Previous Article | Next Article 
Journal of Virology, September 2001, p. 7811-7817, Vol. 75, No. 17
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.17.7811-7817.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
The Leader Protein of Theiler's Virus Inhibits
Immediate-Early Alpha/Beta Interferon Production
Vincent
van Pesch,
Olivier
van Eyll, and
Thomas
Michiels*
Christian de Duve Institute of Cellular
Pathology, University of Louvain, B-1200 Brussels, Belgium
Received 2 February 2001/Accepted 31 May 2001
 |
ABSTRACT |
Theiler's virus is a picornavirus responsible for a persistent
infection of the central nervous system of the mouse, leading to a
chronic demyelinating disease considered to be a model for multiple
sclerosis. The leader (L) protein encoded by Theiler's virus is a
76-amino-acid-long peptide containing a zinc-binding motif. This motif
is conserved in the L proteins of all cardioviruses, including
encephalomyocarditis virus. The L protein of Theiler's virus was
suggested to interfere with the alpha/beta interferon (IFN-
/
) response (W.-P. Kong, G. D. Ghadge, and R. P. Roos, Proc. Natl. Acad. Sci. USA 91:1796-1800, 1994). We show that
expression of the L protein indeed inhibits the production of
alpha/beta interferon by infected L929 cells. The L protein
specifically inhibits the transcription of the IFN-
4 and IFN-
genes, which are known to be activated early in response to viral
infection. Mutation of the zinc finger was sufficient to block the
anti-interferon activity, outlining the importance of this motif in the
L protein function. In agreement with the anti-interferon role of the L protein, a virus bearing a mutation in the zinc-binding motif was
dramatically impaired in its ability to persist in the central nervous
system of SJL/J mice.
 |
INTRODUCTION |
Theiler's murine encephalomyelitis
virus (TMEV) (or Theiler's virus), a member of the
Picornavirus family, is a naturally occurring enteric
pathogen of the mouse, responsible for central nervous system (CNS)
infections (32). The neurovirulent strains (GD7 and FA)
cause an acute lethal encephalomyelitis. The persistent strains (DA and
BeAn) induce a biphasic disease after intracerebral inoculation of
susceptible mice (18). After a mild encephalomyelitis lasting about 2 weeks, mice develop a chronic demyelinating disease, which serves as an experimental model of multiple sclerosis (for review, see references 8 and 25).
TMEV can be recovered from the spinal cord white matter
virtually lifelong, indicating that active viral replication occurs during persistence despite the host immune response. Viral persistence appears to be required to induce the chronic demyelinating disease, but
the exact mechanisms involved in persistence are still poorly understood. Among the viral determinants of persistence identified, the
capsid plays a crucial role, probably affecting the tropism of the
virus in the CNS (2, 11, 22). However, viral factors allowing the virus to escape the host immune response could also play a
pivotal role in establishing persistence.
Antagonism of the innate immune response mediated by alpha/beta
interferons (IFNs-
/
) is a common determinant of virulence (33). Indeed, IFNs-
/
are cytokines produced by most
cell types in response to viral infection. The antiviral action of IFNs
is mediated by the activation of proteins, such as protein kinase R
(PKR), the 2'-5'-oligodenylate synthetase, or the Mx proteins, known to
interfere with the viral cycle (29).
The genome of picornaviruses is translated as a long precursor
polyprotein that undergoes autoproteolytic cleavage to yield the mature
viral proteins. The leader (L) protein of TMEV is a 76-amino-acid-long
acidic protein corresponding to the N terminus of the viral
polyprotein. L contains a zinc-binding C-H-C-C motif critical for its
function in vitro (3, 14). In vivo, the L protein was
demonstrated to be essential for neurovirulence of the GDVII strain
(1).
In vitro, L is required for viral propagation in L929 cells but not in
BHK-21 cells. Since the latter cells are reportedly non-IFN responsive,
Kong et al. (14) postulated that the L protein could
antagonize the cell interferon response.
The purpose of this study was to test the anti-IFN role of the L
peptide and to examine its influence in establishing viral persistence.
We show that L inhibits IFN-
/
production and that it selectively
blocks the transcription of the immediate-early interferon genes (
4
and
) in L929 cells. The L protein is critical for persistence of
the DA1 virus in vivo.
 |
MATERIALS AND METHODS |
Construction of mutant viruses.
Site-directed mutagenesis
(16) was used to introduce three mutations in the region
coding for the zinc finger motif of the L peptide of the DA1 persistent
strain (Fig. 1) without affecting the
amino acid sequence of the L* protein encoded by an overlapping reading
frame (15). Mutagenesis was performed with oligonucleotide TM56 (5'-AAC GGC TGT GCG AAT AGT GCG CAC ATC TGG GT) on pTM410, a
plasmid carrying nucleotides (nt) 1 to 1729 of the DA1 virus. A
BssHII-BsiWI fragment (nt 665 to 1265 of DA1)
containing the mutations was sequenced to ensure that no unexpected
mutation occurred. This fragment was then cloned to replace the
corresponding region of plasmid pRS5 (24), yielding
plasmid pTM595. An XbaI-Van91I fragment (nt 1 to
2983 of DA1) of pTM595 was then used to replace the corresponding
fragment of pTM379, a pTMDA1 derivative carrying a large
BglII deletion in this region (nt 394 to 2432 of DA1). The
plasmid obtained, called pTM598, carries the full-length genome of DA1
with the three point mutations introduced in the zinc finger of the L
region (Lcys) (Table
1). The virus derived from this plasmid
is called TM598.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 1.
Mutations in the zinc-binding motif of the L protein.
Point mutations were introduced in codons 11, 12, and 14 of the
L-coding sequence of the DA1 and KJ6 viruses to produce the mutant
viruses called TM598 and TM659, respectively. Translation of the L
protein (Lwt) and of its mutant form, called
Lcys, is shown above the corresponding nucleotide sequence.
Nucleotides and amino acids that were mutated are underlined. The amino
acid sequence of the L* alternative ORF, shown under the nucleotide
sequence, was unaffected by the mutations.
|
|
The capsid coding region of pTM598, contained in a
BsiWI-
BamHI fragment (nt 1265 to 3925 of
DA1), was then replaced by the
corresponding region of pKJ6
(
12), a variant of pTMDA1 with
mutations in the capsid
coding region that enhance infection of
L929 cells. The recombinant
carrying the L
cys mutations and the capsid
adapted to L929 cells was called pTM659
(Table
1). The virus derived
from this plasmid is called
TM659.
pTM564 carries a 61-codon deletion (L
7-67)
affecting both the L and L* reading frames. The construction of this
plasmid was described
earlier (
24).
Cell culture and virus production.
BHK-21 cells were
cultured in Glasgow minimum essential medium (Gibco-BRL) supplemented
with 10% newborn bovine serum (Gibco-BRL), 100 IU of penicillin/ml,
100 µg of streptomycin/ml, and 130 g of tryptose phosphate broth
(Gibco-BRL)/liter. 2fTGH, U3A (23), BALB/3T3, and L929
cells were cultured in Dulbecco's modified Eagle medium (Gibco-BRL)
supplemented with 10% fetal bovine serum (Gibco-BRL), 100 IU of
penicillin/ml, 100 µg of streptomycin/ml, and 1 mM sodium pyruvate.
TMEV derivatives were produced by electroporation of BHK-21 cells
(24) with the genomic RNA transcribed in vitro from
plasmids carrying the corresponding cDNAs: pTMDA1 (21, 24), pKJ6 (12), pTM564 (24), pTM598,
and pTM659 (this work).
Culture supernatants were collected after completion of the cytopathic
effect (generally between 48 and 72 h after transfection).
The
culture supernatants were frozen, thawed, and centrifuged
at 4,000 ×
g for 15 min. The supernatants were then collected
and
stored in aliquots at

70°C. Viruses were titrated on BHK-21
cells
by standard plaque assay. The Mengo virus strain of
encephalomyocarditis
virus (EMCV) was produced in a similar way from
the pMC24 cDNA
clone (
9).
RNA extraction for dot blotting.
RNA was prepared from cells
or from mouse tissues (brain and spinal cord) by using the technique
described by Chomczynski and Sacchi (5). Dot blot
hybridization to measure viral RNA levels was performed as described
previously (24).
Inactivation of supernatants and estimation of IFN-
/
production.
The protocol established was inspired by that used by
Chinsangaram et al. (4). Culture supernatants from L929
cells infected for 48 h at a multiplicity of infection (MOI) of
0.2 PFU per cell were collected and centrifuged in a microtube at
15,000 × g for 3 min to remove cellular debris.
Supernatants were then brought to pH 2 with a 2 M hydrochloric acid
solution. After 24 h at 4°C, the pH was restored to 7 with a 2 M
sodium hydroxide solution. Inactivation of the virus in the pH
2-treated supernatant samples was checked by plaque assay on BHK-21
cells. Priming of L929 cells was usually done as follows: 5 × 104 to 1 × 105 cells
were incubated in a 24-well plate with 250 µl of pH 2-treated supernatant diluted two times in Dulbecco modified Eagle medium supplemented with 10% fetal calf serum. A series of supernatant samples were treated in parallel, with 80 U of a blocking anti-murine IFN-
/
polyclonal antibody (PBL Biomedical Laboratories) per ml
for half an hour at room temperature before priming. At 24 h after
priming, cells were infected with KJ6 at an MOI of 1 PFU per cell.
Various techniques were used to compare the extent of infection of
cells primed with the different pH 2-treated supernatants, including
plaque assay, dot blot hybridization, flow cytometry, or
immunocytochemistry. The latter techniques involved intracellular labeling of viral antigen with a monoclonal anti-VP1 antibody (F12B3).
IFN activity.
IFN activity was quantified by a plaque number
reduction assay. BALB/3T3 cells were seeded in six-well plates at a
density of 5 × 105 cells per well. After
24 h, cells were treated for 24 h with fourfold serial
dilutions of three independent pH 2-treated supernatants (that had been
kept frozen at
70°C) or with serial dilutions of reference mouse
IFN-
(PBL laboratories), which was itself calibrated against
reference IFN from the National Institutes of Health. Cells were then
infected for 1 h with a test virus (vesicular stomatitis virus
[VSV] or Mengo virus) and overlaid with 0.8% agarose in modified
Eagle medium (Gibco-BRL) for plaque assay. Results were confirmed by a
standard cytopathic effect reduction assay performed in 96-well plates
with the same cells and viruses.
RT-PCR.
For the detection of cytokine mRNA, total RNA was
extracted from cells by using the Microprep kit (Stratagene). As the
IFN genes are intronless, RNA samples (5 to 10 µg) were additionally treated with 20 U of fast-protein liquid chromatography-purified DNase
I (Amersham Pharmacia Biotech) prior to reverse transcriptase PCR
(RT-PCR), as previously described (28). RT-PCRs were
performed with and without RT in order to exclude genomic DNA
contamination. Conditions used for PCR are presented in Table
2. The sequences of the primers were from
reports by Shaw-Jackson and Michiels (28) for
-actin
and virus, by Chinsangaram et al. (4) for IFN-
,
IFN-
, and PKR, and by Deonarain et al. (6) for
IFN-
4 and IFN-non-
4. Note that 1 nucleotide was added to the
TM264 primer to increase melting temperature and specificity.
Primers sequences were as follows: TM4,
TTCCCTCCATCGCGACGTGGT; TM132, GTGCCATAGTAGCAAAAGCA; TM92, TGGCGCTTTTGACTCAGGAT;
TM93, AGCCCTGGCTGCCTCAAC; TM235,
ATGGCTAGRCTCTGTGCTTTCCT; TM236,
AGGGCTCTCCAGAYTTCTGCTCTG; TM237,
CATCAACTATAAGCAGCTCCA; TM238,
TTCAAGTGGAGAGCAGTTGAG; TM257, CGTTGTCACATCTACATTCAGTGGC; TM258, GGATTTTCCATCATTTT
CCAGGGC; TM263, CTGGTCAGCCTGTTCTCTAGGATGT; TM264,
TCAGAGGAGGTTCCTGCATCAC; TM265, ARSYTGTSTGATGCARCAGGT; TM266,
GGWACACAGTGATCCTGTGG.
Infection of mice.
Three-week-old female SJL/J mice (from
IFFA-CREDO) were inoculated intracranially in the right hemisphere with
40 µl of viral suspension containing 105 PFU of
the indicated virus. At 5 or 45 days postinfection, groups of four mice
were sacrificed and their viral loads in brain and spinal cord were
quantified by dot blot analysis. Note that some of the data for DA1-
and TM564-infected mice were reported previously (34).
 |
RESULTS |
Construction of L mutant viruses.
We constructed a DA1 mutant
(called TM598) by disrupting the zinc finger C-H-C-C motif of the TMEV
L protein (Lcys mutant) without altering the
amino acid sequence of the L* protein encoded by an alternative
overlapping open reading frame (Fig. 1). The same mutations were also
introduced in the KJ6 virus, which is a DA1 derivative carrying a
capsid adapted to L929 cells (12). The KJ6 derivative with
the Lcys mutation was called TM659 (Table 1). In
agreement with previous data (14), both the
Lcys and L
7-67 mutant viruses formed plaques
on BHK-21 cells comparable in size to plaques formed by the parental
viruses. On L929 cells, however, the mutants formed only minute to
undetectable plaques while parental viruses formed medium-sized plaques.
After a single cycle of L929 cell infection (14 h) at an MOI of 0.2 PFU
per cell, the yield of infectious virus was slightly
(2.4 times) higher
for the KJ6 virus than for the L
cys derivative
TM659 (7.5 ± 1.08 × 10
4 and 3.2 ± 0.85 × 10
4 PFU per ml,
respectively).
A soluble factor secreted by L929 cells is capable of restricting
viral propagation.
L929 cell monolayers were infected at an MOI of
0.1 PFU per cell with either the wild-type (DA1) or the
Lcys mutant (TM598) virus or with a 1:1 mixture
of the two viruses. Viral replication was assessed by dot blot
hybridization 24 and 48 h postinfection (Fig.
2).

View larger version (70K):
[in this window]
[in a new window]
|
FIG. 2.
Inhibition of viral propagation by a soluble factor. Dot
blot hybridization was performed to detect viral RNA in L929 cells
infected for 24 and 48 h with the wild-type virus (DA1), the
Lcys mutant (TM598) virus, or a 1:1 mixture of the two
viruses. A representative blot of three independent experiments is
shown.
|
|
As reported by Kong et al. (
14), viral replication of the
L-mutant virus was restricted in L929 cells compared to that of
the
wild-type virus. In the case of the mixed infection, the level
of viral
RNA was not higher than that in the case of the L mutant.
As
coinfection of cells by both viruses was unlikely due to the
low MOI
used, the results suggest that a soluble factor, such
as IFN-

/

,
secreted by TM598-infected cells rendered neighboring
cells resistant
to both wild-type and mutant virus
infection.
L protein inhibits IFN-
/
production in L929 cells.
In
order to confirm that the hypothetical soluble factor responsible for
restriction of virus propagation was indeed IFN-
/
, we compared
the amounts of IFN-
/
secreted by L929 cells infected with viruses
expressing the wild-type or the mutated L protein. The protocol (Fig.
3) that we followed to detect IFN-
/
took advantage of the following properties: (i) IFNs-
/
are known to be stable at pH 2 (30), (ii) conversely, TMEV is
inactivated at pH 2 (32), (iii) L929 cells are IFN
responsive, and priming by IFN-
/
induces an antiviral state in
these cells, and (iv) TMEV is inhibited by IFN-
/
(10). Viruses adapted to L929 cells were used in these
experiments to ensure efficient infection.

View larger version (9K):
[in this window]
[in a new window]
|
FIG. 3.
Strategy used to compare IFN production by wild-type and
Lcys virus-infected L929 cells. L929 cells monolayers were
infected with KJ6 or TM659 or were left uninfected. At 48 h after
infection, the culture supernatant was collected, brought to pH 2 for
24 h at 4°C, and then neutralized. A sample of the pH 2-treated
supernatant was subsequently treated with a neutralizing anti-mouse
IFN- / antibody. Conditioned supernatants were then used to prime
fresh L929 cell monolayers for 24 h, and the relative resistance
of primed cells to KJ6 virus infection was measured.
|
|
Supernatants from KJ6 (L
wt), TM659
(L
cys), or mock-infected cells were collected
48 h after infection. These supernatants were
then treated at pH 2 to inactivate the virus and then used to
prime L929 cells. Cells primed
with the various supernatants were
then infected by KJ6 to compare
their resistance to viral
infection.
As shown in Fig.
4A, priming of L929
cells with a supernatant from KJ6-infected cells did not protect cells
from subsequent
infection better than priming with a supernatant from
mock-infected
cells. This suggests that little or no IFN-

/

was
produced in
the supernatant of KJ6-infected cells in the conditions
used.
In contrast, priming of L929 cells with supernatants from
L-mutant-infected
cells strongly inhibited subsequent infection (about
an 80% reduction
in the number of infected cells).

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 4.
Inhibition of IFN- / production by L protein. The
graphics present the relative susceptibility to KJ6 of L929 cells
primed with pH 2-treated supernatants from KJ6-, TM659-, or
mock-infected L929 cells. The percentage of infected cells was
determined by immunocytochemistry. The graphs show the means and
standard deviations of experiments performed in triplicate, with three
independent supernatants used to prime cells. (A) Susceptibility of
cells primed with pH 2-treated supernatants. (B) As in panel A, except
that pH 2-treated supernatants were treated in parallel with a
neutralizing anti-IFN- / antibody prior to priming. (C)
Immunolabeling of viral antigen in KJ6-infected L929 cells primed with
supernatant from the Lcys TM659 mutant virus without (a) or
with (b) anti-IFN antibody treatment of the supernatant.
|
|
To confirm that the inhibition of viral infection was really due to the
presence of IFN-

/

in the pH 2-treated supernatants,
samples of pH
2-treated supernatants were treated in parallel
with an
anti-IFN-

/

antibody prior to cell priming. As shown
in Fig.
4B
and C, such a treatment completely abolished the antiviral
effect of
cell
priming.
The amount of IFN present in the supernatant of infected cells was
quantified using both VSV and the Mengo virus strain of
EMCV as
reporter viruses. In the conditions used (pH 2-treated
supernatants
collected 48 h after infection and stored frozen),
TM659-infected
cells consistently produced between 5 × 10
3
and 20 × 10
3 U of IFN per ml, protective
toward both VSV and Mengo virus infections.
No IFN activity (<100 U
per ml) could be demonstrated in the supernatant
of KJ6-infected
cells.
In conclusion, this experiment shows that the L peptide is capable of
inhibiting IFN-

/

production by L929 cells. Disruption
of the
zinc-binding motif of the protein is sufficient to block
this anti-IFN
activity.
Infection of STAT-1-deficient cells.
As IFN-
/
signaling
occurs through STAT-1 phosphorylation and translocation, we analyzed
whether L mutant viruses could replicate in STAT-1 deficient cells.
Therefore, we compared the infection of 2fTGH human fibroblasts and of
their STAT-1-deficient derivatives (U3A cells) by the DA1 and TM598
viruses. Infections were performed at 0.5 or 5 PFU per cell.
Replication was followed at different time points between 14 and
48 h by dot blot hybridization (Fig. 5). U3A cells appeared to be highly
susceptible to infection by both the wild-type and
Lcys viruses. In these cells, the difference of
replication between wild-type and mutant viruses was low (1.1 to 1.6 times higher for the wild type) while, in 2fTGH cells, the difference
was more pronounced (3.7 to 8 times higher for the wild type). This
observation nicely fits an anti-IFN role for L. One does not know at
this time whether the small but reproducible reduction of replication observed in U3A cells for the mutant virus reflects a
STAT-1-independent effect of the IFN pathway or an additional role for
the L protein.

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 5.
Infection of STAT-1-deficient cells. 2fTGH cells and
their STAT-1 / derivatives (U3A cells) were infected by
the wild-type virus (DA1) or the Lcys mutant virus (TM598)
at an MOI of 5 PFU per cell. At 24 h after infection, total RNA
was extracted from infected and mock-infected cells ( ) and viral
replication was measured by dot blot hybridization.
|
|
L protein selectively inhibits transcription of immediate-early IFN
genes.
In order to examine whether the inhibitory effect of the L
protein on the IFN-
/
production was due to transcriptional
repression, RT-PCRs were performed to compare IFN mRNA levels in cells
infected with the wild-type and mutant viruses. RNA was extracted from L929 cells infected for 7 h with KJ6 or TM659 at an MOI of 5 PFU per cell. At this MOI, the proportion of cells infected by the two
viruses was comparable (more than 95% of antigen-positive cells), as
measured by fluorescence-activated cell sorter analysis (not shown).
RT-PCR results (Fig.
6) showed a strong
inhibition of the transcription of IFN-

4 and IFN-

in KJ6-infected
cells 7 h after
infection. In contrast, in these cells, the mRNA
levels of total
IFN-

and of IFN-non-

4 were similar if not higher
than those
in cells infected with the mutant virus. This specific
inhibition
of IFN-

4 and IFN-

by the
L
wt-expressing virus was confirmed in a time
course experiment (1
to 7 h) (Fig.
7) and in several independent experiments
with samples
analyzed 12 and 24 h after infection at MOIs of 5 and
0.1 PFU/cell
(data not shown). No clear effect of the viral infection
was seen
on the level of PKR mRNA.

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 6.
Specific inhibition by the L protein of immediate-early
IFNs ( 4 and ). Total RNA was extracted from L929 cells infected
for 7 h with viruses expressing the wild-type L protein (KJ6) or
the Lcys mutant (TM659) or from mock-infected cells ( ).
RT-PCR was used to measure mRNA levels of total IFN- , IFN-non- 4,
IFN- 4, IFN- , and PKR. Viral RNA and -actin mRNA were amplified
as controls. PCR conditions used are shown in Table 1. Note the
strong inhibition of IFN- 4 and IFN- , but not of total IFN- , in
cells infected with the wild-type virus, producing the Lwt
protein.
|
|

View larger version (93K):
[in this window]
[in a new window]
|
FIG. 7.
Kinetics of IFN- 4 and IFN- inhibition. As
described in the legend to Fig. 6, except that samples were analyzed
from 1 to 7 h after infection to check whether inhibition was
already effective at early times of IFN induction.
|
|
L protein is essential for persistence of TMEV in CNS.
The L
peptide was previously shown to be essential for the neurovirulence of
the GDVII virus strain (1). We wanted to determine whether
L was also required for the pathogenesis of the persistent strain DA1.
We therefore assessed, by dot blot hybridization, the level of viral
persistence of wild-type DA1 and mutant TM598 (Lcys) and TM564 (L
7-67)
viruses in brains and spinal cords of SJL/J mice 5 and 45 days postinfection (Fig. 8).

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 8.
Mutation of the L protein zinc finger strongly affects
viral infection of the mouse CNS. (A) Viral RNA detected by dot blot
hybridization in the brain and spinal cord of mice infected in parallel
with viruses DA1, TM598, and TM564, for 5 and 45 days. Reprinted in
part from reference 34 with permission. (B) The levels of
viral RNA were quantified using a phosphorimager and are shown as
relative amounts of viral RNA per organ. The levels of -actin mRNA,
measured as a control, were highly homogenous among the samples. TM598
is the Lcys mutant of DA1. TM564 contains a 61-codon-long
deletion in the L ORF as well as in the overlapping L* ORF.
|
|
The 61-codon deletion of TM564 had a dramatic effect on viral
persistence, as this virus was not detected by RT-PCR of the
CNS of the
mouse 45 days after infection. However, it is noteworthy
that the
deletion present in the L region of the virus also affected
the L*
reading frame so that the lack of persistence cannot be
attributed
solely to the mutations in
L.
The mutation of L in TM598 also had a strong impact on virus
persistence. At 45 days postinoculation, the amount of
L
cys-mutant virus RNA in the spinal cord was 36 times lower than that
of the wild-type virus. Viral persistence was
severely but not
completely blocked at this time since viral RNA of the
L
cys mutant could still be detected by RT-PCR in
the spinal cord of
four out of four mice. Sequencing of the RT-PCR
products confirmed
the virus identity and showed that no revertants
were selected
during infection. The effect of the L protein
zinc-binding motif
disruption was already apparent 5 days postinfection
(fourfold
effect). This could indicate that a functional L peptide is
required
for efficient viral infection during the acute phase of the
disease
and is in agreement with the observed anti IFN-

/

role of
the
protein.
 |
DISCUSSION |
Inhibition of IFN-
/
by L peptide.
Kong et al.
(14) have observed that the L peptide of TMEV is required
for viral spread in L929 cells, but not in non-IFN-responsive BHK-21
cells. On the basis of these observations, they proposed that the L
protein could interfere with the host IFN response. Our results
establish that the L peptide indeed inhibits IFN-
/
production by
infected L929 cells, as supernatants of cells infected with a virus
expressing the wild-type L protein failed to prime naive cells for
viral resistance.
To analyze the level at which repression of IFN production occurred, we
performed RT-PCRs to monitor IFN mRNA levels in infected
cells. As soon
as 7 h after infection, we observed a strong inhibition
of the
transcription of the IFN-

4 and IFN-

genes in L929 cells
infected
with the KJ6 virus. This effect is strikingly selective
as the
transcription of IFN-non-

4 genes and that of the PKR gene
were not
decreased.
IFN-

4 and IFN-

are termed the immediate-early IFN genes, being
the first two subtypes synthesized following viral infection
(
6,
19,
20,
26). Several transcriptional activators have
been shown
to cooperate in forming an active enhanceosome at the
IFN-

promoter
(
35). These include IRF-3, NF-

B, and ATF/c-Jun,
which
are all activated by phosphorylation in the cytoplasm and
translocate
to the nucleus following viral infection. The immediate-early
IFNs are
subsequently secreted and act in a paracrine manner to
induce an
antiviral state in neighboring cells. They might also
act in an
autocrine fashion to induce the transcription of the
other IFN-
subtypes.
The selective inhibition of IFN-

4 and IFN-

observed in L929 cells
suggests that the L peptide targets a specific factor
involved in their
transcription, although at this stage we cannot
exclude the possibility
of a posttranscriptional effect. IRF-3
is an obvious candidate for
interaction with the L peptide, as
this factor is known to specifically
activate the transcription
of IFN-

and IFN-

4 (
13).
IRF-3 is constitutively present in
the cytoplasm of uninfected cells.
Viral infection triggers a
signaling cascade which leads to the
C-terminal phosphorylation
of IRF-3 (
27), enabling it to
homodimerize and to translocate
to the nucleus, where it cooperates
with CBP/p300 to activate
the transcription of the IFN genes (
17,
31,
36). Experiments
are in progress to determine whether the L
peptide interacts with
IRF-3.
It is intriguing to note that total IFN mRNA synthesis was activated in
KJ6-infected cells in spite of the represssion of
IFN-

and IFN-

4.
Indeed, in current murine models (
20,
26),
synthesis of
the late IFN-

subtypes depends on the transcriptional
induction of
IRF-7 by immediate-early IFNs. Since immediate-early
IFNs were
repressed here, one might postulate that, in this case,
transcription
of some late IFNs subtypes could occur independently
of IRF-7
activation.
L peptide is critical for viral persistence in vivo.
A virus
with mutations in the zinc-binding motif of the L peptide is severely
impaired in its ability to persist. The L peptide influences infection
in the early stages of the infection, as our data show a fourfold
reduction of viral RNA for the Lcys mutant virus
already 5 days postinfection. These data are in good agreement with
previous results from Calenoff et al. (1), who showed that
the L peptide is also important for the neurovirulence of the GDVII
strain. The fact that L is required early by TMEV in the CNS could be a
clue that it is important for the virus to counteract the innate host
immunity and, in particular, the IFN-
/
response.
It is clear, however, that IFN inhibition by L is not complete, as the
disruption of STAT-1 in U3A cells and of IFN-

/

receptor
in
knockout mice (
10) dramatically enhanced infection by the
wild-type virus (expressing L). This might reflect an inability
of the
virus to completely counteract a potent IFN response of
the host. On
the other hand, modulation rather than blockade of
the IFN response
might represent a better strategy to allow viral
persistence and favor
host-to-host transmission of the
virus.
Conservation of anti-IFN role of picornavirus L.
Although the
picornavirus genome organization is rather well conserved, only
cardioviruses and aphthoviruses express L. The L protein of
aphthoviruses is a protease responsible for host cell protein synthesis
shutoff through cleavage of eIF4G, a factor required for translation
initiation (7). This protein, which is unrelated to the L
protein of cardioviruses, was also found to have anti-IFN activity,
possibly through the inhibition of protein synthesis (4).
The
Cardiovirus genus includes TMEV and EMCV. As in the case
of aphthoviruses, the L protein of Mengo virus (an EMCV strain)
was
proposed to participate in host cell protein synthesis shutoff
and to
affect IFN-

/

production by infected cells (
37). The
L protein of EMCV and TMEV share about 35% of identical amino
acids.
In spite of this rather low identity, the zinc-binding
motif is
perfectly conserved in all the strains sequenced so far,
suggesting
some conserved roles for these proteins. We found that
IFN inhibition
by the L protein of TMEV was specific for immediate-early
IFN and thus
unlikely to result merely from host cell translational
shutoff. L
proteins of cardioviruses might thus interfere with
different signal
transduction pathways to induce translational
shutoff and
immediate-early IFN
inhibition.
 |
ACKNOWLEDGMENTS |
We are indebted to Daniel Gonzalez-Dunia and Sylvie Syan (Pasteur
Institute, Paris, France) for help with the interferon biological assay. We thank Eliane Meurs (Pasteur Institute, Paris, France) for the
gift of VSV and Ann Palmenberg (University of Wisconsin, Madison) for
the gift of pMC24. We thank Michel Brahic (Pasteur Institute, Paris,
France) for the F12B3 monoclonal antibody and for long-term
collaboration. We are grateful to Ian Kerr (Imperial Cancer Research
Fund, London, United Kingdom) and his team for rapid sending of 2fTGH
and U3A cells and to Francis Brasseur (Ludwig Institute for Cancer
Research, Brussels) for the gift of BALB/3T3 cells.
V.V.P. is a research assistant and T.M. is a senior research associate
with the FNRS (Belgian Fund for Scientific Research). O.V.E. is a
fellow of the Belgian FRIA (Fonds pour la Recherche dans l'Industrie
et l'Agriculture). This work was supported by convention 3.4573.94F of
the FRSM, by a crédit aux chercheurs 1.5.095.00 of the FNRS, by
the Charcot Foundation, and by the Fonds de Développement
Scientifique (FSR) of the University of Louvain.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Christian de
Duve Institute of Cellular Pathology, University of Louvain, MIPA-VIRO 74-49, 74, avenue Hippocrate, B-1200 Brussels, Belgium. Phone: 32 2 764 74 29. Fax: 32 2 764 74 95. E-mail:
michiels{at}mipa.ucl.ac.be.
 |
REFERENCES |
| 1.
|
Calenoff, M. A.,
C. S. Badshah,
M. C. Dal Canto,
H. L. Lipton, and M. K. Rundell.
1995.
The leader polypeptide of Theiler's virus is essential for neurovirulence but not for virus growth in BHK cells.
J. Virol.
69:5544-5549[Abstract].
|
| 2.
|
Calenoff, M. A.,
K. S. Faaberg, and H. L. Lipton.
1990.
Genomic regions of neurovirulence and attenuation in Theiler murine encephalomyelitis virus.
Proc. Natl. Acad. Sci. USA
87:978-982[Abstract/Free Full Text].
|
| 3.
|
Chen, H-H.,
W-P. Kong, and R. P. Roos.
1995.
The leader peptide of Theiler's murine encephalomyelitis virus is a zinc-binding protein.
J. Virol.
69:8076-8078[Abstract].
|
| 4.
|
Chinsangaram, J.,
M. E. Piccone, and M. J. Grubman.
1999.
Ability of foot-and-mouth disease virus to form plaques in cell culture is associated with suppression of alpha/beta interferon.
J. Virol.
73:9891-9898[Abstract/Free Full Text].
|
| 5.
|
Chomczynski, P., and N. Sacchi.
1987.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:156-159[Medline].
|
| 6.
|
Deonarain, R.,
A. Alcami,
M. Alexiou,
M. J. Dallman,
D. K. Gewert, and A. C. G. Porter.
2000.
Impaired antiviral response and alpha/beta interferon induction in mice lacking beta interferon.
J. Virol.
74:3404-3409[Abstract/Free Full Text].
|
| 7.
|
Devaney, M. A.,
V. N. Vakharia,
R. E. Lloyd,
E. Ehrenfeld, and M. J. Grubman.
1988.
Leader protein of foot-and-mouth disease virus is required for cleavage of the p220 component of the cap-binding protein complex.
J. Virol.
62:4407-4409[Abstract/Free Full Text].
|
| 8.
|
Drescher, K. M.,
L. R. Pease, and M. Rodriguez.
1997.
Antiviral immune responses modulate the nature of central nervous system (CNS) disease in a murine model of multiple sclerosis.
Immunol. Rev.
159:177-193[CrossRef][Medline].
|
| 9.
|
Duke, G. M., and A. G. Palmenberg.
1989.
Cloning and synthesis of infectious cardiovirus RNAs containing short, discrete poly(C) tracts.
J. Virol.
63:1822-1826[Abstract/Free Full Text].
|
| 10.
|
Fiette, L.,
C. Aubert,
U. Muller,
S. Huang,
M. Aguet,
M. Brahic, and J-F. Bureau.
1995.
Theiler's virus infection of 129Sv mice that lack the interferon alpha/beta or interferon gamma receptors.
J. Exp. Med.
181:2069-2076[Abstract/Free Full Text].
|
| 11.
|
Fu, J.,
S. Stein,
L. Rosenstein,
T. Bodwell,
M. Routbort,
B. L. Semler, and R. P. Roos.
1990.
Neurovirulence determinants of genetically engineered Theiler viruses.
Proc. Natl. Acad. Sci. USA
87:4125-4129[Abstract/Free Full Text].
|
| 12.
|
Jnaoui, K., and T. Michiels.
1998.
Adaptation of Theiler's virus to L929 cells: mutations in the putative receptor binding site on the capsid map to neutralization sites and modulate viral persistence.
Virology
244:397-404[CrossRef][Medline].
|
| 13.
|
Juang, Y. T.,
W. Lowther,
M. Kellum,
W. C. Au,
R. Lin,
J. Hiscott, and P. M. Pitha.
1998.
Primary activation of interferon A and interferon B gene transcription by interferon regulatory factor 3.
Proc. Natl. Acad. Sci. USA
95:9837-9842[Abstract/Free Full Text].
|
| 14.
|
Kong, W.-P.,
G. D. Ghadge, and R. P. Roos.
1994.
Involvement of cardiovirus leader in host cell-restricted virus expression.
Proc. Natl. Acad. Sci. USA
91:1796-1800[Abstract/Free Full Text].
|
| 15.
|
Kong, W.-P., and R. P. Roos.
1991.
Alternative translation initiation site in the DA strain of Theiler's murine encephalomyelitis virus.
J. Virol.
65:3395-3399[Abstract/Free Full Text].
|
| 16.
|
Kunkel, T. A.
1985.
Rapid and efficient site-specific mutagenesis without phenotypic selection.
Proc. Natl. Acad. Sci. USA
82:488-492[Abstract/Free Full Text].
|
| 17.
|
Lin, R.,
C. Heylbroeck,
P. M. Pitha, and J. Hiscott.
1998.
Virus-dependent phosphorylation of the IRF-3 transcription factor regulates nuclear translocation, transactivation potential, and proteasome-mediated degradation.
Mol. Cell. Biol.
18:2986-2996[Abstract/Free Full Text].
|
| 18.
|
Lipton, H. L.
1975.
Theiler's virus infection in mice: an unusual biphasic disease process leading to demyelination.
Infect. Immun.
11:1147-1155[Abstract/Free Full Text].
|
| 19.
|
Mamane, Y.,
C. Heylbroeck,
P. Génin,
M. Algarté,
M. J. Servant,
C. LePage,
C. DeLuca,
H. Kwon,
L. Rongtuan, and J. Hiscott.
1999.
Interferon regulatory factors: the next generation.
Gene
237:1-14[CrossRef][Medline].
|
| 20.
|
Marié, I.,
J. E. Durbin, and D. E. Levy.
1998.
Differential viral induction of distinct interferon- genes by positive feedback through interferon regulatory factor 7.
EMBO J.
17:6660-6669[CrossRef][Medline].
|
| 21.
|
McAllister, A.,
F. Tangy,
C. Aubert, and M. Brahic.
1989.
Molecular cloning of the complete genome of Theiler's virus, strain DA, and production of infectious transcripts.
Microb. Pathog.
7:381-388[CrossRef][Medline].
|
| 22.
|
McAllister, A.,
F. Tangy,
C. Aubert, and M. Brahic.
1990.
Genetic mapping of the ability of Theiler's virus to persist and demyelinate.
J. Virol.
64:4252-4257[Abstract/Free Full Text].
|
| 23.
|
McKendry, R.,
J. John,
D. Flavell,
M. Müller,
I. M. Kerr, and G. R. Stark.
1991.
High-frequency mutagenesis of human cells and characterization of a mutant unresponsive to both and interferons.
Proc. Natl. Acad. Sci. USA
88:11455-11459[Abstract/Free Full Text].
|
| 24.
|
Michiels, T.,
V. Dejong,
R. Rodrigus, and C. Shaw-Jackson.
1997.
Protein 2A is not required for Theiler's virus replication.
J. Virol.
71:9549-9556[Abstract].
|
| 25.
|
Monteyne, P.,
J.-F. Bureau, and M. Brahic.
1997.
The infection of mouse by Theiler's virus: from genetics to immunology.
Immunol. Rev.
159:163-176[CrossRef][Medline].
|
| 26.
|
Sato, M.,
H. Suemori,
N. Hata,
M. Asagiri,
K. Ogasawara,
O. K. Naka,
T. Nakaya,
M. Katsuki,
S. Noguchi,
N. Tanaka, and T. Taniguchi.
2000.
Distinct and essential roles of transcription factors IRF-3 and IRF-7 in response to viruses for IFN- / gene induction.
Immunity
13:539-548[CrossRef][Medline].
|
| 27.
|
Servant, M. J.,
B. ten Oever,
C. Le Page,
L. Conti,
S. Gessani,
I. Julkunen,
R. Lin, and J. Hiscott.
2001.
Identification of distinct signaling pathways leading to the phosphorylation of interferon regulatory factor 3.
J. Biol. Chem.
276:355-363[Abstract/Free Full Text].
|
| 28.
|
Shaw-Jackson, C., and T. Michiels.
1999.
Absence of internal ribosome entry site-mediated tissue specificity in the translation of a bicistronic transgene.
J. Virol.
73:2729-2738[Abstract/Free Full Text].
|
| 29.
|
Stark, G. R.,
I. M. Kerr,
B. R. G. Williams,
R. H. Silverman, and R. D. Schreiber.
1998.
How cells respond to interferons.
Annu. Rev. Biochem.
67:227-264[CrossRef][Medline].
|
| 30.
|
Stewart, W. E., II,
E. D. De Clercq, and P. De Somer.
1974.
Stabilization of interferons by "defensive" reversible denaturation.
Nature
249:460-461[CrossRef][Medline].
|
| 31.
|
Suhara, W.,
M. Yoneyama,
T. Iwamura,
S. Yoshimura,
K. Tamura,
H. Namiki,
S. Aimoto, and T. Fujita.
2000.
Analyses of virus-induced homomeric and heteromeric protein associations between IRF-3 and coactivator CBP/P300.
J. Biochem. (Tokyo)
128:301-307[Abstract/Free Full Text].
|
| 32.
|
Theiler, M., and S. Gard.
1940.
Encephalomyelitis of mice. I. Characteristics and pathogenesis of the virus.
J. Exp. Med.
72:49-67[Abstract].
|
| 33.
|
Tortorella, D.,
B. E. Gewurz,
M. H. Furman,
D. J. Schust, and H. L. Ploegh.
2000.
Viral subversion of the immune system.
Annu. Rev. Immunol.
18:861-926[CrossRef][Medline].
|
| 34.
|
van Eyll, O., and T. Michiels.
2000.
Influence of the Theiler's virus L* protein on macrophage infection, viral persistence and neurovirulence.
J. Virol.
74:9071-9077[Abstract/Free Full Text].
|
| 35.
|
Wathelet, M. G.,
C. H. Lin,
B. S. Parekh,
L. V. Ronco,
P. M. Howley, and T. Maniatis.
1998.
Virus infection induces the assembly of coordinately activated transcription factors on the IFN-beta enhancer in vitro.
Mol. Cell
3:507-518.
|
| 36.
|
Yoneyama, M.,
W. Suhara,
Y. Fukuhara,
M. Fukuda,
E. Nishida, and T. Fujita.
1998.
Direct triggering of the type I interferon system by virus infection: activation of a transcription factor complex containing IRF-3 and CBP/P300.
EMBO J.
17:1087-1095[CrossRef][Medline].
|
| 37.
|
Zoll, J.,
J. M. D. Galama,
F. J. M. van Kuppeveld, and W. J. G. Melchers.
1996.
Mengovirus leader is involved in the inhibition of host cell protein synthesis.
J. Virol.
70:4948-4952[Abstract/Free Full Text].
|
Journal of Virology, September 2001, p. 7811-7817, Vol. 75, No. 17
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.17.7811-7817.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Ricour, C., Borghese, F., Sorgeloos, F., Hato, S. V., van Kuppeveld, F. J. M., Michiels, T.
(2009). Random Mutagenesis Defines a Domain of Theiler's Virus Leader Protein That Is Essential for Antagonism of Nucleocytoplasmic Trafficking and Cytokine Gene Expression. J. Virol.
83: 11223-11232
[Abstract]
[Full Text]
-
Lidsky, P. V., Romanova, L. I., Kolesnikova, M. S., Bardina, M. V., Khitrina, E. V., Hato, S. V., van Kuppeveld, F. J. M., Agol, V. I.
(2009). Interactions between Viral and Prokaryotic Pathogens in a Mixed Infection with Cardiovirus and Mycoplasma. J. Virol.
83: 9940-9951
[Abstract]
[Full Text]
-
Romanova, L. I., Lidsky, P. V., Kolesnikova, M. S., Fominykh, K. V., Gmyl, A. P., Sheval, E. V., Hato, S. V., van Kuppeveld, F. J. M., Agol, V. I.
(2009). Antiapoptotic Activity of the Cardiovirus Leader Protein, a Viral "Security" Protein. J. Virol.
83: 7273-7284
[Abstract]
[Full Text]
-
Taniura, N., Saito, M., Okuwa, T., Saito, K., Ohara, Y.
(2009). Different Subcellular Localization of Theiler's Murine Encephalomyelitis Virus Leader Proteins of GDVII and DA Strains in BHK-21 Cells. J. Virol.
83: 6624-6630
[Abstract]
[Full Text]
-
Fan, J., Son, K.-N., Arslan, S. Y., Liang, Z., Lipton, H. L.
(2009). Theiler's Murine Encephalomyelitis Virus Leader Protein Is the Only Nonstructural Protein Tested That Induces Apoptosis When Transfected into Mammalian Cells. J. Virol.
83: 6546-6553
[Abstract]
[Full Text]
-
Blinkova, O., Kapoor, A., Victoria, J., Jones, M., Wolfe, N., Naeem, A., Shaukat, S., Sharif, S., Alam, M. M., Angez, M., Zaidi, S., Delwart, E. L.
(2009). Cardioviruses Are Genetically Diverse and Cause Common Enteric Infections in South Asian Children. J. Virol.
83: 4631-4641
[Abstract]
[Full Text]
-
Ricour, C., Delhaye, S., Hato, S. V., Olenyik, T. D., Michel, B., van Kuppeveld, F. J. M., Gustin, K. E., Michiels, T.
(2009). Inhibition of mRNA export and dimerization of interferon regulatory factor 3 by Theiler's virus leader protein. J. Gen. Virol.
90: 177-186
[Abstract]
[Full Text]
-
Frieman, M., Baric, R.
(2008). Mechanisms of Severe Acute Respiratory Syndrome Pathogenesis and Innate Immunomodulation. Microbiol. Mol. Biol. Rev.
72: 672-685
[Abstract]
[Full Text]
-
Baida, G., Popko, B., Wollmann, R. L., Stavrou, S., Lin, W., Tretiakova, M., Krausz, T. N., Roos, R. P.
(2008). A Subgenomic Segment of Theiler's Murine Encephalomyelitis Virus RNA Causes Demyelination. J. Virol.
82: 5879-5886
[Abstract]
[Full Text]
-
Myoung, J., Bahk, Y. Y., Kang, H. S., Dal Canto, M. C., Kim, B. S.
(2008). Anticapsid Immunity Level, Not Viral Persistence Level, Correlates with the Progression of Theiler's Virus-Induced Demyelinating Disease in Viral P1-Transgenic Mice. J. Virol.
82: 5606-5617
[Abstract]
[Full Text]
-
Randall, R. E., Goodbourn, S.
(2008). Interferons and viruses: an interplay between induction, signalling, antiviral responses and virus countermeasures. J. Gen. Virol.
89: 1-47
[Abstract]
[Full Text]
-
de los Santos, T., Diaz-San Segundo, F., Grubman, M. J.
(2007). Degradation of Nuclear Factor Kappa B during Foot-and-Mouth Disease Virus Infection. J. Virol.
81: 12803-12815
[Abstract]
[Full Text]
-
Jin, Y.-H., Mohindru, M., Kang, M. H., Fuller, A. C., Kang, B., Gallo, D., Kim, B. S.
(2007). Differential Virus Replication, Cytokine Production, and Antigen-Presenting Function by Microglia from Susceptible and Resistant Mice Infected with Theiler's Virus. J. Virol.
81: 11690-11702
[Abstract]
[Full Text]
-
Asakura, K., Murayama, H., Himeda, T., Ohara, Y.
(2007). Expression of L* protein of Theiler's murine encephalomyelitis virus in the chronic phase of infection. J. Gen. Virol.
88: 2268-2274
[Abstract]
[Full Text]
-
Takano-Maruyama, M., Ohara, Y., Asakura, K., Okuwa, T.
(2006). Theiler's Murine Encephalomyelitis Virus Leader Protein Amino Acid Residue 57 Regulates Subgroup-Specific Virus Growth on BHK-21 Cells. J. Virol.
80: 12025-12031
[Abstract]
[Full Text]
-
Versteeg, G. A., Slobodskaya, O., Spaan, W. J. M.
(2006). Transcriptional profiling of acute cytopathic murine hepatitis virus infection in fibroblast-like cells. J. Gen. Virol.
87: 1961-1975
[Abstract]
[Full Text]
-
Delhaye, S., Paul, S., Blakqori, G., Minet, M., Weber, F., Staeheli, P., Michiels, T.
(2006). Neurons produce type I interferon during viral encephalitis. Proc. Natl. Acad. Sci. USA
103: 7835-7840
[Abstract]
[Full Text]
-
Paul, S., Michiels, T.
(2006). Cardiovirus leader proteins are functionally interchangeable and have evolved to adapt to virus replication fitness.. J. Gen. Virol.
87: 1237-1246
[Abstract]
[Full Text]
-
de los Santos, T., de Avila Botton, S., Weiblen, R., Grubman, M. J.
(2006). The Leader Proteinase of Foot-and-Mouth Disease Virus Inhibits the Induction of Beta Interferon mRNA and Blocks the Host Innate Immune Response. J. Virol.
80: 1906-1914
[Abstract]
[Full Text]
-
Gil, L. H. V. G., Ansari, I. H., Vassilev, V., Liang, D., Lai, V. C. H., Zhong, W., Hong, Z., Dubovi, E. J., Donis, R. O.
(2006). The Amino-Terminal Domain of Bovine Viral Diarrhea Virus Npro Protein Is Necessary for Alpha/Beta Interferon Antagonism. J. Virol.
80: 900-911
[Abstract]
[Full Text]
-
Peng, W., Henderson, G., Inman, M., BenMohamed, L., Perng, G.-C., Wechsler, S. L., Jones, C.
(2005). The Locus Encompassing the Latency-Associated Transcript of Herpes Simplex Virus Type 1 Interferes with and Delays Interferon Expression in Productively Infected Neuroblastoma Cells and Trigeminal Ganglia of Acutely Infected Mice. J. Virol.
79: 6162-6171
[Abstract]
[Full Text]
-
Spiegel, M., Pichlmair, A., Martinez-Sobrido, L., Cros, J., Garcia-Sastre, A., Haller, O., Weber, F.
(2005). Inhibition of Beta Interferon Induction by Severe Acute Respiratory Syndrome Coronavirus Suggests a Two-Step Model for Activation of Interferon Regulatory Factor 3. J. Virol.
79: 2079-2086
[Abstract]
[Full Text]
-
Mena, I., Roussarie, J.-P., Brahic, M.
(2004). Infection of Macrophage Primary Cultures by Persistent and Nonpersistent Strains of Theiler's Virus: Role of Capsid and Noncapsid Viral Determinants. J. Virol.
78: 13356-13361
[Abstract]
[Full Text]
-
van Pesch, V., Lanaya, H., Renauld, J.-C., Michiels, T.
(2004). Characterization of the Murine Alpha Interferon Gene Family. J. Virol.
78: 8219-8228
[Abstract]
[Full Text]
-
Delhaye, S., van Pesch, V., Michiels, T.
(2004). The Leader Protein of Theiler's Virus Interferes with Nucleocytoplasmic Trafficking of Cellular Proteins. J. Virol.
78: 4357-4362
[Abstract]
[Full Text]
-
van Pesch, V., Michiels, T.
(2003). Characterization of Interferon-{alpha} 13, a Novel Constitutive Murine Interferon-{alpha} Subtype. J. Biol. Chem.
278: 46321-46328
[Abstract]
[Full Text]
-
Sasaki, J., Nagashima, S., Taniguchi, K.
(2003). Aichi Virus Leader Protein Is Involved in Viral RNA Replication and Encapsidation. J. Virol.
77: 10799-10807
[Abstract]
[Full Text]
-
Hinton, T. M., Ross-Smith, N., Warner, S., Belsham, G. J., Crabb, B. S.
(2002). Conservation of L and 3C proteinase activities across distantly related aphthoviruses. J. Gen. Virol.
83: 3111-3121
[Abstract]
[Full Text]
-
van Eyll, O., Michiels, T.
(2002). Non-AUG-Initiated Internal Translation of the L* Protein of Theiler's Virus and Importance of This Protein for Viral Persistence. J. Virol.
76: 10665-10673
[Abstract]
[Full Text]
-
Zoll, J., Melchers, W. J. G., Galama, J. M. D., van Kuppeveld, F. J. M.
(2002). The Mengovirus Leader Protein Suppresses Alpha/Beta Interferon Production by Inhibition of the Iron/Ferritin-Mediated Activation of NF-{kappa}B. J. Virol.
76: 9664-9672
[Abstract]
[Full Text]
-
Barnes, B. J., Kellum, M. J., Field, A. E., Pitha, P. M.
(2002). Multiple Regulatory Domains of IRF-5 Control Activation, Cellular Localization, and Induction of Chemokines That Mediate Recruitment of T Lymphocytes. Mol. Cell. Biol.
22: 5721-5740
[Abstract]
[Full Text]