Previous Article | Next Article 
Journal of Virology, September 2001, p. 8074-8081, Vol. 75, No. 17
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.17.8074-8081.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Ribavirin Induces Error-Prone Replication of GB
Virus B in Primary Tamarin Hepatocytes
Robert E.
Lanford,1,*
Deborah
Chavez,1
Bernadette
Guerra,1
J. Y. N.
Lau,2,
Zhi
Hong,2,
Kathleen M.
Brasky,3 and
Burton
Beames1,
Department of Virology and
Immunology1 and Department of Laboratory
Animal Medicine,3 Southwest Regional Primate
Research Center, Southwest Foundation for Biomedical Research, San
Antonio, Texas 78227, and Schering-Plough Research
Institute, Kenilworth, New Jersey 070332
Received 16 March 2001/Accepted 6 June 2001
 |
ABSTRACT |
GB virus B (GBV-B) is the closest relative of hepatitis C
virus (HCV) and is an attractive surrogate model for HCV antiviral studies. GBV-B induces an acute, resolving hepatitis in tamarins. Utilizing primary cultures of tamarin hepatocytes, we have previously developed a tissue culture system that exhibits high levels of GBV-B
replication. In this report, we have extended the utility of this
system for testing antiviral compounds. Treatment with human interferon
provided only a marginal antiviral effect, while poly(I-C)
yielded >3 and 4 log units of reduction of cell-associated and
secreted viral RNA, respectively. Interestingly, treatment of
GBV-B-infected hepatocytes with ribavirin resulted in an approximately 4-log decrease in viral RNA levels. Guanosine blocked the antiviral effect of ribavirin, suggesting that inhibition of IMP dehydrogenase (IMPDH) and reduction of intracellular GTP levels were essential for
the antiviral effect. However, mycophenolic acid, another IMPDH
inhibitor, had no antiviral effect. Virions harvested from ribavirin-treated cultures exhibited a dramatically reduced specific infectivity. These data suggest that incorporation of ribavirin triphosphate induces error-prone replication with concomitant reduction
in infectivity and that reduction of GTP pools may be required for
incorporation of ribavirin triphosphate. In contrast to the in vitro
studies, no significant reduction in viremia was observed in vivo
following treatment of tamarins with ribavirin during acute infection
with GBV-B. These findings are consistent with the observation that
ribavirin monotherapy for HCV infection decreases liver disease without
a significant reduction in viremia. Our data suggest that nucleoside
analogues that induce error-prone replication could be an attractive
approach for the treatment of HCV infection if administered at
sufficient levels to result in efficient incorporation by the viral polymerase.
 |
INTRODUCTION |
The original GB virus (GBV) inoculum was obtained
from a surgeon with the initials G. B. who contracted non-A non-B
hepatitis. In the 1960s, Deinhardt inoculated tamarin monkeys with this
serum and at least one of the animals appeared to have contracted
hepatitis from the inoculation (8). Nearly three decades
later, two agents, GBV-A and GBV-B, were cloned from tamarin serum
representing a serial passage of the original tamarin serum
(25). A related virus, GBV-C (24) or
hepatitis G virus (14), was cloned from human serum. All
three viruses are closely related to hepatitis C virus (HCV), with
GBV-B being the only hepatotropic virus and the most closely related to
HCV (18, 20). At the time of the original GBV studies, it
was assumed that the hepatitis agent originated from the serum of the
surgeon; however, in retrospect, it seems probable that the agent was
already present in the tamarin and that GBV-B is a tamarin virus. This
assumption is based on the fact that GBV-B has not been recovered from
humans and the fact that GBV-B has a very narrow host range for
tamarins and other closely related New World monkeys (R. E. Lanford, unpublished data). The fact that it has not been recovered a
second time from tamarins may be due to the rapid resolution of the
acute infection in tamarins and the limited number of wild caught
tamarins that have been examined immediately upon introduction into captivity.
We have initiated studies with GBV-B, because it represents a surrogate
model for HCV. There are three major limitations to working with HCV
that can be overcome using the GBV-B system. First, HCV replicates at
such low levels that it can be detected only by reverse
transcription-PCR (RT-PCR), and viral antigens are difficult to
detect reproducibly. Second, the only animal model is the chimpanzee,
and chimpanzees are quite large and expensive to use in antiviral
studies. Third, no satisfactory tissue culture system has been
developed for HCV. In contrast to HCV, GBV-B replicates at levels
1,000- to 10,000-fold higher than those for HCV, the tamarin is about
100 times smaller than the chimpanzee, and we have developed a robust
tissue culture system for GBV-B using primary tamarin hepatocytes
(1). Although the recently developed (16) and
improved (2, 15) HCV replicon system will greatly advance
many types of studies with HCV, it cannot replace the need for a
virus-based culture system and a small-animal model.
HCV and GBV-B polyproteins possess approximately 25 to 30% homology at
the amino acid level (18), while the 5' and 3'
untranslated regions are more distinct (4, 18, 21). This
high level of homology has led to the anticipation that antiviral
compounds developed for HCV will be active against GBV-B. This concept
is supported by the observation that the GBV-B NS3 protease correctly processes the HCV polyprotein (22) and that HCV-GBV-B
chimeric NS3 proteins are enzymatically active (5). In
addition, an infectious cDNA clone of GBV-B that induced hepatitis upon
intrahepatic inoculation of tamarins with in vitro-transcribed RNA has
been produced (4). These studies will certainly be
extended to determine whether viable chimeric viruses between HCV and
GBV-B can be produced.
In this study, we extend the utility of the tamarin primary hepatocyte
culture system for GBV-B to the analysis of antiviral compounds.
Interferon (IFN) and ribavirin were evaluated for the ability to reduce
GBV-B RNA levels in culture. Both human IFN
-2b and poly(I-C)
[polyinosinic acid-poly(C)] resulted in reduction of GBV-B
RNA levels. Ribavirin treatment resulted in a dramatic decline in viral
RNA levels, which appeared to result from the incorporation of
ribavirin triphosphate and the induction of error-prone replication.
The results of these studies validate the GBV-B-tamarin hepatocyte
system for antiviral testing and suggest that nucleoside analogues that
are efficiently incorporated and induce error-prone replication may be
efficacious for the treatment of HCV.
(This work was presented in part at the American Society for Virology
Annual Meeting in July 2000.)
 |
MATERIALS AND METHODS |
Animals.
Moustached tamarins (Saguinus mystax)
were housed at the Southwest Regional Primate Research Center at the
Southwest Foundation for Biomedical Research. Animals were cared for by
members of the Department of Laboratory Animal Medicine in accordance
with the Guide for the Care and Use of Laboratory
Animals, and all protocols were approved by the
Institutional Animal Care and Use Committee. Ribavirin therapy was
accomplished by feeding tamarins marshmallows containing the antiviral compound.
Hepatocyte cultures.
Primary tamarin hepatocytes were
isolated by collagenase perfusion as previously described (1,
13). Cells were frozen in liquid nitrogen at the time of
isolation and were revived and plated on collagen-coated culture dishes
as needed. Cultures were maintained in a hormonally defined, serum-free
medium (13). Cells were grown in six-well dishes for 3 days prior to infection. Inoculations were performed with 5 µl of
GBV-B containing tamarin serum (2 × 105 to
4 × 106 genome equivalents) in 1 ml of
serum-free medium for 6 h at 37°C followed by two washes to
remove residual inoculum. Poly(I-C) was obtained from Sigma. Ribavirin
(1-
-D-ribofuranosyl-1H-1,2,4-triazole-3-carboximide) and
human IFN
-2b (Intron A) were obtained from Schering-Plough Research Institute (Kenilworth, N.J.).
TaqMan quantification of GBV-B RNA.
GBV-B RNA was isolated
from cells or medium by extraction with RNazol (Leedo, Houston, Tex.),
and total cell RNA was quantified by optical density. GBV-B RNA was
quantified by a real-time, 5' exonuclease RT-PCR (TaqMan) assay using a
primer-probe combination that recognized a portion of the GBV-B capsid
gene as previously described (1). The primers (558F,
5'AACGAGCAAAGCGCAAAGTC; 626R, 5'CATCATGGATACCAGCAATTTTGT) and probe (579P;
5'6FAM-AGCGCGATGCTCGGCCTCGTA-TAMRA) were selected
using the Primer Express software designed for this purpose (PE Applied
Biosystems, Foster City, Calif.) and were purchased from PE Applied
Biosystems. Standards to establish genome equivalents were synthetic
RNAs transcribed from the cloned GBV-B capsid gene.
Anti-NS3 ELISA.
Antibodies to NS3 in GBV-B-infected animals
were monitored with an enzyme-linked immunoadsorbent assay
(ELISA) using purified NS3 (1). Purified NS3
protein (10 ng per well) was bound to 96-well Immunlon 2 plates
(Dynatech Laboratories, Chantilly, Va.) in borate-buffered
saline (145 mM NaCl, 6 mM NaOH, 48 mM
H3BO3, and 50 mM KCl to
give a pH of 8.2) overnight at 4°C. All ELISA incubations were
performed for 1 h at 37°C, except for the final substrate
incubation, and between incubation steps, wells were washed four times
with phosphate-buffered saline (PBS)-0.05% Tween 20. Unoccupied
protein binding sites were blocked with 5% bovine serum albumin (BSA)
in PBS. Serial tamarin serum samples were diluted 1:40 in antibody
diluent, 0.5% BSA-PBS-0.05% Tween 20. Bound antibody was detected
with goat anti-human immunoglobulin G-horseradish peroxidase conjugate
diluted 1:1,000 in antibody diluent. The substrate {100 µl of 1 mg/ml ABTS [2,2'-azinobis(3-ethylbenthiazolinesulfonic acid])
[Sigma] in 0.03% H2O2}
was incubated at room temperature until color development was stopped
by the addition of 50 µl of 1% sodium dodecyl sulfate. Plates were
read at 405 nm.
apoB ELISA.
The ELISA for apolipoprotein B (apoB) was
performed with culture medium from primary cultures of tamarin
hepatocytes as previously described (12). Microtiter wells
were coated with 100 µl of anti-apoB polyclonal antibody
(Biodesign, Kennebunkport, Maine) per well at 1.5 µg/ml in
0.1 M sodium bicarbonate buffer, pH 9.0. Wells were blocked with PBS
containing 0.05% Tween 20 and 3% BSA. Wells were washed one time with
PBS-0.05% Tween 20 and were incubated for 3 h at 37°C with 100 µl of culture medium. Wells were washed three times with PBS-0.05%
Tween 20 and incubated for 2 h at 37°C with alkaline
phosphatase-conjugated antibody diluted in PBS-0.05% Tween 20 containing 1% BSA. Anti-apoB horseradish peroxidase-conjugated antibody was obtained from The Binding Site (San Diego, Calif). Wells
were washed three times with PBS-0.05% Tween 20 and incubated for 15 min with citrate buffer, pH 5.0, containing 0.3%
H2O2 and 5 µg of
o-phenylenediamine dihydrochloride per ml. The reaction was
stopped with 4 N H2SO4, and
absorbance at 490 nm was determined. The estimates of sample
concentrations (in nanograms per milliliter) were calculated using a
regression equation fitted to a standard curve based on log-log
transformed optical density data (12).
 |
RESULTS |
Inhibition of GBV-B replication by IFN.
We have previously
described a tissue culture system for in vitro replication of GBV-B in
primary tamarin hepatocyte cultures. We were interested in using this
system to evaluate antiviral compounds. Since no antivirals have been
developed for GBV-B, we chose to examine the two drugs used for the
treatment of HCV infections, IFN and ribavirin. The initial studies
involved the treatment of cultures with human IFN
-2b at high levels
(Intron A; 2,000 U/ml) because of the species difference between the
sources of the IFN and hepatocytes. In addition, our studies with HCV replicons in Huh7 cells have suggested that an additional antiviral effect is evident with concentrations as high as 1,000 U/ml (Lanford, unpublished). IFN treatment was started either the day before inoculation or 1 day after inoculation. The in vitro growth curve of
GBV-B in primary tamarin hepatocytes demonstrated that maximum intracellular viral RNA levels were reached by 1 day postinfection (1). Thus, the treatment of cultures at 1 day
postinfection reflects treatment of an established infection, and any
decline in the levels of viral RNA should be the result of loss of
viral RNA following inhibition of replication. In contrast, treatment of cultures prior to infection requires only the inhibition of replication, with no requirement for the loss of existing RNA as
detected by RT-PCR. Treatment with IFN was continued for 7 days
following infection. Regardless of whether treatment was initiated
before or after infection, the levels of viral RNA in the cells and
medium were suppressed by approximately 2 log units as determined by
quantitative, real-time (TaqMan) RT-PCR (Fig. 1). To
control for any nonspecific, adverse effects of the treatment on the
hepatocyte cultures, the synthesis and secretion of apoB was monitored
in all cultures using a quantitative ELISA. This liver-specific
function was monitored, because it represents a very sensitive
indicator of hepatocyte differentiated function. No significant
decrease in apoB was observed. Additional experiments indicated that
lower doses of IFN had little to no antiviral effect and that the level
of viral suppression obtained with human IFN was both marginal and
variable. The limited effect of human IFN on GBV-B replication was
potentially due to the species differences between the IFN source and
the target tissue source (tamarins), since studies with HCV replicons
have demonstrated a pronounced inhibition of HCV replication with IFN
(2, 15) (Lanford, unpublished).

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 1.
Antiviral effect of IFN on GBV-B-infected tamarin
hepatocytes. Primary tamarin hepatocytes were treated with human IFN
(IFN -2b; 2,000 U/ml) starting the day before or the day after
infection with GBV-B. IFN treatment was continued for 7 days with
medium changes and fresh IFN every other day. The levels of viral RNA
in the cells (in genome equivalents per microgram of cell
RNA) and medium (in genome equivalents per milliliter of medium) were
determined by real-time TaqMan RT-PCR. IFN treatment resulted in an
approximately 2-log reduction of cell-associated and secreted viral
RNA. No inhibition of cellular functions was noted, as indicated by the
secretion of apoB, a highly differentiated marker for hepatocytes. On
the left y axis, genome equivalents are shown on a
logarithmic scale (1e+0, 100; 1e+1, 101; 1e+2,
102, etc.).
|
|
Next, cultures were treated with poly(I-C) which not only induces the
synthesis of endogenous IFN but also activates the IFN-inducible,
antiviral pathways of protein kinase R and 2',5'-oligoadenylate
synthetase and thus, RNase L. Cultures were treated in duplicate
with
10 and 50 µg of poly(I-C) per ml. Treatment was initiated
the day
prior to infection and was continued until the time of
harvest, 7 days
postinfection. Analysis of cell-associated viral
RNA from treated and
untreated cultures revealed 2.2-log and 3.3-log
decreases in viral RNA
levels with 10 and 50 µg of poly(I-C) per
ml, respectively (Fig.
2). The decline in secreted viral RNA levels
was greater
with 3.6-log and 4.2-log decreases at 10 and 50 µg
of poly(I-C) per
ml. The 3.3-log decrease in cell-associated viral
RNA at 50 µg/ml may
reflect an experimental limitation, since
the residual cell-associated
viral RNA that remains after antiviral
treatment represents less than
0.1% of the input inoculum. This
level of RNA may represent the amount
of inoculum that adheres
to the plastic wells and cultures in a
nonproductive, yet stable
manner. The RNA present in viral particles
adsorbed on the plastic
surface can persist for an extended period of
time as detected
by RT-PCR. Thus, in this scenario, even 100%
inhibition of viral
replication would not exceed 3.3 log units of
reduction of cell-associated
viral RNA in comparison to untreated
cultures. When these data
are expressed in another manner, treatment
with 50 µg of poly(I-C)
per ml yielded >99.9% reduction of
cell-associated viral RNA and
>99.99% reduction in the level of viral
RNA secreted into the
culture medium.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 2.
Antiviral effect of poly(I-C) on GBV-B-infected tamarin
hepatocytes. Primary tamarin hepatocytes were treated with 10 or 50 µg of poly(I-C) per ml beginning the day before infection with GBV-B.
Treatment was continued for 7 days with medium changes and fresh
poly(I-C) every other day. The levels of viral RNA in the cells (in
genome equivalents [ge] per microgram of cell RNA) and medium (in
genome equivalents per milliliter of medium) were determined by
real-time TaqMan RT-PCR. Poly(I-C) treatment resulted in greater than 3 and 4 log units of reduction of cell-associated and secreted viral RNA,
respectively. On the left y axis, genome equivalents are
shown on a logarithmic scale (1e+0, 100; 1e+1,
101; 1e+2, 102, etc.).
|
|
To determine whether poly(I-C) eliminated all infectious viral RNA,
cultures were treated with poly(I-C) for 7 or 14 days,
and some of the
cultures treated for 14 days were grown in the
absence of poly(I-C) for
an additional 7 days. No further decline
in viral RNA levels occurred
between days 7 and 14 of treatment,
and no increase in viral RNA
occurred following removal of poly(I-C)
for 7 days (data not shown).
These data suggest that no infectious
viral RNA remained in the cells
or that an antiviral state persisted
in the cells after the removal of
poly(I-C). In a separate experiment,
infected cultures were treated
with poly(I-C) for 7 days. The
medium was used to inoculate fresh
hepatocytes, and this process
was repeated after another 7 days. GBV-B
RNA levels in the cells
decreased only 0.65 log unit during serial
passage of virus from
untreated cultures (Table
1),
while GBV-B RNA declined to below
the levels of detection in cells and
media during passage of the
poly(I-C)-treated culture medium. Although
this experiment was
initially designed to select and expand
IFN-resistant variants,
it demonstrates the near total inhibition of
viral replication
by poly(I-C). No IFN-resistant variants were selected
using this
protocol.
Treatment of GBV-B-infected cultures with ribavirin.
Next,
ribavirin was examined for an antiviral effect on GBV-B-infected
tamarin hepatocytes. The monophosphate form of ribavirin is an IMP
dehydrogenase (IMPDH) inhibitor that has an antiviral effect for a
number of viruses (7, 17, 23). The antiviral effect is due
in part to the reduction of GTP pools by inhibition of IMPDH. Although
ribavirin in combination with IFN is used for the treatment of HCV
infections, ribavirin monotherapy induces an improvement in liver
disease without a reduction in the level of viremia (3,
9). The mechanism is believed to involve an immunomodulatory
activity possessed by ribavirin that promotes a Th1-biased immune
response (10, 11, 19, 26).
Surprisingly, treatment of GBV-B-infected tamarin hepatocytes with
ribavirin resulted in a dramatic decline in viral RNA levels
(Fig.
3). Ribavirin treatment was initiated at various
concentrations
the day before infection, and cultures were harvested 6 days after
infection. At the two highest levels of ribavirin employed
(100
and 200 µM), a 3.8-log decrease in cell-associated viral RNA
levels
was observed. No overt toxicity was observed in any of the
cultures
by microscopic examination; however, at 200 µM, a small
decrease
in apoB secretion was observed. Thus, ribavirin appears to
function
as a true antiviral in the GBV-B-tamarin hepatocyte system.
The
level of ribavirin at which antiviral activity was observed (100
µM) is probably higher than that obtained for patients on ribavirin
therapy.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 3.
Suppression of GBV-B replication by ribavirin. Primary
tamarin hepatocytes were treated with various concentrations of
ribavirin (0 to 200 µM) starting the day before infection. Treatment
was continued for 7 days with fresh medium, with ribavirin provided
every other day. The level of viral RNA in the cells (in genome
equivalents per microgram of cell RNA) was determined by
real-time TaqMan RT-PCR. No inhibition of the secretion of apoB, a
marker of hepatocyte function, was noted except possibly at the highest
ribavirin concentration. At 100 µM ribavirin, an approximately 4-log
reduction in cell-associated viral RNA was observed. On the left
y axis, genome equivalents are shown on a logarithmic
scale (1e+0, 100; 1e+1, 101; 1e+2,
102, etc.).
|
|
Serial passage of medium from ribavirin-treated cultures was performed
in a manner similar to that described above for poly(I-C).
Cultures
were treated with 100 µM ribavirin beginning the day
prior to
infection, and treatment was maintained for 7 days. The
medium from
treated and untreated cultures was passed two additional
times to fresh
cultures. No virus was detected in the cells or
the medium after the
first passage of the treated medium, while
the medium for untreated
cultures efficiently initiated new infections
(Table
2).
These data imply that ribavirin treatment resulted
in near complete
inhibition of viral replication and/or secretion
of infectious virus
and that using the current experimental design
no ribavirin-resistant
mutants emerged.
Guanosine abolishes the antiviral effect of ribavirin.
We were
interested in the mechanism of the antiviral effect of ribavirin.
Ribavirin could affect viral RNA synthesis by suppressing intracellular
pools of GTP. However, apoB synthesis was not affected even over a
7-day treatment (Fig. 3), and the apoB mRNA is larger than the GBV-B
genome. Thus, it was questionable whether inhibition of RNA synthesis
by reduction of GTP pools was the primary mechanism of the antiviral
effect observed in vitro. The role of intracellular GTP pools was
examined by competing ribavirin with excess guanosine in the culture
medium, which would provide GTP through an alternate metabolic pathway.
No effect on GBV-B replication was observed with guanosine
supplementation alone, while guanosine supplementation at 100 µM
completely eliminated the antiviral effect of ribavirin (Fig.
4). These data suggest that a reduction in GTP pools was required for the ribavirin effect, but there was still the possibility that the primary antiviral effect was not due solely to inhibition of
RNA synthesis at low GTP levels, especially in the absence of overt
cellular toxicity or inhibition of apoB synthesis.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 4.
Guanosine supplementation abolishes the ribavirin
antiviral effect on GBV-B replication. Primary tamarin hepatocytes were
treated with ribavirin (100 µM) with or without guanosine
supplementation (100 µM). Treatment was initiated the day before
infection and continued for 7 days with fresh medium, with ribavirin
and guanosine provided every other day. The level of viral RNA in the
cells (in genome equivalents per microgram of cell RNA)
was determined by real-time TaqMan RT-PCR. Guanosine supplementation
completely abolished the antiviral effect of ribavirin, but guanosine
alone had no observable effect on GBV-B replication. On the left
y axis, genome equivalents are shown on a logarithmic
scale (1e+0, 100; 1e+1, 101; 1e+2,
102, etc.).
|
|
Lack of antiviral effect of MPA.
To further examine the role
of GTP pools in the antiviral effect of ribavirin, a different
inhibitor of IMPDH was examined. While ribavirin is a guanosine
analogue and is a competitive inhibitor of IMPDH, mycophenolic acid
(MPA) is an uncompetitive inhibitor of IMPDH. Tamarin hepatocytes were
treated with MPA and infected with GBV-B using a protocol identical to
that used for ribavirin with pretreatment for 1 day prior to infection
and continued treatment for 7 days postinfection. No effect on GBV-B
replication was observed at 100 µM, the highest concentration of MPA
employed (Fig. 5). Although no direct demonstration of
IMPDH inhibition by MPA was performed in these studies, the inhibition
of IMPDH is a well-established activity of MPA. Concentrations above
100 µM were cytotoxic. These data imply that although required for
the antiviral effect, reduction of GTP pools was probably not the
primary antiviral mechanism of ribavirin.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 5.
MPA does not significantly inhibit GBV-B replication.
Primary tamarin hepatocytes were treated with various concentrations of
MPA (0 to 100 µM) starting the day before infection. Treatment was
continued for 7 days with fresh medium, with MPA provided every other
day. The level of viral RNA in the cells (in genome equivalents
per microgram of cell RNA) was determined by real-time
TaqMan RT-PCR. No inhibition of GBV-B replication was noted even at the
highest nontoxic dose of MPA. On the left y axis, genome
equivalents are shown on a logarithmic scale (1e+0, 100;
1e+1, 101; 1e+2, 102, etc.).
|
|
Reduction of specific infectivity of GBV-B by ribavirin
treatment.
One possibility consistent with the contrasting effects
of different IMPDH inhibitors and the elimination of the ribavirin effect by guanosine supplementation was the incorporation of ribavirin triphosphate (RTP) by the GBV-B polymerase. Sufficient incorporation of
RTP would occur only when the GTP pool was suppressed, because the
GBV-B polymerase would favor utilization of GTP over RTP. This
hypothesis could be tested by examining the effect of ribavirin on the
specific infectivity of GBV-B produced in the presence of ribavirin. If
RTP were incorporated into GBV-B RNA, in the next round of RNA
synthesis, RMP would be copied by the GBV-B polymerase as either a
guanosine or adenosine, which would lead to error-prone replication.
The accumulation of errors would in turn decrease the infectivity of
the virus.
To test this hypothesis, hepatocytes were infected with GBV-B in the
presence or absence of ribavirin, the secreted virions
were harvested,
and the harvested virions were adjusted such that
the treated and
untreated virus had the same number of genomic
equivalents by RT-PCR.
These media were then used to infect fresh
cultures of hepatocytes.
Virus grown in the presence of ribavirin
for 3 days had a markedly
reduced infectivity (Fig.
6), while
virus grown in the
presence of ribavirin for 6 days was essentially
noninfectious.
Repetition of the experiment produced essentially
identical results.
These data are highly suggestive of induction
of error-prone
replication due to incorporation of RTP.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 6.
GBV-B produced in the presence of ribavirin has low
specific infectivity. Primary tamarin hepatocytes were cultivated with
(+) or without ( ) 100 µM ribavirin as described in the legend to
Fig. 3. Secreted virus was harvested on day 3 or 6 postinfection with
GBV-B. The virus levels in the media were adjusted to contain identical
genome equivalents based on TaqMan RT-PCR. The media were then used to
inoculate fresh cultures of hepatocytes. The infected cultures were
harvested 7 days postinoculation, and the level of cell-associated
viral RNA (in genome equivalents per microgram of cell
RNA) was determined as a measure of specific infectivity of the
inoculum. Infectivity of GBV-B harvested after 3 days of ribavirin
treatment was decreased 2 log units, while GBV-B harvested after 6 days
of ribavirin treatment lacked measurable infectivity. The small bar
present for the sample treated with ribavirin for 6 days shows that the
sample was tested but no viral RNA was detected. On the left
y axis, genome equivalents are shown on a logarithmic
scale (1e+0, 100; 1e+1, 101; 1e+2,
102, etc.).
|
|
Lack of antiviral activity of ribavirin in GBV-B-infected
tamarins.
The high efficacy of ribavirin against GBV-B replication
in vitro prompted an extension of the studies to include the treatment of GBV-B-infected tamarins. Tamarins were fed ribavirin at 10 mg per
day (approximately 20 mg/kg of body weight), a dose approximately 30%
higher than that used for HCV-infected patients. Animals were treated
with ribavirin for 7 days prior to GBV-B inoculation, such that
steady-state RTP levels would be present in the liver at the time of
infection, and treatment was continued for 10 days postinoculation. The
early bleed schedules used for the animals not treated with ribavirin
differed from the animals treated with ribavirin, such that the graphs
cannot be directly compared; however, ribavirin monotherapy did not
prevent establishment of the infection, did not result in a reduced
peak of viremia, and did not result in rapid clearance of GBV-B
infection (Fig. 7). Although the initial viremia
level was lower in one of the two ribavirin-treated animals (compare
week 2 in treated and untreated animals), no major impact on
replication was observed. The untreated animals represent profiles from
a previous experiment (1) in which week 1 samples were not
available for comparison. There was significant variation observed
between individual animals with regard to the early levels of viremia,
so the reduced viremia prior to week 4 in ribavirin-treated animals is
probably not significant. A gradual increase in the levels of viremia
prior to week 4 has been observed in other GBV-B-infected animals.
These data imply that GBV-B is not particularly sensitive to ribavirin
at the concentrations typically used in vivo and in this respect
resembles HCV. Much higher, potentially toxic levels of ribavirin would
be required to obtain significant antiviral efficacy in vivo.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 7.
Ribavirin therapy does not alter the course of GBV-B
infection in tamarins. Tamarins were fed ribavirin at 10 mg per day
(approximately 20 mg/kg) starting 7 days prior to inoculation with
GBV-B, and treatment was continued for the first 10 days
postinoculation. The level of viremia at various times after
inoculation was determined by real-time TaqMan RT-PCR and is indicated
by stippled bars. Serum alanine transaminase (ALT) levels were
monitored as a biochemical indication of liver damage and are indicated
by solid lines. The horizontal line indicates the upper normal limit
for ALT. Seroconversion for GBV-B anti-NS3 was monitored by ELISA
(indicated by symbols above the graph as follows: , seroconversion
did not occur; +, seroconversion occurred). The animals 12027 and 12028 (top) were treated with ribavirin, while animals 12024 and 12026 (bottom) were not treated. The profiles for animals 12024 and 12026 were previously published (1). The bleed schedules used
for the animals not treated with ribavirin differed from the animals
treated with ribavirin, so the graphs cannot be directly compared;
however, ribavirin monotherapy did not appear to alter the course of
GBV-B infection. On the left y axis, genome equivalents
are shown on a logarithmic scale (1e+0, 100; 1e+1,
101; 1e+2, 102, etc.).
|
|
 |
DISCUSSION |
The GBV-B-tamarin system provides a powerful surrogate system for
HCV. The high level of replication facilitates detection of viral
replication and viral antigens (1), and the tamarin provides a useful small-animal model for in vivo studies. The development of an efficient culture system for GBV-B permits a number
of studies not easily performed for HCV, despite the fact that the
system is dependent upon the use of primary hepatocyte cultures. In
this report, we demonstrate the utility of the culture system and
animal model for antiviral studies. As anticipated, GBV-B replication
was inhibited by IFN. Human IFN had a reduced antiviral effect in
comparison to poly(I-C). Poly(I-C) has the capacity to induce
endogenous tamarin IFN as well as protein kinase R and 2',5'OAS
antiviral pathways. The reduced antiviral effect of human IFN was
presumably due to a reduced affinity for the type I IFN receptor on
tamarin hepatocytes, although direct demonstration of this will require
additional studies. Ribavirin was tested, since it is currently being
used in the clinic for HCV infection. However, the clinical data
suggested that it would probably not have significant antiviral
activity against GBV-B. The finding that ribavirin is a highly
efficacious antiviral compound for GBV-B demonstrates the value of this
in vitro system for the analysis of a broad variety of antiviral compounds.
Ribavirin has an antiviral effect on a number of viruses including both
RNA and DNA viruses (7, 17, 23). Presumably, the antiviral
effect in most cases is mediated by inhibition of IMPDH and reduction
of intracellular pools of GTP and dGTP. Such a mechanism would account
for the broad array of viruses susceptible to inhibition by ribavirin
but would at the same time raise questions with regard to the lack of
sensitivity of some viruses to ribavirin inhibition. However, different
viruses are often assayed in different cell types under a variety of
culture conditions. Of importance may be the level of ribavirin
monophosphate available for inhibition of IMPDH, the utilization of
salvage pathways to produce GTP, and the demand on GTP pools due to
cellular growth. Ribavirin can potentiate the antiviral activity of
other guanosine-based nucleoside analogues for hepatitis B virus,
presumably because the analogues are more efficiently utilized once
dGTP levels are reduced by ribavirin (27). The requirement
for reduced GTP levels for the ribavirin-induced inhibition of GBV-B
was apparent by the reversal of the antiviral effect by guanosine
supplementation. An alternative but similar explanation is that
ribavirin does not significantly reduce GTP pools in primary tamarin
hepatocytes under the conditions employed and that error-prone
replication occurs in the presence of normal GTP levels in this system,
but excessive GTP levels due to guanosine supplementation ablate the effect. In some studies, the antiviral effect of ribavirin is not
abolished by guanosine supplementation (17), suggesting that ribavirin may possess other mechanisms of antiviral activity. The
potent antiviral profile of another IMPDH inhibitor (VX-497) resembles
but is not identical to that of ribavirin, suggesting that for most
viruses the IMPDH inhibition provides the antiviral effect independent
of the guanosine-like structure of ribavirin (17). The
studies in this report are among the first to suggest that the
antiviral effect of ribavirin for some viruses is exerted by
incorporation of RTP and induction of error-prone replication.
During preparation of this report, studies with poliovirus that also
concluded that ribavirin can act as a mutagen due to error-prone
replication were published (6). In these studies, in vitro
assays with the poliovirus polymerase demonstrated incorporation of RTP
into a synthetic template, and treatment of poliovirus-infected cells
with ribavirin resulted in error-prone replication, as measured by an
increase in the frequency of guanosine-resistant mutants and by
sequencing of the poliovirus genome. The level of ribavirin required
for a significant antiviral effect was much higher for poliovirus
(1,000 µM) than that required in our studies on GBV-B (100 µM).
There are several possible explanations for this discrepancy: the
cellular uptake of ribavirin and conversion to RTP may differ between
the cell types used in the poliovirus studies and the primary tamarin
hepatocytes; the fact that primary hepatocytes are nondividing cultures
may have a significant impact on intracellular GTP pools; the degree to
which the salvage pathways are used to supply GTP will also influence
the efficacy of ribavirin, as demonstrated in the guanosine
supplementation studies (Fig. 4); and the relative affinity of the two
viral polymerases for RTP may differ as well. The disassociation
constants for the poliovirus polymerase were measured in an in vitro
assay using a synthetic template in which the addition of a templated
GMP could be measured. The Kd for ribavirin was 113-fold higher than the Kd
for GTP, 430 µM versus 3.8 µM, respectively. The disassociation
constant for the GBV-B polymerase cannot be measured at this time due
to the lack of an in vitro assay for the purified polymerase.
The immediate assumption from the poliovirus and GBV-B studies is that
nucleoside analogues that induce error-prone replication should be
highly efficacious in the treatment of viral infections, especially RNA
viruses, and importantly HCV infections. However, one must consider the
specific circumstances in which ribavirin exerts its effect. Ribavirin
must first reduce the levels of the natural nucleotide triphosphate
with which it must compete for incorporation. With ribavirin, this is
facilitated by virtue of its inhibition of an essential enzyme upstream
in the pathway for nucleotide triphosphate synthesis. The efficacy of
other guanosine analogues could be potentiated using combination
therapy with ribavirin, as has been observed for hepatitis B virus
(27). For the use of analogues for other nucleosides to
induce error-prone replication, either the biosynthetic pathway for the
production of the natural triphosphate must be inhibited or the viral
enzyme must have a very low Kd for the
nucleotide triphosphate form of the analogue. Nonetheless, the
potential for induction of error-prone replication as an antiviral
strategy is particularly attractive for RNA viruses.
 |
ACKNOWLEDGMENTS |
This work was supported in part by grants RO1 AI49574 and P51
RR13986 from the National Institutes of Health and by a grant from the
Schering-Plough Research Institute.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Virology and Immunology, Southwest Regional Primate Research Center, Southwest Foundation for Biomedical Research, 7620 N.W. Loop 410, San
Antonio, TX 78227. Phone: (210) 258-9445. Fax: (210) 670-3329. E-mail:
rlanford{at}icarus.sfbr.org.
Present address: ICN Pharmaceuticals, Costa Mesa, CA 92626.
Present address: Bayer Biological Products, Raleigh, NC 27610.
 |
REFERENCES |
| 1.
|
Beames, B.,
D. Chavez,
B. Guerra,
L. Notvall,
K. M. Brasky, and R. E. Lanford.
2000.
Development of a primary tamarin hepatocyte culture system for GB virus-B: a surrogate model for hepatitis C virus.
J. Virol.
74:11764-11772[Abstract/Free Full Text].
|
| 2.
|
Blight, K. J.,
A. A. Kolykhalov, and C. M. Rice.
2000.
Efficient initiation of HCV RNA replication in cell culture.
Science
290:1972-1974[Abstract/Free Full Text].
|
| 3.
|
Bodenheimer, H. C., Jr.,
K. L. Lindsay,
G. L. Davis,
J. H. Lewis,
S. N. Thung, and L. B. Seeff.
1997.
Tolerance and efficacy of oral ribavirin treatment of chronic hepatitis C: a multicenter trial.
Hepatology
26:473-477[CrossRef][Medline].
|
| 4.
|
Bukh, J.,
C. L. Apgar, and M. Yanagi.
1999.
Toward a surrogate model for hepatitis C virus: an infectious molecular clone of the GB virus-B hepatitis agent.
Virology
262:470-478[CrossRef][Medline].
|
| 5.
|
Butkiewicz, N.,
N. Yao,
W. Zhong,
J. Wright-Minogue,
P. Ingravallo,
R. Zhang,
J. Durkin,
D. N. Strandring,
B. M. Baroudy,
D. V. Sangar,
S. M. Lemon,
J. Y. N. Lau, and Z. Hong.
2000.
Virus-specific cofactor requirement and chimeric hepatitis C virus/GB virus B nonstructural protein 3.
J. Virol.
74:4291-4301[Abstract/Free Full Text].
|
| 6.
|
Crotty, S.,
D. Maag,
J. J. Arnold,
W. Zhong,
J. N. Lau,
Z. Hong,
R. Andino, and C. E. Cameron.
2000.
The broad-spectrum antiviral ribonucleoside ribavirin is an RNA virus mutagen.
Nat. Med.
6:1375-1379[CrossRef][Medline].
|
| 7.
|
De Clercq, E.
1993.
Antiviral agents: characteristic activity spectrum depending on the molecular target with which they interact.
Adv. Virus Res.
42:1-55[Medline].
|
| 8.
|
Deinhardt, F.,
A. W. Holmes,
R. B. Capps, and H. Popper.
1967.
Studies on the transmission of human viral hepatitis to marmoset monkeys.
J. Exp. Med.
125:673-688[Abstract].
|
| 9.
|
Dusheiko, G.,
J. Main,
H. Thomas,
O. Reichard,
C. Lee,
A. Dhillon,
S. Rassam,
A. Fryden,
H. Reesink,
M. Bassendine,
G. Norkrans,
T. Cuypers,
N. Lelie,
P. Telfer,
J. Watson,
C. Weegink,
P. Sillikens, and O. Weiland.
1996.
Ribavirin treatment for patients with chronic hepatitis C: results of a placebo-controlled study.
J. Hepatol.
25:591-598[CrossRef][Medline].
|
| 10.
|
Fang, S. H.,
L. H. Hwang,
D. S. Chen, and B. L. Chiang.
2000.
Ribavirin enhancement of hepatitis C virus core antigen-specific type 1 T helper cell response correlates with the increased IL-12 level.
J. Hepatol.
33:791-798[CrossRef][Medline].
|
| 11.
|
Hultgren, C.,
D. R. Milich,
O. Weiland, and M. Sällberg.
1998.
The antiviral compound ribavirin modulates the T helper (Th)1/Th2 subset balance in hepatitis B and C virus-specific immune responses.
J. Gen. Virol.
79:2381-2391[Abstract].
|
| 12.
|
Lanford, R. E.,
L. Estlack, and A. L. White.
1996.
Neomycin inhibits secretion of apolipoprotein[a] by increasing retention on the hepatocyte cell surface.
J. Lipid Res.
37:2055-2064[Abstract].
|
| 13.
|
Lanford, R. E., and L. E. Estlack.
1998.
A cultivation method for highly differentiated primary chimpanzee hepatocytes permissive for hepatitis C virus replication.
Methods Mol. Med.
19:501-516.
|
| 14.
|
Linnen, J.,
J. Wages, Jr.,
Z.-Y. Zhang-Keck,
K. E. Fry,
K. Z. Krawczynski,
H. Alter,
E. Koonin,
M. Gallagher,
M. Alter,
S. Hadziyannis,
P. Karayiannis,
K. Fung,
Y. Nakatsuji,
J. W. K. Shih,
L. Young,
M. Piatak, Jr.,
C. Hoover,
J. Fernandez,
S. Chen,
J.-C. Zou,
T. Morris,
K. C. Hyams,
S. Ismay,
J. D. Lifson,
G. Hess,
S. K. H. Foung,
H. Thomas,
D. Bradley,
H. Margolis, and J. P. Kim.
1996.
Molecular cloning and disease association of hepatitis G virus: a transfusion-transmissible agent.
Science
271:505-508[Abstract].
|
| 15.
|
Lohmann, V.,
F. Korner,
A. Dobierzewska, and R. Bartenschlager.
2001.
Mutations in hepatitis C virus RNAs conferring cell culture adaptation.
J. Virol.
75:1437-1449[Abstract/Free Full Text].
|
| 16.
|
Lohmann, V.,
F. Körner,
J. O. Koch,
U. Herian,
L. Theilmann, and R. Bartenschlager.
1999.
Replication of subgenomic hepatitis C virus RNAs in a hepatoma cell line.
Science
285:110-113[Abstract/Free Full Text].
|
| 17.
|
Markland, W.,
T. J. McQuaid,
J. Jain, and A. D. Kwong.
2000.
Broad-spectrum antiviral activity of the IMP dehydrogenase inhibitor VX-497: a comparison with ribavirin and demonstration of antiviral additivity with alpha interferon.
Antimicrob. Agents Chemother.
44:859-866[Abstract/Free Full Text].
|
| 18.
|
Muerhoff, A. S.,
T. P. Leary,
J. N. Simons,
T. J. Pilot-Matias,
G. J. Dawson,
J. C. Erker,
M. L. Chalmers,
G. G. Schlauder,
S. M. Desai, and I. K. Mushahwar.
1995.
Genomic organization of GB viruses A and B: two new members of the Flaviviridae associated with GB agent hepatitis.
J. Virol.
69:5621-5630[Abstract].
|
| 19.
|
Ning, Q.,
D. Brown,
J. Parodo,
M. Cattral,
R. Gorczynski,
E. Cole,
L. Fung,
J. W. Ding,
M. F. Liu,
O. Rotstein,
M. J. Phillips, and G. Levy.
1998.
Ribavirin inhibits viral-induced macrophage production of TNF, IL-1, the procoagulant fgl2 prothrombinase and preserves Th1 cytokine production but inhibits Th2 cytokine response.
J. Immunol.
160:3487-3493[Abstract/Free Full Text].
|
| 20.
|
Ohba, K.,
M. Mizokami,
J. Y. N. Lau,
E. Orito,
K. Ikeo, and T. Gojobori.
1996.
Evolutionary relationship of hepatitis C, pesti-, flavi-, plant viruses, and newly discovered GB hepatitis agents.
FEBS Lett.
378:232-234[CrossRef][Medline].
|
| 21.
|
Rijnbrand, R.,
G. Abell, and S. M. Lemon.
2000.
Mutational analysis of the GB virus B internal ribosome entry site.
J. Virol.
74:773-783[Abstract/Free Full Text].
|
| 22.
|
Scarselli, E.,
A. Urbani,
A. Sbardellati,
L. Tomei,
R. De Francesco, and C. Traboni.
1997.
GB virus B and hepatitis C virus NS3 serine proteases share substrate specificity.
J. Virol.
71:4985-4989[Abstract].
|
| 23.
|
Sidwell, R. W.,
J. H. Huffman,
G. P. Khare,
L. B. Allen,
J. T. Witkowski, and R. K. Robins.
1972.
Broad-spectrum antiviral activity of virazole: 1-beta-D-ribofuranosyl-1,2,4-triazole-3-carboxamide.
Science
177:705-706[Abstract/Free Full Text].
|
| 24.
|
Simons, J. N.,
T. P. Leary,
G. J. Dawson,
T. J. Pilot-Matias,
A. S. Muerhoff,
G. G. Schlauder,
S. M. Desai, and I. K. Mushahwar.
1995.
Isolation of novel virus like sequences associated with human hepatitis.
Nat. Med.
1:564-569[CrossRef][Medline].
|
| 25.
|
Simons, J. N.,
T. J. Pilot-Matias,
T. P. Leary,
G. J. Dawson,
S. M. Desai,
G. G. Schlauder,
A. S. Muerhoff,
J. C. Erker,
S. L. Buijk,
M. L. Chalmers,
C. L. Van Sant, and I. K. Mushahwar.
1995.
Identification of two flavivirus-like genomes in the GB hepatitis agent.
Proc. Natl. Acad. Sci. USA
92:3401-3405[Abstract/Free Full Text].
|
| 26.
|
Tam, R. C.,
B. Pai,
J. Bard,
C. Lim,
D. R. Averett,
U. T. Phan, and T. Milovanovic.
1999.
Ribavirin polarizes human T cell responses towards a type 1 cytokine profile.
J. Hepatol.
30:376-382[CrossRef][Medline].
|
| 27.
|
Ying, C.,
E. De Clercq, and J. Neyts.
2000.
Ribavirin and mycophenolic acid potentiate the activity of guanine- and diaminopurine-based nucleoside analogues against hepatitis B virus.
Antiviral Res.
48:117-124[CrossRef][Medline].
|
Journal of Virology, September 2001, p. 8074-8081, Vol. 75, No. 17
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.17.8074-8081.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Cuevas, J. M., Gonzalez-Candelas, F., Moya, A., Sanjuan, R.
(2009). Effect of Ribavirin on the Mutation Rate and Spectrum of Hepatitis C Virus In Vivo. J. Virol.
83: 5760-5764
[Abstract]
[Full Text]
-
Chung, D.-H., Sun, Y., Parker, W. B., Arterburn, J. B., Bartolucci, A., Jonsson, C. B.
(2007). Ribavirin Reveals a Lethal Threshold of Allowable Mutation Frequency for Hantaan Virus. J. Virol.
81: 11722-11729
[Abstract]
[Full Text]
-
Graci, J. D., Harki, D. A., Korneeva, V. S., Edathil, J. P., Too, K., Franco, D., Smidansky, E. D., Paul, A. V., Peterson, B. R., Brown, D. M., Loakes, D., Cameron, C. E.
(2007). Lethal Mutagenesis of Poliovirus Mediated by a Mutagenic Pyrimidine Analogue. J. Virol.
81: 11256-11266
[Abstract]
[Full Text]
-
Chevaliez, S., Brillet, R., Lazaro, E., Hezode, C., Pawlotsky, J.-M.
(2007). Analysis of Ribavirin Mutagenicity in Human Hepatitis C Virus Infection. J. Virol.
81: 7732-7741
[Abstract]
[Full Text]
-
Sierra, M., Airaksinen, A., Gonzalez-Lopez, C., Agudo, R., Arias, A., Domingo, E.
(2007). Foot-and-Mouth Disease Virus Mutant with Decreased Sensitivity to Ribavirin: Implications for Error Catastrophe. J. Virol.
81: 2012-2024
[Abstract]
[Full Text]
-
Sun, Y., Chung, D.-H., Chu, Y.-K., Jonsson, C. B., Parker, W. B.
(2007). Activity of Ribavirin against Hantaan Virus Correlates with Production of Ribavirin-5'-Triphosphate, Not with Inhibition of IMP Dehydrogenase. Antimicrob. Agents Chemother.
51: 84-88
[Abstract]
[Full Text]
-
Chang, J., Nie, X., Gudima, S., Taylor, J.
(2006). Action of Inhibitors on Accumulation of Processed Hepatitis Delta Virus RNAs.. J. Virol.
80: 3205-3214
[Abstract]
[Full Text]
-
Leyssen, P., De Clercq, E., Neyts, J.
(2006). The Anti-Yellow Fever Virus Activity of Ribavirin Is Independent of Error-Prone Replication. Mol. Pharmacol.
69: 1461-1467
[Abstract]
[Full Text]
-
Paeshuyse, J., Leyssen, P., Mabery, E., Boddeker, N., Vrancken, R., Froeyen, M., Ansari, I. H., Dutartre, H., Rozenski, J., Gil, L. H. V. G., Letellier, C., Lanford, R., Canard, B., Koenen, F., Kerkhofs, P., Donis, R. O., Herdewijn, P., Watson, J., De Clercq, E., Puerstinger, G., Neyts, J.
(2006). A Novel, Highly Selective Inhibitor of Pestivirus Replication That Targets the Viral RNA-Dependent RNA Polymerase. J. Virol.
80: 149-160
[Abstract]
[Full Text]
-
Grande-Perez, A., Gomez-Mariano, G., Lowenstein, P. R., Domingo, E.
(2005). Mutagenesis-Induced, Large Fitness Variations with an Invariant Arenavirus Consensus Genomic Nucleotide Sequence. J. Virol.
79: 10451-10459
[Abstract]
[Full Text]
-
Morbitzer, M., Herget, T.
(2005). Expression of Gastrointestinal Glutathione Peroxidase Is Inversely Correlated to the Presence of Hepatitis C Virus Subgenomic RNA in Human Liver Cells. J. Biol. Chem.
280: 8831-8841
[Abstract]
[Full Text]
-
Leyssen, P., Balzarini, J., De Clercq, E., Neyts, J.
(2005). The Predominant Mechanism by Which Ribavirin Exerts Its Antiviral Activity In Vitro against Flaviviruses and Paramyxoviruses Is Mediated by Inhibition of IMP Dehydrogenase. J. Virol.
79: 1943-1947
[Abstract]
[Full Text]
-
Jacob, J. R., Lin, K.-C., Tennant, B. C., Mansfield, K. G.
(2004). GB virus B infection of the common marmoset (Callithrix jacchus) and associated liver pathology. J. Gen. Virol.
85: 2525-2533
[Abstract]
[Full Text]
-
Gonzalez-Lopez, C., Arias, A., Pariente, N., Gomez-Mariano, G., Domingo, E.
(2004). Preextinction Viral RNA Can Interfere with Infectivity. J. Virol.
78: 3319-3324
[Abstract]
[Full Text]
-
Buckwold, V. E., Wei, J., Wenzel-Mathers, M., Russell, J.
(2003). Synergistic In Vitro Interactions between Alpha Interferon and Ribavirin against Bovine Viral Diarrhea Virus and Yellow Fever Virus as Surrogate Models of Hepatitis C Virus Replication. Antimicrob. Agents Chemother.
47: 2293-2298
[Abstract]
[Full Text]
-
Pariente, N., Airaksinen, A., Domingo, E.
(2003). Mutagenesis versus Inhibition in the Efficiency of Extinction of Foot-and-Mouth Disease Virus. J. Virol.
77: 7131-7138
[Abstract]
[Full Text]
-
Lanford, R. E., Guerra, B., Lee, H., Averett, D. R., Pfeiffer, B., Chavez, D., Notvall, L., Bigger, C.
(2002). Antiviral Effect and Virus-Host Interactions in Response to Alpha Interferon, Gamma Interferon, Poly(I)-Poly(C), Tumor Necrosis Factor Alpha, and Ribavirin in Hepatitis C Virus Subgenomic Replicons. J. Virol.
77: 1092-1104
[Abstract]
[Full Text]
-
Severson, W. E., Schmaljohn, C. S., Javadian, A., Jonsson, C. B.
(2002). Ribavirin Causes Error Catastrophe during Hantaan Virus Replication. J. Virol.
77: 481-488
[Abstract]
[Full Text]
-
Contreras, A. M., Hiasa, Y., He, W., Terella, A., Schmidt, E. V., Chung, R. T.
(2002). Viral RNA Mutations Are Region Specific and Increased by Ribavirin in a Full-Length Hepatitis C Virus Replication System. J. Virol.
76: 8505-8517
[Abstract]
[Full Text]
-
De Tomassi, A., Pizzuti, M., Graziani, R., Sbardellati, A., Altamura, S., Paonessa, G., Traboni, C.
(2002). Cell Clones Selected from the Huh7 Human Hepatoma Cell Line Support Efficient Replication of a Subgenomic GB Virus B Replicon. J. Virol.
76: 7736-7746
[Abstract]
[Full Text]