Previous Article | Next Article ![]()
Journal of Virology, September 2001, p. 8063-8073, Vol. 75, No. 17
Gladstone Institute of Virology and
Immunology1 and Departments of
Physiology2 and
Medicine,4 School of Medicine,
University of California San Francisco, San Francisco, California
94141-9100, and Department of Neurology and Neurological
Sciences, Stanford University, Stanford, California
943053
Received 5 April 2001/Accepted 2 June 2001
Progress in developing a small animal model of human
immunodeficiency virus type 1 (HIV-1) disease would greatly facilitate studies of transmission, pathogenesis, host immune responses, and
antiviral strategies. In this study, we have explored the potential of
rats as a susceptible host. In a single replication cycle, rat cell
lines Rat2 and Nb2 produced infectious virus at levels 10- to 60-fold
lower than those produced by human cells. Rat-derived cells supported
substantial levels of early HIV-1 gene expression, which was further
enhanced by overexpression of human cyclin T1. Rat cells displayed
quantitative, qualitative, and cell-type-specific limitations in the
late phase of the HIV-1 replication cycle including relative expression
levels of HIV-1 Gag proteins, intracellular Gag processing, and viral
egress. Nb2 cells were rendered permissive to HIV-1 R5 viruses by
coexpression of human CD4 and CCR5, indicating that the major
restriction on HIV-1 replication was at the level of cellular entry. We
also found that primary rat lymphocytes, macrophages, and microglia expressed considerable levels of early HIV-1 gene products following infection with pseudotyped HIV-1. Importantly, primary rat macrophages and microglia, but not lymphocytes, also expressed substantial levels
of HIV-1 p24 CA and produced infectious virions. Collectively, these
results identify the rat as a promising candidate for a transgenic
small animal model of HIV-1 infection and highlight pertinent
cell-type-specific restrictions that are features of this species.
It has long been recognized that human
immunodeficiency virus type 1 (HIV-1) replicates efficiently in human
cells but is subject to potent species-specific restrictions in cells
from many nonprimate species (25, 33, 34, 44). Several
advances have been made recently in elucidating the molecular bases of such blocks to HIV-1 replication in nonprimate cells. These discoveries have recharged efforts to develop small animal models of infection for
use in the study of pathogenesis, the screening of drugs, and the
testing of vaccines.
A first important advance was made with the understanding of the
requirements for human chemokine receptors as cofactors with human CD4
(hCD4) for cell surface fusion and entry of HIV-1 (reviewed in
references 28 and 43). The discovery of the primary roles played by human CCR5 (hCCR5) and human CXCR4 (hCXCR4) renewed hopes for
the development of a transgenic mouse model. However, while
coexpression of hCD4 and a human chemokine receptor largely overcame
the entry block in mouse NIH 3T3 cells (5, 20, 40) as well
as in primary T cells from mice transgenic for either hCD4 and hCCR5
(11) or hCD4 and hCXCR4 (49), these mouse
cells exhibited little or no productive infection.
A second advance has been in understanding postentry blocks to HIV-1
replication in some rodent cell lines. At least one restriction in cell
lines from mice and hamsters is the inability of the viral transcription regulator, Tat, to activate transcription from the long
terminal repeat (LTR) of HIV-1, which is normally a crucial step for
vigorous viral replication (24). Recently, a novel Tat-interacting protein, human cyclin T1 (CycT1), was discovered (58), which is a component of the pTEFb transcription
factor complex (38, 60). Human CycT1, in association with
the cyclin-dependent kinase CDK9, interacts with Tat to form a
heterodimer with very high affinity for binding the TAR stem-loop near
the 5' end of nascent HIV-1 mRNA transcripts. This complex mediates
hyperphosphorylation of RNA polymerase II, thereby increasing its
processivity (20). Mouse CycT1 differs from its human
homologue at several amino acids, and the change from tyrosine to
cysteine at position 261 prevents it from interacting with Tat
(6, 20, 31). Expression of human CycT1 in NIH 3T3 cells
reverses the block to Tat function and allows the HIV-1 replication
cycle to proceed through entry, reverse transcription, integration, and
proviral gene expression in cells coexpressing hCD4 and an appropriate
coreceptor but is not sufficient to reconstitute the full HIV-1
replication cycle (5, 20, 40). There has been some
controversy over the existence of an additional block in mouse and
hamster cells that limits the function of HIV-1 Rev (37,
55), and more recent studies suggest a relative, rather than an
absolute, limitation in the function of this regulatory protein in
rodent cells (5, 39). Moreover, a viral assembly block was
reported for NIH 3T3 cells (40) that could be partially
complemented by human-mouse heterokaryon fusions (5, 39).
Also, conflicting data have been published regarding the infectivity of
virions released from murine cell lines (5, 20, 39-41).
With regard to the rat species, the rat fibroblast cell line Rat2 and
neuroblastoma cell line B50 have been demonstrated to support robust
levels of HIV-1 LTR activity (5, 40, 42), and persistently
infected Rat2 cells that secrete considerable levels of p24 CA were
reported elsewhere (42). Furthermore, Rattus
norvegicus offers several advantages for the development of an
animal model, including small size, convenience in breeding, and
well-characterized immune and central nervous systems. In addition, rat
transgenesis can be performed with relative ease, thereby enabling the
selective expression of human genes that may be essential for full
realization of the HIV-1 replication cycle.
Therefore, in the present work we sought to extend these provocative
cell culture data as a further exploration of the rat as a potential
small animal model of HIV disease. These experiments used both cell
lines and primary rat-derived cell cultures to define in greater detail
the extent to which the HIV-1 replication cycle is intact in this
species context. The results reveal the integrity of the early phase of
the replication cycle but also expose cell-type-specific limitations in
the late phase. These features are likely to dictate patterns of
productive infection, and probably pathogenesis, in a transgenic model
based on rats.
Plasmids.
pCMV4hygro is a version of the mammalian
expression vector pCMV4 (2), which has the neomycin
resistance gene replaced by a hygromycin resistance gene. pCD4neo,
which expresses hCD4 and a neomycin resistance gene, has been described
previously (23). pCMVFCCR5 contains an epitope-tagged
version of hCCR5 and has been previously described (3).
pCCR5hygro was developed by excising the epitope-tagged version of
hCCR5 as a HindIII-XbaI fragment from
pCMVFCCR5 and inserting it into these sites of pCMVhygro. Human CycT1
was expressed under the control of the cytomegalovirus (CMV) promoter
by transfection of a plasmid (pCICycT) kindly provided by Katherine
Jones. pVSV-G, the mammalian expression vector for vesicular stomatitis
virus G (VSV-G) protein (17), was kindly provided by Jane
Burns. The molecular clone pNL-4-3 Luc
E Cell lines and transfectants.
Rat2 cells (rat
fibroblast-like cell line [ATCC CRL-1764]) and C58 cells (rat T-cell
lymphoma [ATCC TIB-236]) were obtained from the American Type Culture
Collection, Manassas, Va., and cultivated as recommended. Nb2 cells
(rat T-cell lymphoma) (18) were a kind gift from Jay Ryan.
Nb2 hCD4 cells were generated by electroporation of Nb2 cells with
pCD4neo and neomycin selection (Life Technologies). Nb2 hCD4/hCCR5
cells were generated by electroporation of Nb2 hCD4 cells with
pCCR5hygro and selection in medium containing both neomycin and
hygromycin B (Roche Diagnostics). Pretreatment of Nb2 hCD4/hCCR5 cells
with sodium butyrate (Sigma) (1 mM, 16 h) was required to induce
expression of hCCR5 at detectable levels by flow cytometry. SUP-T1
hCCR5 cells were generated by transfection of SUP-T1 cells with
pCCR5hygro and hygromycin B selection. Jurkat hCCR5 cells were a kind
gift from Paula Pitha. The rat T-cell line SD1 was established by human
T-cell leukemia virus type 1 transformation of primary hCD4-transgenic
T lymphocytes from outbred Sprague-Dawley (SD) rats following an
established protocol (1).
Primary cells.
Rat strains were obtained from Charles River
Laboratories (inbred strains Fischer F344 [Fischer], Brown-Norway
[BN], Noble, Copenhagen, Lewis, and WKY) or from Taconics (SD).
Primary rat lymphocytes and macrophages were prepared from spleens,
which had been removed aseptically from euthanatized rats. Single-cell suspensions were prepared by pushing tissue pieces through a nylon mesh
screen (Falcon cell strainer; 70-µm-pore-size nylon; Becton Dickinson). The cell suspension was washed once with phosphate-buffered saline (PBS), and erythrocytes were then lysed by incubation in ACK
lysis buffer (BioWhittaker) for 5 min, followed by another PBS wash.
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.17.8063-8073.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Susceptibility of Rat-Derived Cells to Replication
by Human Immunodeficiency Virus Type 1


and
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
R
(15),
an NL4-3 provirus (along with mutations in env,
nef, and vpr) carrying a luciferase gene within
the nef locus driven by the 5' LTR, was a gift of Nathaniel
Landau via the AIDS Research and Reference Reagent Program. A
three-plasmid lentivirus expression system was used to generate
HIV-derived retrovirus vector particles that express firefly luciferase
under the control of the CMV intermediate-early promoter,
including the packaging construct pCMV
R8.91 (62), the
transfer vector construct pHR'CMV-Luc-SIN-W (16, 61)
(kindly provided by Didier Trono), and pVSV-G.
5 M 2-mercaptoethanol (GIBCO-BRL),
nonessential amino acids (Cellgro), 1 mM sodium pyruvate, and minimum
essential medium vitamin solution (GIBCO-BRL). To activate rat
lymphocytes, concanavalin A (Sigma) was added at a final concentration
of 1 µg/ml. After overnight incubation, cells were washed twice with
PBS and then resuspended in fresh medium supplemented with 20 nM human
recombinant interleukin 2 (IL-2) (a gift of Chiron Corporation).
Viruses and infections.
NL4-3 or 49.5/(VSV-G)
replication-competent pseudotypes were produced by calcium phosphate
transfection of 293T cells with an equal amount of proviral DNA plasmid
and pVSV-G. Culture supernatants were harvested 48 h
posttransfection, filtered, and frozen in aliquots at
80°C. Virus
titers were determined on GHOST.R5 and GHOST.X4 cells
(12), respectively, and a multiplicity of infection (MOI)
of 1 was used for subsequent infections. Molecular clones of pYU-2,
pJR-CSF, pNL4-3, and pLAI.2 were obtained through the AIDS Research and
Reference Reagent Program and were prepared as described previously
(52). p49.5 (14) was a gift from Bruce Chesebro. Infections were carried out at the indicated MOIs (YU-2 and
JR-CSF) or at a p24 CA inoculum of 100 ng/ml (LAI.2). For experiments
shown in Fig. 4, T-cell lines were pretreated with sodium butyrate at 1 mM for 16 h. The preparation of NL4-3 Luc E
R
pseudotype viruses
with autologous or heterologous envelopes has been described previously
(13).
Antibodies and flow cytometry. Fluorescence-activated cell sorting analyses were performed as previously described (3), using phycoerythrin (PE)-conjugated anti-hCD4 (monoclonal antibody [MAb] Leu-3a); fluorescein isothiocyanate (FITC)-conjugated anti-hCCR5 (MAb 2D7); PE-conjugated anti-human HLA-A, -B, and -C (MAb G46-2.6); FITC-conjugated anti-human CD3 (MAb Leu-4); PE-conjugated anti-rat major histocompatibility complex class I (MAb OX-18); FITC-conjugated anti-rat CD3 (MAb G4.18); PE-conjugated anti-rat macrophage subset (ED2-like antigen; MAb HIS36); FITC-conjugated anti-rat CD11b (MAb WT.5); or PE-conjugated anti-rat CD11b/c (MAb OX-42). All antibodies were from BD Pharmingen.
Viral infectivity assay. The infectious titer (50% tissue culture infective dose [TCID50]) of HIV-1 in cell culture supernatants was determined by endpoint limiting dilution on PHA-P-activated human PBMC (pool of human PBMC from three or four HIV-1-negative donors) 5 days after inoculation. The p24 CA concentration in supernatants was quantified by the NEN/DuPont p24 enzyme-linked immunosorbent assay (NEN Life Sciences), which selectively measures p24 CA but not unprocessed p55 Gag (5). In some analyses, supernatant from a hybridoma producing the neutralizing anti-VSV-G MAb I1 (8) (a kind gift from Leo Lefrancois) was added at a final volume of 1:100 [a 1:1,000 dilution was still neutralizing for the HIV-1/(VSV-G) input stock].
cDNA sequencing of rat CycT1. Total RNA was prepared from rat Nb2 using the Qiagen RNeasy kit. First-strand cDNA for PCR was carried out with avian myeloblastosis virus reverse transcriptase reagents from Roche Diagnostics (catalog no. 1483-188) according to the manufacturer's instructions, using oligo(dT) as a primer. The 5' half of rat CycT1 was amplified using primer RATTAT 1 (AAGCTTGCCGCCATGGAGGGAGAGAGG), containing the start codon, and RATTAT 3 (CAAGTGCAGTGCCTTCCCTGC). The 3' half was amplified using RATTAT 4 (GCAGGGAAGGCACTGCACTTG), the inverse complement of RATTAT 3, and RATTAT 2 (GGATCCTYACTTAGGAAGRGGTGG), with the stop codon. These primers were chosen based upon sequence similarities between the mouse and human sequences, and RATTAT 2 contains two degeneracies. The two halves were amplified using AmpliTaq and standard conditions. Amplified DNA was TA cloned into pCR2.1, and a TA clone of each half was obtained and sequenced. This preliminary sequence of 94% of the entire rat CycT1 clearly identified the amplified sequence as CycT1 and no other known cyclin. The identity of residue 261 was confirmed by preparing another set of RNA samples from Nb2, Rat2, and C58 cells and amplifying the region around residue 261 using another set of primers.
Western blot analysis.
The cell pellets were lysed in buffer
A (50 mM HEPES, 135 mM NaCl, 10% glycerol, 1% Triton X-100, 1 mM
EDTA, and 1× protease inhibitor cocktail [Calbiochem]), pH 7.2, for
1 h at 4°C. The cell lysate was collected after centrifugation
at 13,200 × g for 20 min at 4°C. The lysate was
analyzed for protein concentration using the bicinchoninic acid protein
assay (Pierce), and 10 µg of cellular protein was run on sodium
dodecyl sulfate-12% polyacrylamide gels (Bio-Rad) and transferred to
nitrocellulose (Osmonics). The blots were sequentially probed with
primary antibodies to HIV-1 Nef (1:1,000; GF-7 [9]),
gp120 (1:500; no. 387; from the AIDS Research and Reference Reagent
Program), and
-tubulin (3 µg/ml; Oncogene Sciences) or an anti-p24
CA ascites (1:2,000; a generous gift from Beckman Coulter). Following
secondary antibody treatment, the blots were exposed to
autoradiographic film using the ECL system (Amersham).
| |
RESULTS |
|---|
|
|
|---|
Early and late HIV-1 gene expression in cell lines from humans,
rats, and mice.
As a first assessment of the postentry
susceptibility of rat cells to HIV-1 replication, various rat, human,
and mouse cell lines were infected with pseudotyped HIV-1 virions
carrying VSV-G, which mediates entry into a broad range of mammalian
cells. To determine the relative expression of an early,
Rev-independent HIV-1 gene product, we used HIV-1 pseudotype virus
based on the HIV-1 NL4-3 proviral backbone containing the firefly
luciferase gene within the nef gene locus (NL4-3 Luc
E
R
) (15),
the expression of which provides a quantitative marker of successful
entry, reverse transcription, integration, and early viral gene
expression in a given target cell. To quantify the relative expression
and egress of a Rev-dependent, fully processed structural HIV-1 gene
product, cells were similarly challenged with a VSV-G-pseudotyped HIV-1
molecular clone based on NL4-3 (49.5) and the p24 CA antigen
concentration was measured in culture supernatants. To assess
quantitative differences in VSV-G-mediated entry among different cell
types, parallel infections were performed with VSV-G pseudotypes
containing a firefly luciferase gene under the control of the CMV
promoter (16, 61, 62).
|
|
The HIV-1 LTR exhibits significant activity in Rat2 cells which can
be further enhanced by human CycT1.
To characterize further the
efficiency of HIV-1 LTR transactivation and transcript elongation in
rat cells, increasing amounts of the proviral plasmid pNL4-3 Luc
E
R
were transfected
into Rat2, HeLa, and NIH 3T3 cells, and luciferase activities in
cellular lysates were quantified 48 h later. The measured HIV-1
LTR activity was normalized for variability in transfection efficiency
by cotransfection of an LTR-independent reporter construct
(58). Over a range of pNL4-3 Luc
E
R
concentrations, Rat2
cells yielded a substantial signal that was significantly higher than
that found in NIH 3T3 cells but somewhat lower than that of HeLa cells
(Fig. 3A). Interestingly, the substitution of a single
amino residue (tyrosine-261) in mouse CycT1 compared to its human
homologue was previously identified as the major determinant
restricting Tat-mediated HIV-1 LTR transactivation in NIH 3T3 cells
(6, 20, 31, 58). In view of the substantial transcriptional activity observed in Rat2 cells, we sought to establish
the sequence of the rat CycT1 homologue. A partial sequence of rat
CycT1 cloned from a rat cDNA library revealed that it shared a tyrosine
residue at position 261 with mouse CycT1 (data not shown). This fact
raises the possibility that this sequence change in CycT1 may not be
essential for its interaction with Tat in rat cells or that viral
transcription in rat cells is relatively Tat independent. In the same
HIV-1 LTR assay system described above, cotransfection of an expression
plasmid encoding human CycT1 nevertheless significantly augmented
luciferase signals in both NIH 3T3 and Rat2 cells, achieving levels
comparable to those of HeLa cells (Fig. 3B). Therefore, the activity of
CycT1 may be a quantitatively limiting factor for Tat transactivation in rat cells, although human CycT1 is nonessential.
|
Coexpression of hCD4 and hCCR5 in rat Nb2 cells renders them
permissive for HIV-1 infection.
Cellular entry is a major
restriction of HIV-1 replication in rodent cells (reviewed in reference
4). To test whether coexpression of hCD4 and the human
chemokine receptor CCR5 could overcome this block, we generated stable
transfectants of the rat T-cell line Nb2 that express hCD4 alone (Nb2
hCD4) or hCD4 and hCCR5 (Nb2 hCD4/hCCR5). Clones of the human
CD4+ T-cell lines Jurkat (Jurkat hCCR5)
(48) and SUP-T1 (SUP-T1 hCCR5), which had also been
engineered to express hCCR5, served as controls. Cell surface
expression of human receptors was quantified by flow cytometry,
revealing various levels of hCD4 and hCCR5 on Nb2 hCD4/hCCR5, Jurkat
hCCR5, and SUP-T1 hCCR5 cells (Fig. 4A). We first
performed single-round infection studies with NL4-3 luciferase reporter
viruses pseudotyped with different autologous or heterologous
envelopes. VSV-G pseudotypes comparably infected Nb2, Nb2 hCD4, and Nb2
hCD4/hCCR5, as well as the human T-cell line clones (Fig. 4B). The
HIV-1 R5 envelope pseudotypes efficiently infected Nb2 hCD4/hCCR5 cells
but failed to produce significant signals in parental Nb2 cells.
Interestingly, SUP-T1 hCCR5 cells yielded the highest signals for both
R5 pseudotypes and yet expressed almost undetectable levels of hCCR5.
As a confirmation of specificity, the HIV-1 X4 pseudotype did not show
significant entry into any of the Nb2 cell lines but readily infected
the human T-cell lines expressing endogenous hCXCR4.
|
Primary rat cells can support substantial early HIV-1 gene
expression, but only macrophages and microglia support significant
expression of late, fully processed HIV-1 gene products.
Tissue-specific differences in supporting particular steps in the HIV-1
replication cycle have been described previously (35, 45),
which emphasizes the need to study the specific cell types that are
expected to express human transgenes and thereby be rendered infectible
by HIV-1 in a transgenic animal. Primary T lymphocytes and cells from
the monocyte/macrophage lineage are considered to be the most important
sites of HIV-1 replication in humans and are thus obvious targets for
rodent transgenesis. We therefore investigated the ability of HIV-1 to
replicate in primary lymphocytes, macrophages, and microglia from rats.
The same VSV-G pseudotype infection strategies described above for cell
lines were used to assess early and late events in the HIV-1
replication cycle in primary cells from a variety of different rat
strains. Both primary rat lymphocytes and macrophages supported
substantial LTR-driven early gene expression even in the absence of
human cofactors for Tat (Fig. 5, top panels). When
normalized for differences in VSV-G-mediated entry, levels for rat
lymphocytes were 12 to 31% of that of human reference cultures, and
levels for rat macrophages were 16 to 45%. Since luciferase activity
is a surrogate marker of early gene expression that may be affected by
other factors, we also used Nef expression in primary rat cells as an
independent and direct measure. In agreement with our earlier findings,
primary rat lymphocytes and macrophages expressed abundant levels of
HIV-1 Nef following NL4-3/(VSV-G) pseudotype infections (Fig.
6A, lanes 3 and 8, and B, lane 4). AZT treatment
inhibited Nef expression in both rat and human lymphocytes, confirming
that this protein had been synthesized de novo. Of note, the kinetics
of Nef expression in primary rat lymphocytes were somewhat delayed
compared to those in human cultures, and human lymphocytes displayed
massive cell death on day 3 postinfection.
|
|
|
HIV-1 produced by human cells and that produced by rat cells are
equally infectious.
Finally, we sought to assess the relative
infectivity of virions released from comparable human and rat cell
cultures. We challenged adherent cell lines HeLa and Rat2, T-cell lines
Jurkat and Nb2, and a set of primary macrophage cultures with VSV-G
pseudotyped virus containing an intact, replication-competent HIV-1
genome. Five days postinfection, culture supernatants were collected
and analyzed for both the concentration of p24 CA and infectious titer (TCID50 per milliliter) on human PBMC. The
relative infectivity of released HIV-1, defined as the ratio of the
TCID50 per milliliter to nanograms of p24 CA per
milliliter, was comparable for the respective cell pairs (Fig.
8). Importantly, in earlier experiments of this
type, TCID50 values determined in the presence or
absence of a neutralizing concentration of the anti-VSV-G MAb I1
(8) had not revealed significant differences, indicating
that the washing procedures had completely removed the initial VSV-G
pseudotyped inoculum (data not shown). Thus, the comparable
infectivities of human and rat cell-derived virions demonstrate that
fully mature, infectious HIV-1 particles can be efficiently
synthesized, assembled, and released from rat cells.
|
| |
DISCUSSION |
|---|
|
|
|---|
The urgent need for enhanced model systems to study HIV-1 transmission, pathogenesis, and candidate vaccines or therapeutic strategies necessitates a deeper understanding of quantitative limitations and blocks in the viral replication cycle in animals that may be used as hosts. Here we show that cellular entry constitutes the only absolute block to HIV-1 replication in certain rat cell lines and that this restriction can be overcome by coexpression of hCD4 and hCCR5. Our study revealed quantitative, qualitative, and cell-type-specific limitations in various aspects of the HIV-1 replication cycle in rat cells. Despite such limitations, primary rat cells from the monocyte/macrophage lineage supported all postentry steps in the viral life cycle and secreted substantial levels of infectious virions.
A first indication that rat-derived cells are permissive for postentry steps in the HIV-1 replication cycle resulted from infection studies of established cell lines using HIV-1 pseudotyped with a VSV-G envelope. Rat cell lines Rat2 (fibroblast) and Nb2 (T cell) supported considerable levels of productive infection, yielding p24 CA concentrations of approximately 30 ng/ml. Such high levels of HIV-1 replication have never been reported for mouse cell lines, even in the presence of human cofactors for Tat (4, 5, 40). Consistent with our findings, Rat2 clones stably transfected with HIV-1 provirus that secreted significant levels of virus have been reported previously (42). In contrast, one recent report found infection levels in Rat2 cells that were 10-fold lower than those seen in our study (5). The explanation for this discrepancy is unclear but may relate to different clones of Rat2 cells used in different laboratories. Nevertheless, these results prompted us to explore in subsequent experiments the efficiency of specific steps in the HIV-1 replication cycle in rat cells.
In these experiments, the postentry steps including uncoating, reverse transcription, nuclear importation, and proviral integration appeared to be intact in many rat-derived cells. Furthermore, rat-derived cells exhibited robust HIV-1 LTR activity as determined by HIV-1 NL4-3 pseudotype reporter virus infections, HIV-1 immunoblot analyses, HIV-1 LTR reporter assays, and infection studies with replication-competent HIV-1. The remarkably high HIV-1 LTR activity in rat cells seen in our study and previously reported by others (5, 39, 42) is in clear contrast to the previously reported inability of native mouse and hamster cells to support Tat-dependent HIV-1 transcription (5, 40, 58). The change of amino residue 261 from cysteine to tyrosine in CycT1 had previously been shown to be the major determinant restricting Tat-mediated HIV-1 LTR transactivation in NIH 3T3 cells (6, 20, 31, 58). Surprisingly, we found that rat and mouse CycT1 shared this amino acid substitution. Our experiments did not directly address whether the robust LTR activity in rat cells is indeed CycT1 dependent, and it is possible that viral transcription is at least partially CycT1 independent in this context. Alternatively, it can be speculated that this specific tyrosine residue is nonessential for rat CycT1 in supporting HIV-1 LTR transactivation. Specifically, one might hypothesize that other sequence changes in rat CycT1 may augment its interaction with Tat despite tyrosine-261, and indeed the sequence of a rat CycT1 clone that we obtained diverged at other positions from its mouse counterpart (data not shown). Furthermore, our results suggest that CycT1 may nonetheless be a quantitatively limiting factor for Tat transactivation in rat cells. Importantly, we also extended our analyses to primary rat cells, including lymphocytes and macrophages from different rat strains, all of which supported substantial early HIV-1 gene expression in the range of 12 to 45% of that of human reference cultures. We also found marked HIV-1 LTR activity in primary rat microglia, another cell type of the macrophage/monocyte lineage. Collectively, these data suggest that the ability to support robust HIV-1 LTR activity is a universal property of R. norvegicus.
We also found that coexpression of hCD4 and hCCR5 in rat Nb2 cells mediated substantial and specific entry of HIV-1. This finding is consistent with a number of studies demonstrating that the coexpression of hCD4 and hCCR5 or hCXCR4 on rodent cell lines is sufficient to overcome the HIV-1 entry block (5, 11, 39, 40, 49, 51), although there has been some controversy over the efficiency of this process (5, 40). Although Nb2 hCD4/hCCR5 cells could be productively infected and secrete infectious HIV-1, they failed to support an efficiently spreading infection. The reason for this inefficiency is unclear. One possible explanation is the lower absolute number of infectious particles being released from rat cells; compared to Nb2 cells, human T-cell lines produced approximately 40- to 60-fold-more infectious particles per cell in a single replication cycle. Also, Nb2 hCD4/hCCR5 cells only transiently express detectable levels of hCCR5 on the surface following sodium butyrate pretreatment, which conceivably limited a spreading infection by loss of potential secondary target cells for newly released virions in these experiments. Nevertheless, our data show that the major block to HIV-1 replication in rat cells can be overcome by expression of the HIV-1 receptor complex.
Quantitative and qualitative limitations in the late phase of the viral life cycle that appeared to be cell type specific were also found, although these relationships were complex. Intracellular p55 Gag processing, virion assembly, and egress occurred at various efficiencies that could not be predicted from cell-associated levels of structural proteins; in general, rat cell lines appeared to be less efficient than human cells but more efficient than mouse cells in supporting these steps. Absolute levels of secreted p24 CA were 10- to 60-fold lower in Rat2 and Nb2 cells than in human cell lines. However, there was no single step in the late phase of the HIV-1 replication cycle in these rat cell lines that could be pinpointed as being rate limiting for virus production. First, there has been some controversy over the existence of a profound block in Rev function in rodent cells (5, 37, 40, 55). This regulatory HIV-1 protein is thought to control the transition into the late phase of the viral replication cycle by orchestrating the ordered expression of the various gene products through effects on splicing, stability, and nuclear export of the unspliced genomic transcripts that depend on interactions with cellular factors (reviewed in reference 47). Our data do not support the existence of a rat species-specific defect in the function of HIV-1 Rev. In cell lines Rat2 and Nb2, as well as primary rat macrophages, we detected abundant levels of p55 Gag, a protein that derives from the Rev-dependent p160 Gag-Pol precursor. Furthermore, Rev function was conserved in rat T-cell lines C58 and SD1 (data not shown), as assessed with the chloramphenicol acetyltransferase reporter construct pDM128 and Rev supplied in trans by an expression vector (26). Second, there were clear quantitative differences in terms of the intracellular levels of fully processed p24 CA in rat and human cell lysates, as has been noted by others (5, 39, 40), but intracellular protein content was not a good indicator of levels of secreted p24 CA. Although difficult to quantify, the efficiency of viral assembly and egress may also be partly impaired in rat cells. Taking the data together, we speculate that several minor limitations at different steps of the HIV-1 replication cycle in rat cell lines in aggregate account for the quantitative reduction in virus production that we observed.
Importantly, we also found that HIV-1 produced by rat cells and that
produced by human cells had comparable levels of infectivity. HIV-1
derived from adherent cell lines and that derived from T-cell lines of
human or rat origin had similar ratios of TCID50
to p24 CA, indicating that assembly and maturation of virions can
proceed normally in rat cells. A similar finding was recently reported for NIH 3T3 (40) and CHO and Rat2 (39) cells,
while another study reported rat and mouse cell-derived HIV-1 to be
largely noninfectious (5). The basis for these
discrepancies is not known but could be related to different methods
for measuring infectious titers. We also found comparable infectivities
for HIV-1 released from primary macrophages of rat origin and for that
from macrophages of human origin. Future infection studies with HIV-1
vif mutants in primary rat macrophages may help to clarify the functionality of the HIV-1 Vif protein in this species context, since the vif gene is known to greatly enhance the
infectivity of HIV-1 that is released from human cells classified as
nonpermissive, which include primary macrophages (36, 54,
56).
An important aspect of our current study was to evaluate postentry steps in the HIV-1 replication cycle in primary rat cells, and we found that primary rat macrophages and microglia are remarkably susceptible. To our knowledge, this analysis is the first report describing primary rodent cells supporting HIV-1 replication at such high levels; the p24 CA concentrations secreted by rat macrophages were only two- to sixfold lower than those secreted by human monocyte-derived macrophages in a single replication cycle. In humans, macrophages and microglia in the central nervous system have long been known to be targets of HIV-1 that support virus replication in vivo (10, 19, 21, 29, 30, 53, 57, 59). Also, macrophages have been implicated as a source of increasing viremia in the latter stages of HIV disease in humans, in particular during opportunistic infections (46). A recent study suggested macrophages as the principal reservoir for sustained high virus load in rhesus macaques after the depletion of CD4+ T cells by a highly pathogenic simian immunodeficiency virus-HIV-1 chimera (27). Interestingly, macrophages are the evolutionarily conserved host cell type for all animal lentiviruses (reviewed in reference 32). Furthermore, the productive infection of microglia and the presence of multinucleated giant cells were found in one study to correlate roughly with the antemortem diagnosis of HIV-associated dementia (22). We speculate that reconstituting the HIV-1 viral receptor complex in transgenic rats may be sufficient to permit recapitulation of the full viral replication cycle in cells of the macrophage/monocyte lineage in vitro and in vivo.
Primary rat T lymphocytes were found to harbor a major posttranscriptional block to HIV-1 replication. Despite considerable expression of Nef protein or a reporter gene, primary T cells failed to synthesize Gag proteins and secrete significant concentrations of p24 CA. This phenotype is consistent with an impaired function of Rev in promoting the nuclear export of unspliced genomic transcripts, and future studies will be needed to address this possibility. On one hand, the failure of HIV-1 replication to proceed beyond early gene expression in primary rat T lymphocytes may help to dissect mechanisms of CD4+ T-cell depletion in an in vivo model. On the other hand, the future identification of human cellular factors that participate in HIV-1 replication and that may surmount restrictions in primary rat T lymphocytes would both provide a better understanding of the molecular aspects of HIV-1 replication and increase the range of uses of a transgenic rat model for the study of HIV-related pathogenesis. The results of the present study employing rat cell lines and primary rat cells serve as a sound basis for our current efforts to develop a transgenic small animal model using Rattus norvegicus, in which hCD4 and human chemokine receptors are expressed on macrophages, microglia, and T lymphocytes. It will be important to determine the impact in vivo of the cell-specific viral replication described here, which may dictate additional modifications that should be incorporated in subsequent generations of such a model.
| |
ACKNOWLEDGMENTS |
|---|
We thank Jane Burns, Kathy Jones, Matija Peterlin, Ned Landau, Didier Trono, Malcolm Martin, Leo Lefrancois, Jay Ryan, Paula Pitha, and Kathleen Page for reagents. We thank Warner C. Greene for his support. We acknowledge the excellent administrative assistance of Heather Gravois in the preparation of the manuscript and of John Carroll and Jack Hull for graphics preparation.
This work was supported in part by the J. David Gladstone Institutes (M.A.G.), NIH grant R21-AI46258 (M.A.G.), and the UCSF AIDS Clinical Research Center (R.F.S.). Oliver T. Keppler is a Howard Hughes Medical Institute Physician Postdoctoral Fellow. Frank J. Welte is a Howard Hughes Medical Institute Medical Student Research Training Fellow.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Gladstone Institute of Virology and Immunology, P.O. Box 419100, San Francisco, CA 94141. Phone: (415) 695-3775. Fax: (415) 695-1364. E-mail: mgoldsmith{at}gladstone.ucsf.edu.
Present address: Dynavax Technologies Corporation, Berkeley, CA 94710.
Present address: Rigel Pharmaceuticals, Inc., South San
Francisco, CA 94080.
§ Present address: Agilent Technologies, Palo Alto, CA 94304.
Present address: University Hospital Zürich, CH-8091
Zürich, Switzerland.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Akagi, T., H. Takata, T. Yoshino, N. Teramoto, S. Yano, and T. Oka. 1989. Immortalization of rat spleen and thymus T-cells by human T-cell leukemia virus type-I. Acta Med. Okayama 43:143-151. |
| 2. |
Andersson, S.,
D. L. Davis,
H. Dahlbäck,
H. Jörnvall, and D. W. Russell.
1989.
Cloning, structure, and expression of the mitochondrial cytochrome P-450 sterol 26-hydroxylase, a bile acid biosynthetic enzyme.
J. Biol. Chem.
264:8222-8229 |
| 3. |
Atchison, R. E.,
J. Gosling,
F. S. Monteclaro,
C. Franci,
L. Digilio,
I. F. Charo, and M. A. Goldsmith.
1996.
Multiple extracellular elements of CCR5 and HIV-1 entry: dissociation from response to chemokines.
Science
274:1924-1926 |
| 4. | Berger, E. A., P. M. Murphy, and J. M. Farber. 1999. Chemokine receptors as HIV-1 coreceptors: roles in viral entry, tropism, and disease. Annu. Rev. Immunol. 17:657-700[CrossRef][Medline]. |
| 5. |
Bieniasz, P. D., and B. R. Cullen.
2000.
Multiple blocks to human immunodeficiency virus type 1 replication in rodent cells.
J. Virol.
74:9868-9877 |
| 6. | Bieniasz, P. D., T. A. Grdina, H. P. Bogerd, and B. R. Cullen. 1998. Recruitment of a protein complex containing Tat and cyclin T1 to TAR governs the species specificity of HIV-1 Tat. EMBO J. 17:7056-7065[CrossRef][Medline]. |
| 7. | Boddeke, E., I. Meigel, S. Frentzel, N. G. Gourmala, J. K. Harrison, M. Buttini, O. Spleiss, and P. Gebicke-Harter. 1999. Cultured rat microglia express functional beta-chemokine receptors. J. Neuroimmunol. 98:176-184[CrossRef][Medline]. |
| 8. |
Boritz, E.,
J. Gerlach,
J. E. Johnson, and J. K. Rose.
1999.
Replication-competent rhabdoviruses with human immunodeficiency virus type 1 coats and green fluorescent protein: entry by a pH-independent pathway.
J. Virol.
73:6937-6945 |
| 9. | Bresnahan, P. A., W. Yonemoto, S. Ferrell, D. Williams-Herman, R. Geleziunas, and W. C. Greene. 1998. A dileucine motif in HIV-1 Nef acts as an internalization signal for CD4 downregulation and binds the AP-1 clathrin adaptor. Curr. Biol. 8:1235-1238[CrossRef][Medline]. |
| 10. | Brew, B. J., M. Rosenblum, K. Cronin, and R. W. Price. 1995. AIDS dementia complex and HIV-1 brain infection: clinical-virological correlations. Ann. Neurol. 38:563-570[CrossRef][Medline]. |
| 11. |
Browning, J.,
J. W. Horner,
M. Pettoello-Mantovani,
C. Raker,
S. Yurasov,
R. A. DePinho, and H. Goldstein.
1997.
Mice transgenic for human CD4 and CCR5 are susceptible to HIV infection.
Proc. Natl. Acad. Sci. USA
94:14637-14641 |
| 12. |
Cecilia, D.,
V. N. Kewalramani,
J. O'Leary,
B. Volsky,
P. Nyambi,
S. Burda,
S. Xu,
D. R. Littman, and S. Zolla-Pazner.
1998.
Neutralization profiles of primary human immunodeficiency virus type 1 isolates in the context of coreceptor usage.
J. Virol.
72:6988-6996 |
| 13. |
Chan, S. Y.,
R. F. Speck,
C. Power,
S. L. Gaffen,
B. Chesebro, and M. A. Goldsmith.
1999.
V3 recombinants indicate a central role for CCR5 as a coreceptor in tissue infection by human immunodeficiency virus type 1.
J. Virol.
73:2350-2358 |
| 14. |
Chesebro, B.,
K. Wehrly,
J. Nishio, and S. Perryman.
1992.
Macrophage-tropic human immunodeficiency virus isolates from different patients exhibit unusual V3 envelope sequence homogeneity in comparison with T-cell-tropic isolates: definition of critical amino acids involved in cell tropism.
J. Virol.
66:6547-6554 |
| 15. | Connor, R., B. Chen, S. Choe, and N. Landau. 1995. Vpr is required for efficient replication of human immunodeficiency virus type-1 in mononuclear phagocytes. Virology 206:935-944[CrossRef][Medline]. |
| 16. | Deglon, N., J. L. Tseng, J. C. Bensadoun, A. D. Zurn, Y. Arsenijevic, L. P. De Almeida, R. Zufferey, D. Trono, and P. Aebischer. 2000. Self-inactivating lentiviral vectors with enhanced transgene expression as potential gene transfer system in Parkinson's disease. Hum. Gene Ther. 11:179-190[CrossRef][Medline]. |
| 17. |
Emi, N.,
T. Friedmann, and J. K. Yee.
1991.
Pseudotype formation of murine leukemia virus with the G protein of vesicular stomatitis virus.
J. Virol.
65:1202-1207 |
| 18. |
Fleming, W. H.,
N. M. Pettigrew,
R. J. Matusik, and H. G. Friesen.
1982.
Thymic origin of the prolactin-dependent Nb2 lymphoma cell line.
Cancer Res.
42:3138-3141 |
| 19. | Gabuzda, D. H., D. D. S. Ho, M. de la Monte, M. S. Hirsch, T. R. Rota, and R. A. Sobel. 1986. Immunohistochemical identification of HTLV-III antigen in brains of patients with AIDS. Ann. Neurol. 20:289-295[CrossRef][Medline]. |
| 20. |
Garber, M.,
P. Wei,
V. KewalRamani,
T. Mayall,
C. Herrmann,
A. Rice,
D. Littman, and K. Jones.
1998.
The interaction between HIV-1 Tat and human cyclin T1 requires zinc and a critical cysteine residue that is not conserved in the murine CycT1 protein.
Genes Dev.
12:3512-3527 |
| 21. |
Gartner, S.,
P. Markovits,
D. M. Markovitz,
M. H. Kaplan,
R. C. Gallo, and M. Popovic.
1986.
The role of mononuclear phagocytes in HTLV-III/LAV infection.
Science
233:215-219 |
| 22. |
Glass, J. D.,
H. Fedor,
S. L. Wesselingh, and J. C. McArthur.
1995.
Immunocytochemical quantitation of human immunodeficiency virus in the brain correlations with dementia.
Ann. Neurol.
38:755-762[CrossRef][Medline].
|
| 23. | Goldsmith, M. A., M. T. Warmerdam, R. E. Atchison, M. D. Miller, and W. C. Greene. 1995. Dissociation of the CD4 downregulation and viral infectivity enhancement functions of human immunodeficiency virus type 1 Nef. J. Virol. 69:4112-4121[Abstract]. |
| 24. |
Hart, C. E.,
C. Y. Ou,
J. C. Galphin,
J. Moore,
L. T. Bacheler,
J. J. Wasmuth,
S. R. Petteway, Jr., and G. Schochetman.
1989.
Human chromosome 12 is required for elevated HIV-1 expression in human-hamster hybrid cells.
Science
246:488-491 |
| 25. |
Hofmann, W.,
D. Schubert,
J. LaBonte,
L. Munson,
S. Gibson,
J. Scammell,
P. Ferrigno, and J. Sodroski.
1999.
Species-specific, postentry barriers to primate immunodeficiency virus infection.
J. Virol.
73:10020-10028 |
| 26. |
Hope, T. J.,
D. McDonald,
X. J. Huang,
J. Low, and T. G. Parslow.
1990.
Mutational analysis of the human immunodeficiency virus type 1 Rev transactivator: essential residues near the amino terminus.
J. Virol.
64:5360-5366 |
| 27. |
Igarashi, T.,
C. R. Brown,
Y. Endo,
A. Buckler-White,
R. Plishka,
N. Bischofberger,
V. Hirsch, and M. A. Martin.
2001.
Macrophage are the principal reservoir and sustain high virus loads in rhesus macaques after the depletion of CD4(+) T cells by a highly pathogenic simian immunodeficiency virus/HIV type 1 chimera (SHIV): implications for HIV-1 infections of humans.
Proc. Natl. Acad. Sci. USA
98:658-663 |
| 28. | Kinter, A., J. Arthos, C. Cicala, and A. S. Fauci. 2000. Chemokines, cytokines and HIV: a complex network of interactions that influence HIV pathogenesis. Immunol. Rev. 177:88-98[CrossRef][Medline]. |
| 29. |
Koenig, S.,
H. Gendelman,
J. Orenstein,
M. Dal Canto,
G. Pezeshkpour,
M. Yungbluth,
F. Janotta,
A. Aksamit,
M. Martin, and A. Fauci.
1986.
Detection of AIDS virus in macrophages in brain tissue from AIDS patients with encephalopathy.
Science
233:1089-1093 |
| 30. | Kolson, D. L., and F. Gonzalez-Scarano. 2000. HIV and HIV dementia. J. Clin. Investig. 106:11-13[Medline]. |
| 31. | Kwak, Y. T., D. Ivanov, J. Guo, E. Nee, and R. B. Gaynor. 1999. Role of the human and murine cyclin T proteins in regulating HIV-1 tat-activation. J. Mol. Biol. 288:57-69[CrossRef][Medline]. |
| 32. | Levy, J. A. 1996. The value of primate models for studying human immunodeficiency virus pathogenesis. J. Med. Primatol. 25:163-174[Medline]. |
| 33. |
Levy, J. A.,
C. Cheng-Mayer,
D. Dina, and P. A. Luciw.
1986.
AIDS retrovirus (ARV-2) clone replicates in transfected human and animal fibroblasts.
Science
232:998-1001 |
| 34. |
Lewis, A. D., and P. R. Johnson.
1995.
Developing animal models for AIDS research progress and problems.
Trends Biotechnol.
13:142-150[CrossRef][Medline].
|
| 35. |
Ludwig, E.,
F. Ceccherini-Silberstein,
J. van Empel,
V. Erfle,
M. Neumann, and R. Brack-Werner.
1999.
Diminished Rev-mediated stimulation of human immunodeficiency virus type 1 protein synthesis is a hallmark of human astrocytes.
J. Virol.
73:8279-8289 |
| 36. |
Madani, N., and D. Kabat.
2000.
Cellular and viral specificities of human immunodeficiency virus type 1 Vif protein.
J. Virol.
74:5982-5987 |
| 37. |
Malim, M. H., and B. R. Cullen.
1991.
HIV-1 structural gene expression requires the binding of multiple Rev monomers to the viral Rre implications for HIV-1 latency.
Cell
65:241-248[CrossRef][Medline].
|
| 38. |
Mancebo, H. S. Y.,
G. Lee,
J. Flygare,
J. Tomassini,
P. Luu,
Y. R. Zhu,
J. M. Peng,
C. Blau,
D. Hazuda,
D. Price, and O. Flores.
1997.
P-TEFb kinase is required for HIV Tat transcriptional activation in vivo and in vitro.
Genes Dev.
11:2633-2644 |
| 39. |
Mariani, R.,
B. A. Rasala,
G. Rutter,
K. Wiegers,
S. M. Brandt,
H. G. Kräusslich, and N. R. Landau.
2001.
Mouse-human heterokaryons support efficient human immunodeficiency virus type 1 assembly.
J. Virol.
75:3141-3151 |
| 40. |
Mariani, R.,
G. Rutter,
M. E. Harris,
T. J. Hope,
H. G. Kräusslich, and N. R. Landau.
2000.
A block to human immunodeficiency virus type 1 assembly in murine cells.
J. Virol.
74:3859-3870 |
| 41. | Mizrachi, Y., A. Rubinstein, M. Golodner, K. Sakai, and D. J. Volsky. 1996. CD4 confers susceptibility to human immunodeficiency virus type 1 infection in a rat fibroblast cell line. AIDS Res. Hum. Retrovir. 12:1315-1318[Medline]. |
| 42. | Mizrachi, Y., L. Sternas, and D. J. Volsky. 1992. The establishment of rodent cell lines persistently producing HIV-1. Virology 186:167-174[CrossRef][Medline]. |
| 43. | Moore, J. P., A. Trkola, and T. Dragic. 1997. Co-receptors for HIV-1 entry. Curr. Opin. Immunol. 9:551-562[CrossRef][Medline]. |
| 44. |
Morrow, W. J.,
M. Wharton,
D. Lau, and J. A. Levy.
1987.
Small animals are not susceptible to human immunodeficiency virus infection.
J. Gen. Virol.
68:2253-2257 |
| 45. |
Murphy, K. M.,
M. J. Sweet,
I. L. Ross, and D. A. Hume.
1993.
Effects of the tat and nef gene products of human immunodeficiency virus type 1 (HIV-1) on transcription controlled by the HIV-1 long terminal repeat and on cell growth in macrophages.
J. Virol.
67:6956-6964 |
| 46. |
Orenstein, J.,
C. Fox, and S. Wahl.
1997.
Macrophages as a source of HIV during opportunistic infections.
Science
276:1857-1861 |
| 47. | Pollard, V. W., and M. H. Malim. 1998. The HIV-1 Rev protein. Annu. Rev. Microbiol. 52:491-532[CrossRef][Medline]. |
| 48. | Popik, W., and P. M. Pitha. 1998. Early activation of mitogen-activated protein kinase kinase, extracellular signal-regulated kinase, p38 mitogen-activated protein kinase, and c-Jun N-terminal kinase in response to binding of simian imm |