This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van Pesch, V.
Right arrow Articles by Michiels, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van Pesch, V.
Right arrow Articles by Michiels, T.

 Previous Article  |  Next Article 

Journal of Virology, September 2001, p. 7811-7817, Vol. 75, No. 17
0022-538X/01/$04.00+0   DOI: 10.1128/JVI.75.17.7811-7817.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.

The Leader Protein of Theiler's Virus Inhibits Immediate-Early Alpha/Beta Interferon Production

Vincent van Pesch, Olivier van Eyll, and Thomas Michiels*

Christian de Duve Institute of Cellular Pathology, University of Louvain, B-1200 Brussels, Belgium

Received 2 February 2001/Accepted 31 May 2001


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Theiler's virus is a picornavirus responsible for a persistent infection of the central nervous system of the mouse, leading to a chronic demyelinating disease considered to be a model for multiple sclerosis. The leader (L) protein encoded by Theiler's virus is a 76-amino-acid-long peptide containing a zinc-binding motif. This motif is conserved in the L proteins of all cardioviruses, including encephalomyocarditis virus. The L protein of Theiler's virus was suggested to interfere with the alpha/beta interferon (IFN-alpha /beta ) response (W.-P. Kong, G. D. Ghadge, and R. P. Roos, Proc. Natl. Acad. Sci. USA 91:1796-1800, 1994). We show that expression of the L protein indeed inhibits the production of alpha/beta interferon by infected L929 cells. The L protein specifically inhibits the transcription of the IFN-alpha 4 and IFN-beta genes, which are known to be activated early in response to viral infection. Mutation of the zinc finger was sufficient to block the anti-interferon activity, outlining the importance of this motif in the L protein function. In agreement with the anti-interferon role of the L protein, a virus bearing a mutation in the zinc-binding motif was dramatically impaired in its ability to persist in the central nervous system of SJL/J mice.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Theiler's murine encephalomyelitis virus (TMEV) (or Theiler's virus), a member of the Picornavirus family, is a naturally occurring enteric pathogen of the mouse, responsible for central nervous system (CNS) infections (32). The neurovirulent strains (GD7 and FA) cause an acute lethal encephalomyelitis. The persistent strains (DA and BeAn) induce a biphasic disease after intracerebral inoculation of susceptible mice (18). After a mild encephalomyelitis lasting about 2 weeks, mice develop a chronic demyelinating disease, which serves as an experimental model of multiple sclerosis (for review, see references 8 and 25).

TMEV can be recovered from the spinal cord white matter virtually lifelong, indicating that active viral replication occurs during persistence despite the host immune response. Viral persistence appears to be required to induce the chronic demyelinating disease, but the exact mechanisms involved in persistence are still poorly understood. Among the viral determinants of persistence identified, the capsid plays a crucial role, probably affecting the tropism of the virus in the CNS (2, 11, 22). However, viral factors allowing the virus to escape the host immune response could also play a pivotal role in establishing persistence.

Antagonism of the innate immune response mediated by alpha/beta interferons (IFNs-alpha /beta ) is a common determinant of virulence (33). Indeed, IFNs-alpha /beta are cytokines produced by most cell types in response to viral infection. The antiviral action of IFNs is mediated by the activation of proteins, such as protein kinase R (PKR), the 2'-5'-oligodenylate synthetase, or the Mx proteins, known to interfere with the viral cycle (29).

The genome of picornaviruses is translated as a long precursor polyprotein that undergoes autoproteolytic cleavage to yield the mature viral proteins. The leader (L) protein of TMEV is a 76-amino-acid-long acidic protein corresponding to the N terminus of the viral polyprotein. L contains a zinc-binding C-H-C-C motif critical for its function in vitro (3, 14). In vivo, the L protein was demonstrated to be essential for neurovirulence of the GDVII strain (1).

In vitro, L is required for viral propagation in L929 cells but not in BHK-21 cells. Since the latter cells are reportedly non-IFN responsive, Kong et al. (14) postulated that the L protein could antagonize the cell interferon response.

The purpose of this study was to test the anti-IFN role of the L peptide and to examine its influence in establishing viral persistence. We show that L inhibits IFN-alpha /beta production and that it selectively blocks the transcription of the immediate-early interferon genes (alpha 4 and beta ) in L929 cells. The L protein is critical for persistence of the DA1 virus in vivo.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Construction of mutant viruses. Site-directed mutagenesis (16) was used to introduce three mutations in the region coding for the zinc finger motif of the L peptide of the DA1 persistent strain (Fig. 1) without affecting the amino acid sequence of the L* protein encoded by an overlapping reading frame (15). Mutagenesis was performed with oligonucleotide TM56 (5'-AAC GGC TGT GCG AAT AGT GCG CAC ATC TGG GT) on pTM410, a plasmid carrying nucleotides (nt) 1 to 1729 of the DA1 virus. A BssHII-BsiWI fragment (nt 665 to 1265 of DA1) containing the mutations was sequenced to ensure that no unexpected mutation occurred. This fragment was then cloned to replace the corresponding region of plasmid pRS5 (24), yielding plasmid pTM595. An XbaI-Van91I fragment (nt 1 to 2983 of DA1) of pTM595 was then used to replace the corresponding fragment of pTM379, a pTMDA1 derivative carrying a large BglII deletion in this region (nt 394 to 2432 of DA1). The plasmid obtained, called pTM598, carries the full-length genome of DA1 with the three point mutations introduced in the zinc finger of the L region (Lcys) (Table 1). The virus derived from this plasmid is called TM598.


View larger version (24K):
[in this window]
[in a new window]
 
FIG. 1.   Mutations in the zinc-binding motif of the L protein. Point mutations were introduced in codons 11, 12, and 14 of the L-coding sequence of the DA1 and KJ6 viruses to produce the mutant viruses called TM598 and TM659, respectively. Translation of the L protein (Lwt) and of its mutant form, called Lcys, is shown above the corresponding nucleotide sequence. Nucleotides and amino acids that were mutated are underlined. The amino acid sequence of the L* alternative ORF, shown under the nucleotide sequence, was unaffected by the mutations.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Viruses used in the experiments

The capsid coding region of pTM598, contained in a BsiWI-BamHI fragment (nt 1265 to 3925 of DA1), was then replaced by the corresponding region of pKJ6 (12), a variant of pTMDA1 with mutations in the capsid coding region that enhance infection of L929 cells. The recombinant carrying the Lcys mutations and the capsid adapted to L929 cells was called pTM659 (Table 1). The virus derived from this plasmid is called TM659.

pTM564 carries a 61-codon deletion (LDelta 7-67) affecting both the L and L* reading frames. The construction of this plasmid was described earlier (24).

Cell culture and virus production. BHK-21 cells were cultured in Glasgow minimum essential medium (Gibco-BRL) supplemented with 10% newborn bovine serum (Gibco-BRL), 100 IU of penicillin/ml, 100 µg of streptomycin/ml, and 130 g of tryptose phosphate broth (Gibco-BRL)/liter. 2fTGH, U3A (23), BALB/3T3, and L929 cells were cultured in Dulbecco's modified Eagle medium (Gibco-BRL) supplemented with 10% fetal bovine serum (Gibco-BRL), 100 IU of penicillin/ml, 100 µg of streptomycin/ml, and 1 mM sodium pyruvate. TMEV derivatives were produced by electroporation of BHK-21 cells (24) with the genomic RNA transcribed in vitro from plasmids carrying the corresponding cDNAs: pTMDA1 (21, 24), pKJ6 (12), pTM564 (24), pTM598, and pTM659 (this work).

Culture supernatants were collected after completion of the cytopathic effect (generally between 48 and 72 h after transfection). The culture supernatants were frozen, thawed, and centrifuged at 4,000 × g for 15 min. The supernatants were then collected and stored in aliquots at -70°C. Viruses were titrated on BHK-21 cells by standard plaque assay. The Mengo virus strain of encephalomyocarditis virus (EMCV) was produced in a similar way from the pMC24 cDNA clone (9).

RNA extraction for dot blotting. RNA was prepared from cells or from mouse tissues (brain and spinal cord) by using the technique described by Chomczynski and Sacchi (5). Dot blot hybridization to measure viral RNA levels was performed as described previously (24).

Inactivation of supernatants and estimation of IFN-alpha /beta production. The protocol established was inspired by that used by Chinsangaram et al. (4). Culture supernatants from L929 cells infected for 48 h at a multiplicity of infection (MOI) of 0.2 PFU per cell were collected and centrifuged in a microtube at 15,000 × g for 3 min to remove cellular debris. Supernatants were then brought to pH 2 with a 2 M hydrochloric acid solution. After 24 h at 4°C, the pH was restored to 7 with a 2 M sodium hydroxide solution. Inactivation of the virus in the pH 2-treated supernatant samples was checked by plaque assay on BHK-21 cells. Priming of L929 cells was usually done as follows: 5 × 104 to 1 × 105 cells were incubated in a 24-well plate with 250 µl of pH 2-treated supernatant diluted two times in Dulbecco modified Eagle medium supplemented with 10% fetal calf serum. A series of supernatant samples were treated in parallel, with 80 U of a blocking anti-murine IFN-alpha /beta polyclonal antibody (PBL Biomedical Laboratories) per ml for half an hour at room temperature before priming. At 24 h after priming, cells were infected with KJ6 at an MOI of 1 PFU per cell. Various techniques were used to compare the extent of infection of cells primed with the different pH 2-treated supernatants, including plaque assay, dot blot hybridization, flow cytometry, or immunocytochemistry. The latter techniques involved intracellular labeling of viral antigen with a monoclonal anti-VP1 antibody (F12B3).

IFN activity. IFN activity was quantified by a plaque number reduction assay. BALB/3T3 cells were seeded in six-well plates at a density of 5 × 105 cells per well. After 24 h, cells were treated for 24 h with fourfold serial dilutions of three independent pH 2-treated supernatants (that had been kept frozen at -70°C) or with serial dilutions of reference mouse IFN-beta (PBL laboratories), which was itself calibrated against reference IFN from the National Institutes of Health. Cells were then infected for 1 h with a test virus (vesicular stomatitis virus [VSV] or Mengo virus) and overlaid with 0.8% agarose in modified Eagle medium (Gibco-BRL) for plaque assay. Results were confirmed by a standard cytopathic effect reduction assay performed in 96-well plates with the same cells and viruses.

RT-PCR. For the detection of cytokine mRNA, total RNA was extracted from cells by using the Microprep kit (Stratagene). As the IFN genes are intronless, RNA samples (5 to 10 µg) were additionally treated with 20 U of fast-protein liquid chromatography-purified DNase I (Amersham Pharmacia Biotech) prior to reverse transcriptase PCR (RT-PCR), as previously described (28). RT-PCRs were performed with and without RT in order to exclude genomic DNA contamination. Conditions used for PCR are presented in Table 2. The sequences of the primers were from reports by Shaw-Jackson and Michiels (28) for beta -actin and virus, by Chinsangaram et al. (4) for IFN-alpha , IFN-beta , and PKR, and by Deonarain et al. (6) for IFN-alpha 4 and IFN-non-alpha 4. Note that 1 nucleotide was added to the TM264 primer to increase melting temperature and specificity. Primers sequences were as follows: TM4, TTCCCTCCATCGCGACGTGGT; TM132, GTGCCATAGTAGCAAAAGCA; TM92, TGGCGCTTTTGACTCAGGAT; TM93, AGCCCTGGCTGCCTCAAC; TM235, ATGGCTAGRCTCTGTGCTTTCCT; TM236, AGGGCTCTCCAGAYTTCTGCTCTG; TM237, CATCAACTATAAGCAGCTCCA; TM238, TTCAAGTGGAGAGCAGTTGAG; TM257, CGTTGTCACATCTACATTCAGTGGC; TM258, GGATTTTCCATCATTTT CCAGGGC; TM263, CTGGTCAGCCTGTTCTCTAGGATGT; TM264, TCAGAGGAGGTTCCTGCATCAC; TM265, ARSYTGTSTGATGCARCAGGT; TM266, GGWACACAGTGATCCTGTGG.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 2.   Primers and PCR conditions

Infection of mice. Three-week-old female SJL/J mice (from IFFA-CREDO) were inoculated intracranially in the right hemisphere with 40 µl of viral suspension containing 105 PFU of the indicated virus. At 5 or 45 days postinfection, groups of four mice were sacrificed and their viral loads in brain and spinal cord were quantified by dot blot analysis. Note that some of the data for DA1- and TM564-infected mice were reported previously (34).


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Construction of L mutant viruses. We constructed a DA1 mutant (called TM598) by disrupting the zinc finger C-H-C-C motif of the TMEV L protein (Lcys mutant) without altering the amino acid sequence of the L* protein encoded by an alternative overlapping open reading frame (Fig. 1). The same mutations were also introduced in the KJ6 virus, which is a DA1 derivative carrying a capsid adapted to L929 cells (12). The KJ6 derivative with the Lcys mutation was called TM659 (Table 1). In agreement with previous data (14), both the Lcys and LDelta 7-67 mutant viruses formed plaques on BHK-21 cells comparable in size to plaques formed by the parental viruses. On L929 cells, however, the mutants formed only minute to undetectable plaques while parental viruses formed medium-sized plaques.

After a single cycle of L929 cell infection (14 h) at an MOI of 0.2 PFU per cell, the yield of infectious virus was slightly (2.4 times) higher for the KJ6 virus than for the Lcys derivative TM659 (7.5 ± 1.08 × 104 and 3.2 ± 0.85 × 104 PFU per ml, respectively).

A soluble factor secreted by L929 cells is capable of restricting viral propagation. L929 cell monolayers were infected at an MOI of 0.1 PFU per cell with either the wild-type (DA1) or the Lcys mutant (TM598) virus or with a 1:1 mixture of the two viruses. Viral replication was assessed by dot blot hybridization 24 and 48 h postinfection (Fig. 2).


View larger version (70K):
[in this window]
[in a new window]
 
FIG. 2.   Inhibition of viral propagation by a soluble factor. Dot blot hybridization was performed to detect viral RNA in L929 cells infected for 24 and 48 h with the wild-type virus (DA1), the Lcys mutant (TM598) virus, or a 1:1 mixture of the two viruses. A representative blot of three independent experiments is shown.

As reported by Kong et al. (14), viral replication of the L-mutant virus was restricted in L929 cells compared to that of the wild-type virus. In the case of the mixed infection, the level of viral RNA was not higher than that in the case of the L mutant. As coinfection of cells by both viruses was unlikely due to the low MOI used, the results suggest that a soluble factor, such as IFN-alpha /beta , secreted by TM598-infected cells rendered neighboring cells resistant to both wild-type and mutant virus infection.

L protein inhibits IFN-alpha /beta production in L929 cells. In order to confirm that the hypothetical soluble factor responsible for restriction of virus propagation was indeed IFN-alpha /beta , we compared the amounts of IFN-alpha /beta secreted by L929 cells infected with viruses expressing the wild-type or the mutated L protein. The protocol (Fig. 3) that we followed to detect IFN-alpha /beta took advantage of the following properties: (i) IFNs-alpha /beta are known to be stable at pH 2 (30), (ii) conversely, TMEV is inactivated at pH 2 (32), (iii) L929 cells are IFN responsive, and priming by IFN-alpha /beta induces an antiviral state in these cells, and (iv) TMEV is inhibited by IFN-alpha /beta (10). Viruses adapted to L929 cells were used in these experiments to ensure efficient infection.


View larger version (9K):
[in this window]
[in a new window]
 
FIG. 3.   Strategy used to compare IFN production by wild-type and Lcys virus-infected L929 cells. L929 cells monolayers were infected with KJ6 or TM659 or were left uninfected. At 48 h after infection, the culture supernatant was collected, brought to pH 2 for 24 h at 4°C, and then neutralized. A sample of the pH 2-treated supernatant was subsequently treated with a neutralizing anti-mouse IFN-alpha /beta antibody. Conditioned supernatants were then used to prime fresh L929 cell monolayers for 24 h, and the relative resistance of primed cells to KJ6 virus infection was measured.

Supernatants from KJ6 (Lwt), TM659 (Lcys), or mock-infected cells were collected 48 h after infection. These supernatants were then treated at pH 2 to inactivate the virus and then used to prime L929 cells. Cells primed with the various supernatants were then infected by KJ6 to compare their resistance to viral infection.

As shown in Fig. 4A, priming of L929 cells with a supernatant from KJ6-infected cells did not protect cells from subsequent infection better than priming with a supernatant from mock-infected cells. This suggests that little or no IFN-alpha /beta was produced in the supernatant of KJ6-infected cells in the conditions used. In contrast, priming of L929 cells with supernatants from L-mutant-infected cells strongly inhibited subsequent infection (about an 80% reduction in the number of infected cells).


View larger version (34K):
[in this window]
[in a new window]
 
FIG. 4.   Inhibition of IFN-alpha /beta production by L protein. The graphics present the relative susceptibility to KJ6 of L929 cells primed with pH 2-treated supernatants from KJ6-, TM659-, or mock-infected L929 cells. The percentage of infected cells was determined by immunocytochemistry. The graphs show the means and standard deviations of experiments performed in triplicate, with three independent supernatants used to prime cells. (A) Susceptibility of cells primed with pH 2-treated supernatants. (B) As in panel A, except that pH 2-treated supernatants were treated in parallel with a neutralizing anti-IFN-alpha /beta antibody prior to priming. (C) Immunolabeling of viral antigen in KJ6-infected L929 cells primed with supernatant from the Lcys TM659 mutant virus without (a) or with (b) anti-IFN antibody treatment of the supernatant.

To confirm that the inhibition of viral infection was really due to the presence of IFN-alpha /beta in the pH 2-treated supernatants, samples of pH 2-treated supernatants were treated in parallel with an anti-IFN-alpha /beta antibody prior to cell priming. As shown in Fig. 4B and C, such a treatment completely abolished the antiviral effect of cell priming.

The amount of IFN present in the supernatant of infected cells was quantified using both VSV and the Mengo virus strain of EMCV as reporter viruses. In the conditions used (pH 2-treated supernatants collected 48 h after infection and stored frozen), TM659-infected cells consistently produced between 5 × 103 and 20 × 103 U of IFN per ml, protective toward both VSV and Mengo virus infections. No IFN activity (<100 U per ml) could be demonstrated in the supernatant of KJ6-infected cells.

In conclusion, this experiment shows that the L peptide is capable of inhibiting IFN-alpha /beta production by L929 cells. Disruption of the zinc-binding motif of the protein is sufficient to block this anti-IFN activity.

Infection of STAT-1-deficient cells. As IFN-alpha /beta signaling occurs through STAT-1 phosphorylation and translocation, we analyzed whether L mutant viruses could replicate in STAT-1 deficient cells. Therefore, we compared the infection of 2fTGH human fibroblasts and of their STAT-1-deficient derivatives (U3A cells) by the DA1 and TM598 viruses. Infections were performed at 0.5 or 5 PFU per cell. Replication was followed at different time points between 14 and 48 h by dot blot hybridization (Fig. 5). U3A cells appeared to be highly susceptible to infection by both the wild-type and Lcys viruses. In these cells, the difference of replication between wild-type and mutant viruses was low (1.1 to 1.6 times higher for the wild type) while, in 2fTGH cells, the difference was more pronounced (3.7 to 8 times higher for the wild type). This observation nicely fits an anti-IFN role for L. One does not know at this time whether the small but reproducible reduction of replication observed in U3A cells for the mutant virus reflects a STAT-1-independent effect of the IFN pathway or an additional role for the L protein.


View larger version (64K):
[in this window]
[in a new window]
 
FIG. 5.   Infection of STAT-1-deficient cells. 2fTGH cells and their STAT-1-/- derivatives (U3A cells) were infected by the wild-type virus (DA1) or the Lcys mutant virus (TM598) at an MOI of 5 PFU per cell. At 24 h after infection, total RNA was extracted from infected and mock-infected cells (-) and viral replication was measured by dot blot hybridization.

L protein selectively inhibits transcription of immediate-early IFN genes. In order to examine whether the inhibitory effect of the L protein on the IFN-alpha /beta production was due to transcriptional repression, RT-PCRs were performed to compare IFN mRNA levels in cells infected with the wild-type and mutant viruses. RNA was extracted from L929 cells infected for 7 h with KJ6 or TM659 at an MOI of 5 PFU per cell. At this MOI, the proportion of cells infected by the two viruses was comparable (more than 95% of antigen-positive cells), as measured by fluorescence-activated cell sorter analysis (not shown).

RT-PCR results (Fig. 6) showed a strong inhibition of the transcription of IFN-alpha 4 and IFN-beta in KJ6-infected cells 7 h after infection. In contrast, in these cells, the mRNA levels of total IFN-alpha and of IFN-non-alpha 4 were similar if not higher than those in cells infected with the mutant virus. This specific inhibition of IFN-alpha 4 and IFN-beta by the Lwt-expressing virus was confirmed in a time course experiment (1 to 7 h) (Fig. 7) and in several independent experiments with samples analyzed 12 and 24 h after infection at MOIs of 5 and 0.1 PFU/cell (data not shown). No clear effect of the viral infection was seen on the level of PKR mRNA.


View larger version (61K):
[in this window]
[in a new window]
 
FIG. 6.   Specific inhibition by the L protein of immediate-early IFNs (alpha 4 and beta ). Total RNA was extracted from L929 cells infected for 7 h with viruses expressing the wild-type L protein (KJ6) or the Lcys mutant (TM659) or from mock-infected cells (-). RT-PCR was used to measure mRNA levels of total IFN-alpha , IFN-non-alpha 4, IFN-alpha 4, IFN-beta , and PKR. Viral RNA and beta -actin mRNA were amplified as controls. PCR conditions used are shown in Table 1. Note the strong inhibition of IFN-alpha 4 and IFN-beta , but not of total IFN-alpha , in cells infected with the wild-type virus, producing the Lwt protein.


View larger version (93K):
[in this window]
[in a new window]
 
FIG. 7.   Kinetics of IFN-alpha 4 and IFN-beta inhibition. As described in the legend to Fig. 6, except that samples were analyzed from 1 to 7 h after infection to check whether inhibition was already effective at early times of IFN induction.

L protein is essential for persistence of TMEV in CNS. The L peptide was previously shown to be essential for the neurovirulence of the GDVII virus strain (1). We wanted to determine whether L was also required for the pathogenesis of the persistent strain DA1. We therefore assessed, by dot blot hybridization, the level of viral persistence of wild-type DA1 and mutant TM598 (Lcys) and TM564 (LDelta 7-67) viruses in brains and spinal cords of SJL/J mice 5 and 45 days postinfection (Fig. 8).


View larger version (39K):
[in this window]
[in a new window]
 
FIG. 8.   Mutation of the L protein zinc finger strongly affects viral infection of the mouse CNS. (A) Viral RNA detected by dot blot hybridization in the brain and spinal cord of mice infected in parallel with viruses DA1, TM598, and TM564, for 5 and 45 days. Reprinted in part from reference 34 with permission. (B) The levels of viral RNA were quantified using a phosphorimager and are shown as relative amounts of viral RNA per organ. The levels of beta -actin mRNA, measured as a control, were highly homogenous among the samples. TM598 is the Lcys mutant of DA1. TM564 contains a 61-codon-long deletion in the L ORF as well as in the overlapping L* ORF.

The 61-codon deletion of TM564 had a dramatic effect on viral persistence, as this virus was not detected by RT-PCR of the CNS of the mouse 45 days after infection. However, it is noteworthy that the deletion present in the L region of the virus also affected the L* reading frame so that the lack of persistence cannot be attributed solely to the mutations in L.

The mutation of L in TM598 also had a strong impact on virus persistence. At 45 days postinoculation, the amount of Lcys-mutant virus RNA in the spinal cord was 36 times lower than that of the wild-type virus. Viral persistence was severely but not completely blocked at this time since viral RNA of the Lcys mutant could still be detected by RT-PCR in the spinal cord of four out of four mice. Sequencing of the RT-PCR products confirmed the virus identity and showed that no revertants were selected during infection. The effect of the L protein zinc-binding motif disruption was already apparent 5 days postinfection (fourfold effect). This could indicate that a functional L peptide is required for efficient viral infection during the acute phase of the disease and is in agreement with the observed anti IFN-alpha /beta role of the protein.


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Inhibition of IFN-alpha /beta by L peptide. Kong et al. (14) have observed that the L peptide of TMEV is required for viral spread in L929 cells, but not in non-IFN-responsive BHK-21 cells. On the basis of these observations, they proposed that the L protein could interfere with the host IFN response. Our results establish that the L peptide indeed inhibits IFN-alpha /beta production by infected L929 cells, as supernatants of cells infected with a virus expressing the wild-type L protein failed to prime naive cells for viral resistance.

To analyze the level at which repression of IFN production occurred, we performed RT-PCRs to monitor IFN mRNA levels in infected cells. As soon as 7 h after infection, we observed a strong inhibition of the transcription of the IFN-alpha 4 and IFN-beta genes in L929 cells infected with the KJ6 virus. This effect is strikingly selective as the transcription of IFN-non-alpha 4 genes and that of the PKR gene were not decreased.

IFN-alpha 4 and IFN-beta are termed the immediate-early IFN genes, being the first two subtypes synthesized following viral infection (6, 19, 20, 26). Several transcriptional activators have been shown to cooperate in forming an active enhanceosome at the IFN-beta promoter (35). These include IRF-3, NF-kappa B, and ATF/c-Jun, which are all activated by phosphorylation in the cytoplasm and translocate to the nucleus following viral infection. The immediate-early IFNs are subsequently secreted and act in a paracrine manner to induce an antiviral state in neighboring cells. They might also act in an autocrine fashion to induce the transcription of the other IFN-alpha subtypes.

The selective inhibition of IFN-alpha 4 and IFN-beta observed in L929 cells suggests that the L peptide targets a specific factor involved in their transcription, although at this stage we cannot exclude the possibility of a posttranscriptional effect. IRF-3 is an obvious candidate for interaction with the L peptide, as this factor is known to specifically activate the transcription of IFN-beta and IFN-alpha 4 (13). IRF-3 is constitutively present in the cytoplasm of uninfected cells. Viral infection triggers a signaling cascade which leads to the C-terminal phosphorylation of IRF-3 (27), enabling it to homodimerize and to translocate to the nucleus, where it cooperates with CBP/p300 to activate the transcription of the IFN genes (17, 31, 36). Experiments are in progress to determine whether the L peptide interacts with IRF-3.

It is intriguing to note that total IFN mRNA synthesis was activated in KJ6-infected cells in spite of the represssion of IFN-beta and IFN-alpha 4. Indeed, in current murine models (20, 26), synthesis of the late IFN-alpha subtypes depends on the transcriptional induction of IRF-7 by immediate-early IFNs. Since immediate-early IFNs were repressed here, one might postulate that, in this case, transcription of some late IFNs subtypes could occur independently of IRF-7 activation.

L peptide is critical for viral persistence in vivo. A virus with mutations in the zinc-binding motif of the L peptide is severely impaired in its ability to persist. The L peptide influences infection in the early stages of the infection, as our data show a fourfold reduction of viral RNA for the Lcys mutant virus already 5 days postinfection. These data are in good agreement with previous results from Calenoff et al. (1), who showed that the L peptide is also important for the neurovirulence of the GDVII strain. The fact that L is required early by TMEV in the CNS could be a clue that it is important for the virus to counteract the innate host immunity and, in particular, the IFN-alpha /beta response.

It is clear, however, that IFN inhibition by L is not complete, as the disruption of STAT-1 in U3A cells and of IFN-alpha /beta receptor in knockout mice (10) dramatically enhanced infection by the wild-type virus (expressing L). This might reflect an inability of the virus to completely counteract a potent IFN response of the host. On the other hand, modulation rather than blockade of the IFN response might represent a better strategy to allow viral persistence and favor host-to-host transmission of the virus.

Conservation of anti-IFN role of picornavirus L. Although the picornavirus genome organization is rather well conserved, only cardioviruses and aphthoviruses express L. The L protein of aphthoviruses is a protease responsible for host cell protein synthesis shutoff through cleavage of eIF4G, a factor required for translation initiation (7). This protein, which is unrelated to the L protein of cardioviruses, was also found to have anti-IFN activity, possibly through the inhibition of protein synthesis (4).

The Cardiovirus genus includes TMEV and EMCV. As in the case of aphthoviruses, the L protein of Mengo virus (an EMCV strain) was proposed to participate in host cell protein synthesis shutoff and to affect IFN-alpha /beta production by infected cells (37). The L protein of EMCV and TMEV share about 35% of identical amino acids. In spite of this rather low identity, the zinc-binding motif is perfectly conserved in all the strains sequenced so far, suggesting some conserved roles for these proteins. We found that IFN inhibition by the L protein of TMEV was specific for immediate-early IFN and thus unlikely to result merely from host cell translational shutoff. L proteins of cardioviruses might thus interfere with different signal transduction pathways to induce translational shutoff and immediate-early IFN inhibition.


    ACKNOWLEDGMENTS

We are indebted to Daniel Gonzalez-Dunia and Sylvie Syan (Pasteur Institute, Paris, France) for help with the interferon biological assay. We thank Eliane Meurs (Pasteur Institute, Paris, France) for the gift of VSV and Ann Palmenberg (University of Wisconsin, Madison) for the gift of pMC24. We thank Michel Brahic (Pasteur Institute, Paris, France) for the F12B3 monoclonal antibody and for long-term collaboration. We are grateful to Ian Kerr (Imperial Cancer Research Fund, London, United Kingdom) and his team for rapid sending of 2fTGH and U3A cells and to Francis Brasseur (Ludwig Institute for Cancer Research, Brussels) for the gift of BALB/3T3 cells.

V.V.P. is a research assistant and T.M. is a senior research associate with the FNRS (Belgian Fund for Scientific Research). O.V.E. is a fellow of the Belgian FRIA (Fonds pour la Recherche dans l'Industrie et l'Agriculture). This work was supported by convention 3.4573.94F of the FRSM, by a crédit aux chercheurs 1.5.095.00 of the FNRS, by the Charcot Foundation, and by the Fonds de Développement Scientifique (FSR) of the University of Louvain.


    FOOTNOTES

* Corresponding author. Mailing address: Christian de Duve Institute of Cellular Pathology, University of Louvain, MIPA-VIRO 74-49, 74, avenue Hippocrate, B-1200 Brussels, Belgium. Phone: 32 2 764 74 29. Fax: 32 2 764 74 95. E-mail: michiels{at}mipa.ucl.ac.be.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Calenoff, M. A., C. S. Badshah, M. C. Dal Canto, H. L. Lipton, and M. K. Rundell. 1995. The leader polypeptide of Theiler's virus is essential for neurovirulence but not for virus growth in BHK cells. J. Virol. 69:5544-5549[Abstract].
2. Calenoff, M. A., K. S. Faaberg, and H. L. Lipton. 1990. Genomic regions of neurovirulence and attenuation in Theiler murine encephalomyelitis virus. Proc. Natl. Acad. Sci. USA 87:978-982[Abstract/Free Full Text].
3. Chen, H-H., W-P. Kong, and R. P. Roos. 1995. The leader peptide of Theiler's murine encephalomyelitis virus is a zinc-binding protein. J. Virol. 69:8076-8078[Abstract].
4. Chinsangaram, J., M. E. Piccone, and M. J. Grubman. 1999. Ability of foot-and-mouth disease virus to form plaques in cell culture is associated with suppression of alpha/beta interferon. J. Virol. 73:9891-9898[Abstract/Free Full Text].
5. Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156-159[Medline].
6. Deonarain, R., A. Alcami, M. Alexiou, M. J. Dallman, D. K. Gewert, and A. C. G. Porter. 2000. Impaired antiviral response and alpha/beta interferon induction in mice lacking beta interferon. J. Virol. 74:3404-3409[Abstract/Free Full Text].
7. Devaney, M. A., V. N. Vakharia, R. E. Lloyd, E. Ehrenfeld, and M. J. Grubman. 1988. Leader protein of foot-and-mouth disease virus is required for cleavage of the p220 component of the cap-binding protein complex. J. Virol. 62:4407-4409[Abstract/Free Full Text].
8. Drescher, K. M., L. R. Pease, and M. Rodriguez. 1997. Antiviral immune responses modulate the nature of central nervous system (CNS) disease in a murine model of multiple sclerosis. Immunol. Rev. 159:177-193[CrossRef][Medline].
9. Duke, G. M., and A. G. Palmenberg. 1989. Cloning and synthesis of infectious cardiovirus RNAs containing short, discrete poly(C) tracts. J. Virol. 63:1822-1826[Abstract/Free Full Text].
10. Fiette, L., C. Aubert, U. Muller, S. Huang, M. Aguet, M. Brahic, and J-F. Bureau. 1995. Theiler's virus infection of 129Sv mice that lack the interferon alpha/beta or interferon gamma receptors. J. Exp. Med. 181:2069-2076[Abstract/Free Full Text].
11. Fu, J., S. Stein, L. Rosenstein, T. Bodwell, M. Routbort, B. L. Semler, and R. P. Roos. 1990. Neurovirulence determinants of genetically engineered Theiler viruses. Proc. Natl. Acad. Sci. USA 87:4125-4129[Abstract/Free Full Text].
12. Jnaoui, K., and T. Michiels. 1998. Adaptation of Theiler's virus to L929 cells: mutations in the putative receptor binding site on the capsid map to neutralization sites and modulate viral persistence. Virology 244:397-404[CrossRef][Medline].
13. Juang, Y. T., W. Lowther, M. Kellum, W. C. Au, R. Lin, J. Hiscott, and P. M. Pitha. 1998. Primary activation of interferon A and interferon B gene transcription by interferon regulatory factor 3. Proc. Natl. Acad. Sci. USA 95:9837-9842[Abstract/Free Full Text].
14. Kong, W.-P., G. D. Ghadge, and R. P. Roos. 1994. Involvement of cardiovirus leader in host cell-restricted virus expression. Proc. Natl. Acad. Sci. USA 91:1796-1800[Abstract/Free Full Text].
15. Kong, W.-P., and R. P. Roos. 1991. Alternative translation initiation site in the DA strain of Theiler's murine encephalomyelitis virus. J. Virol. 65:3395-3399[Abstract/Free Full Text].
16. Kunkel, T. A. 1985. Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc. Natl. Acad. Sci. USA 82:488-492[Abstract/Free Full Text].
17. Lin, R., C. Heylbroeck, P. M. Pitha, and J. Hiscott. 1998. Virus-dependent phosphorylation of the IRF-3 transcription factor regulates nuclear translocation, transactivation potential, and proteasome-mediated degradation. Mol. Cell. Biol. 18:2986-2996[Abstract/Free Full Text].
18. Lipton, H. L. 1975. Theiler's virus infection in mice: an unusual biphasic disease process leading to demyelination. Infect. Immun. 11:1147-1155[Abstract/Free Full Text].
19. Mamane, Y., C. Heylbroeck, P. Génin, M. Algarté, M. J. Servant, C. LePage, C. DeLuca, H. Kwon, L. Rongtuan, and J. Hiscott. 1999. Interferon regulatory factors: the next generation. Gene 237:1-14[CrossRef][Medline].
20. Marié, I., J. E. Durbin, and D. E. Levy. 1998. Differential viral induction of distinct interferon-alpha genes by positive feedback through interferon regulatory factor 7. EMBO J. 17:6660-6669[CrossRef][Medline].
21. McAllister, A., F. Tangy, C. Aubert, and M. Brahic. 1989. Molecular cloning of the complete genome of Theiler's virus, strain DA, and production of infectious transcripts. Microb. Pathog. 7:381-388[CrossRef][Medline].
22. McAllister, A., F. Tangy, C. Aubert, and M. Brahic. 1990. Genetic mapping of the ability of Theiler's virus to persist and demyelinate. J. Virol. 64:4252-4257[Abstract/Free Full Text].
23. McKendry, R., J. John, D. Flavell, M. Müller, I. M. Kerr, and G. R. Stark. 1991. High-frequency mutagenesis of human cells and characterization of a mutant unresponsive to both alpha  and gamma  interferons. Proc. Natl. Acad. Sci. USA 88:11455-11459[Abstract/Free Full Text].
24. Michiels, T., V. Dejong, R. Rodrigus, and C. Shaw-Jackson. 1997. Protein 2A is not required for Theiler's virus replication. J. Virol. 71:9549-9556[Abstract].
25. Monteyne, P., J.-F. Bureau, and M. Brahic. 1997. The infection of mouse by Theiler's virus: from genetics to immunology. Immunol. Rev. 159:163-176[CrossRef][Medline].
26. Sato, M., H. Suemori, N. Hata, M. Asagiri, K. Ogasawara, O. K. Naka, T. Nakaya, M. Katsuki, S. Noguchi, N. Tanaka, and T. Taniguchi. 2000. Distinct and essential roles of transcription factors IRF-3 and IRF-7 in response to viruses for IFN-alpha /beta gene induction. Immunity 13:539-548[CrossRef][Medline].
27. Servant, M. J., B. ten Oever, C. Le Page, L. Conti, S. Gessani, I. Julkunen, R. Lin, and J. Hiscott. 2001. Identification of distinct signaling pathways leading to the phosphorylation of interferon regulatory factor 3. J. Biol. Chem. 276:355-363[Abstract/Free Full Text].
28. Shaw-Jackson, C., and T. Michiels. 1999. Absence of internal ribosome entry site-mediated tissue specificity in the translation of a bicistronic transgene. J. Virol. 73:2729-2738[Abstract/Free Full Text].
29. Stark, G. R., I. M. Kerr, B. R. G. Williams, R. H. Silverman, and R. D. Schreiber. 1998. How cells respond to interferons. Annu. Rev. Biochem. 67:227-264[CrossRef][Medline].
30. Stewart, W. E., II, E. D. De Clercq, and P. De Somer. 1974. Stabilization of interferons by "defensive" reversible denaturation. Nature 249:460-461[CrossRef][Medline].
31. Suhara, W., M. Yoneyama, T. Iwamura, S. Yoshimura, K. Tamura, H. Namiki, S. Aimoto, and T. Fujita. 2000. Analyses of virus-induced homomeric and heteromeric protein associations between IRF-3 and coactivator CBP/P300. J. Biochem. (Tokyo) 128:301-307[Abstract/Free Full Text].
32. Theiler, M., and S. Gard. 1940. Encephalomyelitis of mice. I. Characteristics and pathogenesis of the virus. J. Exp. Med. 72:49-67[Abstract].
33. Tortorella, D., B. E. Gewurz, M. H. Furman, D. J. Schust, and H. L. Ploegh. 2000. Viral subversion of the immune system. Annu. Rev. Immunol. 18:861-926[CrossRef][Medline].
34. van Eyll, O., and T. Michiels. 2000. Influence of the Theiler's virus L* protein on macrophage infection, viral persistence and neurovirulence. J. Virol. 74:9071-9077[Abstract/Free Full Text].
35. Wathelet, M. G., C. H. Lin, B. S. Parekh, L. V. Ronco, P. M. Howley, and T. Maniatis. 1998. Virus infection induces the assembly of coordinately activated transcription factors on the IFN-beta enhancer in vitro. Mol. Cell 3:507-518.
36. Yoneyama, M., W. Suhara, Y. Fukuhara, M. Fukuda, E. Nishida, and T. Fujita. 1998. Direct triggering of the type I interferon system by virus infection: activation of a transcription factor complex containing IRF-3 and CBP/P300. EMBO J. 17:1087-1095[CrossRef][Medline].
37. Zoll, J., J. M. D. Galama, F. J. M. van Kuppeveld, and W. J. G. Melchers. 1996. Mengovirus leader is involved in the inhibition of host cell protein synthesis. J. Virol. 70:4948-4952[Abstract/Free Full Text].


Journal of Virology, September 2001, p. 7811-7817, Vol. 75, No. 17
0022-538X/01/$04.00+0   DOI: 10.1128/JVI.75.17.7811-7817.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Ricour, C., Borghese, F., Sorgeloos, F., Hato, S. V., van Kuppeveld, F. J. M., Michiels, T. (2009). Random Mutagenesis Defines a Domain of Theiler's Virus Leader Protein That Is Essential for Antagonism of Nucleocytoplasmic Trafficking and Cytokine Gene Expression. J. Virol. 83: 11223-11232 [Abstract] [Full Text]  
  • Lidsky, P. V., Romanova, L. I., Kolesnikova, M. S., Bardina, M. V., Khitrina, E. V., Hato, S. V., van Kuppeveld, F. J. M., Agol, V. I. (2009). Interactions between Viral and Prokaryotic Pathogens in a Mixed Infection with Cardiovirus and Mycoplasma. J. Virol. 83: 9940-9951 [Abstract] [Full Text]  
  • Romanova, L. I., Lidsky, P. V., Kolesnikova, M. S., Fominykh, K. V., Gmyl, A. P., Sheval, E. V., Hato, S. V., van Kuppeveld, F. J. M., Agol, V. I. (2009). Antiapoptotic Activity of the Cardiovirus Leader Protein, a Viral "Security" Protein. J. Virol. 83: 7273-7284 [Abstract] [Full Text]  
  • Taniura, N., Saito, M., Okuwa, T., Saito, K., Ohara, Y. (2009). Different Subcellular Localization of Theiler's Murine Encephalomyelitis Virus Leader Proteins of GDVII and DA Strains in BHK-21 Cells. J. Virol. 83: 6624-6630 [Abstract] [Full Text]  
  • Fan, J., Son, K.-N., Arslan, S. Y., Liang, Z., Lipton, H. L. (2009). Theiler's Murine Encephalomyelitis Virus Leader Protein Is the Only Nonstructural Protein Tested That Induces Apoptosis When Transfected into Mammalian Cells. J. Virol. 83: 6546-6553 [Abstract] [Full Text]  
  • Blinkova, O., Kapoor, A., Victoria, J., Jones, M., Wolfe, N., Naeem, A., Shaukat, S., Sharif, S., Alam, M. M., Angez, M., Zaidi, S., Delwart, E. L. (2009). Cardioviruses Are Genetically Diverse and Cause Common Enteric Infections in South Asian Children. J. Virol. 83: 4631-4641 [Abstract] [Full Text]  
  • Ricour, C., Delhaye, S., Hato, S. V., Olenyik, T. D., Michel, B., van Kuppeveld, F. J. M., Gustin, K. E., Michiels, T. (2009). Inhibition of mRNA export and dimerization of interferon regulatory factor 3 by Theiler's virus leader protein. J. Gen. Virol. 90: 177-186 [Abstract] [Full Text]  
  • Frieman, M., Baric, R. (2008). Mechanisms of Severe Acute Respiratory Syndrome Pathogenesis and Innate Immunomodulation. Microbiol. Mol. Biol. Rev. 72: 672-685 [Abstract] [Full Text]  
  • Baida, G., Popko, B., Wollmann, R. L., Stavrou, S., Lin, W., Tretiakova, M., Krausz, T. N., Roos, R. P. (2008). A Subgenomic Segment of Theiler's Murine Encephalomyelitis Virus RNA Causes Demyelination. J. Virol. 82: 5879-5886 [Abstract] [Full Text]  
  • Myoung, J., Bahk, Y. Y., Kang, H. S., Dal Canto, M. C., Kim, B. S. (2008). Anticapsid Immunity Level, Not Viral Persistence Level, Correlates with the Progression of Theiler's Virus-Induced Demyelinating Disease in Viral P1-Transgenic Mice. J. Virol. 82: 5606-5617 [Abstract] [Full Text]  
  • Randall, R. E., Goodbourn, S. (2008). Interferons and viruses: an interplay between induction, signalling, antiviral responses and virus countermeasures. J. Gen. Virol. 89: 1-47 [Abstract] [Full Text]  
  • de los Santos, T., Diaz-San Segundo, F., Grubman, M. J. (2007). Degradation of Nuclear Factor Kappa B during Foot-and-Mouth Disease Virus Infection. J. Virol. 81: 12803-12815 [Abstract] [Full Text]  
  • Jin, Y.-H., Mohindru, M., Kang, M. H., Fuller, A. C., Kang, B., Gallo, D., Kim, B. S. (2007). Differential Virus Replication, Cytokine Production, and Antigen-Presenting Function by Microglia from Susceptible and Resistant Mice Infected with Theiler's Virus. J. Virol. 81: 11690-11702 [Abstract] [Full Text]  
  • Asakura, K., Murayama, H., Himeda, T., Ohara, Y. (2007). Expression of L* protein of Theiler's murine encephalomyelitis virus in the chronic phase of infection. J. Gen. Virol. 88: 2268-2274 [Abstract] [Full Text]  
  • Takano-Maruyama, M., Ohara, Y., Asakura, K., Okuwa, T. (2006). Theiler's Murine Encephalomyelitis Virus Leader Protein Amino Acid Residue 57 Regulates Subgroup-Specific Virus Growth on BHK-21 Cells. J. Virol. 80: 12025-12031 [Abstract] [Full Text]  
  • Versteeg, G. A., Slobodskaya, O., Spaan, W. J. M. (2006). Transcriptional profiling of acute cytopathic murine hepatitis virus infection in fibroblast-like cells. J. Gen. Virol. 87: 1961-1975 [Abstract] [Full Text]  
  • Delhaye, S., Paul, S., Blakqori, G., Minet, M., Weber, F., Staeheli, P., Michiels, T. (2006). Neurons produce type I interferon during viral encephalitis. Proc. Natl. Acad. Sci. USA 103: 7835-7840 [Abstract] [Full Text]  
  • Paul, S., Michiels, T. (2006). Cardiovirus leader proteins are functionally interchangeable and have evolved to adapt to virus replication fitness.. J. Gen. Virol. 87: 1237-1246 [Abstract] [Full Text]  
  • de los Santos, T., de Avila Botton, S., Weiblen, R., Grubman, M. J. (2006). The Leader Proteinase of Foot-and-Mouth Disease Virus Inhibits the Induction of Beta Interferon mRNA and Blocks the Host Innate Immune Response. J. Virol. 80: 1906-1914 [Abstract] [Full Text]  
  • Gil, L. H. V. G., Ansari, I. H., Vassilev, V., Liang, D., Lai, V. C. H., Zhong, W., Hong, Z., Dubovi, E. J., Donis, R. O. (2006). The Amino-Terminal Domain of Bovine Viral Diarrhea Virus Npro Protein Is Necessary for Alpha/Beta Interferon Antagonism. J. Virol. 80: 900-911 [Abstract] [Full Text]  
  • Peng, W., Henderson, G., Inman, M., BenMohamed, L., Perng, G.-C., Wechsler, S. L., Jones, C. (2005). The Locus Encompassing the Latency-Associated Transcript of Herpes Simplex Virus Type 1 Interferes with and Delays Interferon Expression in Productively Infected Neuroblastoma Cells and Trigeminal Ganglia of Acutely Infected Mice. J. Virol. 79: 6162-6171 [Abstract] [Full Text]  
  • Spiegel, M., Pichlmair, A., Martinez-Sobrido, L., Cros, J., Garcia-Sastre, A., Haller, O., Weber, F. (2005). Inhibition of Beta Interferon Induction by Severe Acute Respiratory Syndrome Coronavirus Suggests a Two-Step Model for Activation of Interferon Regulatory Factor 3. J. Virol. 79: 2079-2086 [Abstract] [Full Text]  
  • Mena, I., Roussarie, J.-P., Brahic, M. (2004). Infection of Macrophage Primary Cultures by Persistent and Nonpersistent Strains of Theiler's Virus: Role of Capsid and Noncapsid Viral Determinants. J. Virol. 78: 13356-13361 [Abstract] [Full Text]  
  • van Pesch, V., Lanaya, H., Renauld, J.-C., Michiels, T. (2004). Characterization of the Murine Alpha Interferon Gene Family. J. Virol. 78: 8219-8228 [Abstract] [Full Text]  
  • Delhaye, S., van Pesch, V., Michiels, T. (2004). The Leader Protein of Theiler's Virus Interferes with Nucleocytoplasmic Trafficking of Cellular Proteins. J. Virol. 78: 4357-4362 [Abstract] [Full Text]  
  • van Pesch, V., Michiels, T. (2003). Characterization of Interferon-{alpha} 13, a Novel Constitutive Murine Interferon-{alpha} Subtype. J. Biol. Chem. 278: 46321-46328 [Abstract] [Full Text]  
  • Sasaki, J., Nagashima, S., Taniguchi, K. (2003). Aichi Virus Leader Protein Is Involved in Viral RNA Replication and Encapsidation. J. Virol. 77: 10799-10807 [Abstract] [Full Text]  
  • Hinton, T. M., Ross-Smith, N., Warner, S., Belsham, G. J., Crabb, B. S. (2002). Conservation of L and 3C proteinase activities across distantly related aphthoviruses. J. Gen. Virol. 83: 3111-3121 [Abstract] [Full Text]  
  • van Eyll, O., Michiels, T. (2002). Non-AUG-Initiated Internal Translation of the L* Protein of Theiler's Virus and Importance of This Protein for Viral Persistence. J. Virol. 76: 10665-10673 [Abstract] [Full Text]  
  • Zoll, J., Melchers, W. J. G., Galama, J. M. D., van Kuppeveld, F. J. M. (2002). The Mengovirus Leader Protein Suppresses Alpha/Beta Interferon Production by Inhibition of the Iron/Ferritin-Mediated Activation of NF-{kappa}B. J. Virol. 76: 9664-9672 [Abstract] [Full Text]  
  • Barnes, B. J., Kellum, M. J., Field, A. E., Pitha, P. M. (2002). Multiple Regulatory Domains of IRF-5 Control Activation, Cellular Localization, and Induction of Chemokines That Mediate Recruitment of T Lymphocytes. Mol. Cell. Biol. 22: 5721-5740 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van Pesch, V.
Right arrow Articles by Michiels, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van Pesch, V.
Right arrow Articles by Michiels, T.