirus types 6 and 11 mRNAs from genital condylomata acuminata.
J. Virol.
61:2581-2588 |
| 7. |
Colgan, D. F., and J. L. Manley.
1997.
Mechanism and regulation of mRNA polyadenylation.
Genes Dev.
11:2755-2766 |
| 8. | Flores, E. R., B. L. Allen-Hoffmann, D. Lee, C. A. Sattler, and P. F. Lambert. 1999. Establishment of the human papillomavirus type 16 (HPV-16) life cycle in an immortalized human foreskin keratinocyte cell line. Virology 262:344-354[CrossRef][Medline]. |
| 9. | Frattini, M. G., and L. A. Laimins. 1994. The role of the E1 and E2 proteins in the replication of human papillomavirus type 31b. Virology 204:799-804[CrossRef][Medline]. |
| 10. | Frattini, M. G., H. B. Lim, J. Doorbar, and L. A. Laimins. 1997. Induction of human papillomavirus type 18 late gene expression and genomic amplification in organotypic cultures from transfected DNA templates. J. Virol. 71:7068-7072[Abstract]. |
| 11. |
Frattini, M. G.,
H. B. Lim, and L. A. Laimins.
1996.
In vitro synthesis of oncogenic human papillomaviruses requires episomal genomes for differentiation-dependent late expression.
Proc. Natl. Acad. Sci. USA
93:3062-3067 |
| 12. |
Furth, P. A., and C. C. Baker.
1991.
An element in the bovine papillomavirus late 3' untranslated region reduces polyadenylated cytoplasmic RNA levels.
J. Virol.
65:5806-5812 |
| 13. |
Furth, P. A.,
W.-T. Choe,
J. H. Rex,
J. C. Byrne, and C. C. Baker.
1994.
Sequences homologous to 5' splice sites are required for the inhibitory activity of papillomavirus late 3' untranslated regions.
Mol. Cell. Biol.
14:5278-5289 |
| 14. | Goldsborough, M. D., D. DiSilvestre, G. F. Temple, and A. T. Lorincz. 1989. Nucleotide sequence of human papillomavirus type 31: a cervical neoplasia-associated virus. Virology 171:306-311[CrossRef][Medline]. |
| 15. | Gunderson, S. I., M. Polycarpou-Schwarz, and I. W. Mattaj. 1998. U1 snRNP inhibits pre-mRNA polyadenylation through a direct interaction between U1 70K and poly(A) polymerase. Mol. Cell 1:255-264[CrossRef][Medline]. |
| 16. |
Halbert, C. L.,
G. W. Demers, and D. A. Galloway.
1992.
The E6 and E7 genes of human papillomavirus type 6 have weak immortalizing activity in human epithelial cells.
J. Virol.
66:2125-2134 |
| 17. |
Higgins, G. D.,
D. M. Uzelin,
G. E. Phillips,
P. McEvoy, and C. J. Burrel.
1992.
Transcription patterns of human papillomavirus type 16 in genital intraepithelial neoplasia: evidence for promoter usage within the E7 open reading frame during epithelial differentiation.
J. Gen. Virol.
73:2047-2057 |
| 18. | Hirt, B. 1967. Selective extraction of polyoma DNA from infected mouse cell culture. J Mol. Biol. 26:365-369[CrossRef][Medline]. |
| 19. | Howley, P. M. 1996. Papillomavirinae and their replication, p. 947-978. In B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fundamental virology. Lippincott-Raven Publishers, Philadelphia, Pa. |
| 20. |
Hubert, W. G.,
T. Kanaya, and L. A. Laimins.
1999.
DNA replication of human papillomavirus type 31 is modulated by elements of the upstream regulatory region that lie 5' of the minimal origin.
J. Virol.
73:1835-1845 |
| 21. |
Hummel, M.,
J. B. Hudson, and L. A. Laimins.
1992.
Differentiation-induced and constitutive transcription of human papillomavirus type 31b in cell lines containing viral episomes.
J. Virol.
66:6070-6080 |
| 22. | Hummel, M., H. B. Lim, and L. A. Laimins. 1995. Human papillomavirus type 31b late gene expression is regulated through protein kinase C-mediated changes in RNA processing. J. Virol. 69:3381-3388[Abstract]. |
| 23. |
Jeon, S., and P. F. Lambert.
1995.
Integration of human papillomavirus type 16 DNA into the human genome leads to increased stability of E6 and E7 mRNAs: Implications for cervical carcinogenesis.
Proc. Natl. Acad. Sci. USA
92:1654-1658 |
| 24. |
Kennedy, I. M.,
J. K. Haddow, and J. B. Clements.
1990.
Analysis of human papillomavirus type 16 late mRNA 3' processing signals in vitro and in vivo.
J. Virol.
64:1825-1829 |
| 25. |
Kennedy, I. M.,
J. K. Haddow, and J. B. Clements.
1991.
A negative regulatory element in the human papillomavirus type 16 genome acts at the level of late mRNA stability.
J. Virol.
65:2093-2097 |
| 26. | Klumpp, D. J., and L. A. Laimins. 1999. Differentiation-induced changes in promoter usage for transcripts encoding the human papillomavirus type 31 replication protein E1. Virology 257:239-246[CrossRef][Medline]. |
| 27. | Klumpp, D. J., F. Stubenrauch, and L. A. Laimins. 1997. Differential effects of the splice acceptor at nucleotide3295. of human papillomavirus type 31 on stable and transient viral replication. J. Virol. 71:8186-8194[Abstract]. |
| 28. |
Koffa, M. D.,
S. V. Graham,
Y. Takagaki,
J. L. Manley, and J. B. Clements.
2000.
The human papillomavirus type 16 negative regulatory RNA element interacts with three proteins that act at different posttranscription levels.
Proc. Natl. Acad. Sci. USA
97:4677-4682 |
| 29. | Koutsky, L. 1997. Epidemiology of genital human papillomavirus infection. Am. J. Med. 102:3-8[Medline]. |
| 30. | Laimins, L. A. 1993. The biology of human papillomaviruses: from warts to cancer. Infect. Agents Dis. 2:74-86[Medline]. |
| 31. |
Meyers, C.,
M. Fratini,
J. Hudson, and L. A. Laimins.
1992.
Biosynthesis of human papillomavirus from a continuous cell line upon epithelial differentiation.
Science
257:971-973 |
| 32. | Meyers, C., T. J. Mayer, and M. A. Ozbun. 1997. Synthesis of infectious human papillomavirus type 18 in differentiating epithelium transfected with viral DNA. J. Virol. 71:7381-7386[Abstract]. |
| 33. | Osheim, Y. N., N. J. Proudfoot, and A. L. Beyer. 1999. EM visualization of transcription by RNA polymerase II: downstream termination requires apoly(A)) signal but not transcript cleavage. Mol. Cell 3:379-387[CrossRef][Medline]. |
| 34. | Ozbun, M. A., and C. Meyers. 1997. Characterization of late gene transcripts expressed during vegetative replication of human papillomavirus type 31b. J. Virol. 71:5161-5172[Abstract]. |
| 35. |
Ozbun, M. A., and C. Meyers.
1998.
Temporal usage of multiple promoters during the life cycle of human papillomavirus type 31b.
J. Virol.
72:2715-2722 |
| 36. |
Ozbun, M. A., and C. Meyers.
1999.
Two novel promoters in the upstream regulatory region of human papillomavirus type 31b are negatively regulated by epithelial differentiation.
J. Virol.
73:3505-3510 |
| 37. | Proudfoot, N. 2000. Connecting transcription to messenger RNA processing. Trends Biochem. Sci. 25:290-293[CrossRef][Medline]. |
| 38. |
Rheinwald, J. G., and M. A. Beckett.
1981.
Tumorigenic keratinocyte lines requiring anchorage and fibroblast support cultures from human squamous cell carcinomas.
Cancer Res.
41:1657-1663 |
| 39. | Rohlfs, M., S. Winkenback, S. Meyer, T. Rupp, and M. Durst. 1991. Viral Transcription in human keratinocyte cell lines immortalized by human papillomavirus type-16. Virology 183:331-342[CrossRef][Medline]. |
| 40. | Ruesch, M. N., and L. A. Laimins. 1998. Human papillomavirus oncoproteins alter differentiation-dependent cell cycle exit on suspension in semisolid medium. Virology 250:19-29[CrossRef][Medline]. |
| 41. |
Ruesch, M. N.,
F. Stubenrauch, and L. A. Laimins.
1998.
Activation of papillomavirus late gene transcription and genome amplification upon differentiation in semisolid medium is coincident with expression of involucrin and transglutaminase but not keratin-10.
J. Virol.
72:5016-5024 |
| 42. |
Sokolowski, M.,
W. Tan,
M. Jellne, and S. Schwartz.
1998.
mRNA instability elements in the human papillomavirus type 16 L2 coding region.
J. Virol.
72:1504-1515 |
| 43. |
Stubenrauch, F.,
A. M. Colbert, and L. A. Laimins.
1998.
Transactivation by the E2 protein of oncogenic human papillomavirus type 31 is not essential for early and late viral functions.
J. Virol.
72:8115-8123 |
| 44. |
Stubenrauch, F.,
M. Hummel,
T. Ifner, and L. Laimins.
2000.
The E8 E2C protein, a negative regulator of viral transcription and replication, is required for extrachromosomal maintenance of human papillomavirus type 31 in keratinocytes.
J. Virol.
74:1178-1186 |
| 45. |
Stubenrauch, F.,
H. B. Lim, and L. A. Laimins.
1998.
Differential requirements for conserved E2 binding sites in the life cycle of oncogenic human papillomavirus type 31.
J. Virol.
72:1071-1077 |
| 46. |
Terhune, S. S.,
C. Milcarek, and L. A. Laimins.
1999.
Regulation of human papillomavirus type 31 polyadenylation during the differentiation-dependent life cycle.
J. Virol.
73:7185-7912 |
| 47. |
Thomas, J. T.,
W. G. Hubert,
M. N. Ruesch, and L. A. Laimins.
1999.
Human papillomavirus type 31 oncoproteins E6 and E7 are required for the maintenance of episomes during the viral life cycle in normal human keratinocytes.
Proc. Natl. Acad. Sci. USA
96:8449-8454 |
| 48. |
Yang, Y.-C.,
H. Okayama, and P. M. Howley.
1985.
Bovine papillomavirus contains multiple transforming genes.
Proc. Natl. Acad. Sci. USA
82:1030-1034 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»