Previous Article | Next Article 
Journal of Virology, August 2001, p. 7778-7784, Vol. 75, No. 16
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.16.7778-7784.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Sindbis Virus Variant with a Deletion in the 6K
Gene Shows Defects in Glycoprotein Processing and Trafficking: Lack of
Complementation by a Wild-Type 6K Gene in
trans
Miguel Angel
Sanz* and
Luis
Carrasco
Centro de Biología Molecular
(CSIC-UAM), Universidad Autónoma de Madrid, Cantoblanco, 28049 Madrid, Spain
Received 26 February 2001/Accepted 9 May 2001
 |
ABSTRACT |
A Sindbis virus (SV) variant with a 6K gene partially
deleted has been obtained. This SV Del6K virus is defective in the
proteolytic processing of virus glycoprotein precursor, transport of
glycoproteins to the plasma membrane, and plaque phenotype. A revertant
virus (SV Del6K-revQ21L) containing a point mutation in the deleted 6K
gene was isolated and characterized. SV Del6K-revQ21L has corrected the
defects of proteolytic processing and transport of virus glycoproteins to the plasma membrane, but it still remains attenuated compared to
wild-type (wt) SV, exhibiting defects in virus budding. Neither mutant
nor revertant viruses are complemented by the coexpression in
trans of a wt SV 6K gene.
 |
TEXT |
Alphaviruses are enveloped viruses
that contain a single-stranded positive-sense RNA as a genome
(23). The alphavirus structural proteins are synthesized
from a subgenomic mRNA encoding a polyprotein that is proteolytically
processed. The C protein is first synthesized and separated from the
rest of the polyprotein by autocatalytic cleavage. Once the C protein
has been released to the cytoplasm, further translation of the mRNA
continues that is associated with membranes (23). The
newly exposed amino terminus contains a signal sequence that interacts
with membranes of the endoplasmic reticulum (ER) and directs
this portion of the glycoprotein precursor (E3-E2-6K-E1) into the
lumen of the ER. The precursor associates with the ER membrane,
spanning the lipid bilayer six times. Soon after synthesis, this
precursor is cleaved at both ends of the 6K protein by a cellular
protease present in the ER, generating the products PE2 (E3 plus E2),
6K, and E1. Subsequently, PE2 and E1 associate to form dimers that
migrate together with 6K through the vesicular system to the plasma
membrane. PE2 is cleaved by a furin-like protease present in a
post-Golgi compartment, giving rise to glycoproteins E3 and E2
(23). Despite the association of the 6K protein with the
plasma membrane and its association with E1-E2, very little 6K is
incorporated into the released virus particles (6, 18).
The 6K protein is a small hydrophobic polypeptide that is acylated with
fatty acids (6, 18). 6K provides the signal sequence for
translocation of E1 to the lumen of the ER (15). A
Semliki Forest virus (SFV) variant lacking the entire 6K is
processed between E2 and E1 (16). E1 is properly
translocated to the ER in the 6K-deleted SFV mutant. The major defects
of this variant are found in the budding process (16, 17).
Similarly, Sindbis virus (SV) variants with single or multiple amino
acid substitutions in the 6K gene are defective in virion release,
leading to the formation of multinucleated virus particles (5,
7,11, 12). Proper proteolytic processing of the virus
glycoproteins is hampered in a SV variant bearing an insertion of 15 amino acids in the 6K protein (22). This SV mutant
exhibits a trans-dominant phenotype, but virus particles
have a morphology similar to wild-type (wt) virus. On the other hand,
the functions of the 6K protein cannot be rescued by the corresponding
counterpart from related virus species. Thus, the replacement of the SV
6K gene with the 6K counterpart from Ross River virus produced viruses
with a small plaque phenotype and reduced formation of infectious virus
(26). This SV variant containing the 6K gene from Ross
River virus was able to proteolytically cleave the glycoproteins'
precursor and to transport them to the plasma membrane. Although these
observations suggest a function for 6K in the release of virions, the
precise molecular mechanism by which 6K protein enhances virus particle release remains unknown.
Generation of a 6K deletion variant of SV.
The role of the 6K
protein in the SV replication cycle has been analyzed previously by
several laboratories using a number of 6K variants. To further assess
the role of 6K protein, a variant of SV that lacks a significant
portion of the 6K gene was generated (SV Del6K) (Fig.
1A). pT7 SV wt is a full-length cDNA
clone of SV. It was constructed by inserting the fragment obtained upon digestion of pT7 TOTO 1102 with SacI/SpeI
into pTE3'2J1 (9) digested with
SacI/SpeI. This construction changes the
Sp6 promoter in pTE3'2J1 to the T7 promoter. Both plasmids were a kind
gift of C. M. Rice (Washington University School of Medicine).

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Schematic representation of the different RNAs
derived from the constructs pT7 SV wt, pT7 SV Del6K, or pT7 SV
Del6K-revQ21L (top) and pT7 SV Del6K + 6K or pT7 SV Del6K-revQ21L + 6K
(bottom). The sequences of 6K and deleted 6K are shown. (B) Plaques
formed by virus wt SV or SV Del6K. The titers of the stocks of wt SV
and SV Del6K on BHK cells obtained after RNA electroporation were
determined, and the cells were stained at 72 h
postinfection. (C) Kinetics of release of wt SV and SV Del6K
viruses from infected BHK cells. The titers of viruses released to the
medium from BHK cells infected at a concentration of 50 PFU/cell were
determined at the times indicated. The viruses used in this experiment
correspond to amplifications of initial stocks obtained after RNA
electroporation. (D) Hydrophobicity plots of 6K, Del6K and
Del6K-revQ21L proteins are according to the Kite-Doolittle
hydrophobicity test.
|
|
pT7 SV Del6K contains an internal deletion in the sequence encoding the
6K protein. The coding sequence corresponding to amino
acids 24 to 45 of the 6K protein has been deleted. In addition,
it has the mutation
altering TTG nucleotides to GCA, predicting
a change from L22 to
A.
The PCR product generated using the oligonucleotides 5'
C CCGGGCATATGGGATGGCCACACGAAATAGTACAG 3' and 5'
GGCGCCGCATGCCTGGACCCAGAAGAACGGCTGACT
3' was digested with
SphI and ligated to the PCR product generated
using the
oligonucleotides 5' CCCGGGGCATGCGCCGGCGCCTACCTGGCGAAGGTA
3'
and 5' GGCGCCGGATCCTTATTAGACGTACGCCTCACTCATCTGGCT 3'
previously
digested with
SphI. The new product was digested
with
BssHII and
BsiWI and inserted into
BssHII/
BsiWI sites of pT7 SV wt. The SV
Del6K
variant obtained retains the two cleavage signals at either
end of the
6K protein. Electroporation of BHK cells with the viral
RNA synthesized
in vitro led to the production of progeny viruses.
A plaque assay of
the viruses thus obtained indicated that most
of the plaques had a
minute phenotype, while a significant number
exhibited a size about
half that of the wt virus (Fig.
1B). Further
amplification of SV Del6K
obtained after electroporation of BHK
cells produced viruses with an
intermediate-plaque-size phenotype
(results not shown). These viruses
already represent revertant
SV. The virus yield obtained with these
viruses was almost equal
to that of wt SV, albeit with a delayed rate
of replication (Fig.
1C).
We next isolated viruses from several intermediate-size plaques of SV
Del6K. The region corresponding to 6K was sequenced
in 12 of these
isolates. Seventy percent of the variant viruses
contained a point
mutation at nucleotide 9961 (A changed to T)
affecting residue 21 (Q
was replaced by L) in the deleted 6K gene.
This point mutation rendered
the truncated 6K protein more hydrophobic
(Fig.
1D). To ensure that
this was the only significant variation
in the revertant Del6K, the
region corresponding to the wt 6K
gene of SV was replaced with the same
region from a variant strain.
This virus was designated SV
Del6K-revQ21L. Virions obtained by
growth of the bulk SV Del6K and the
6K revertant SV Del6K-revQ21L
were similar in all respects analyzed,
except that the plaques
obtained with the 6K revertant were more
homogeneous and always
exhibited an intermediate-plaque-size phenotype.
The virus stock
of SV Del6K obtained by several reinfections was also
sequenced,
showing the point mutation at nucleotide 9961 that leads to
the
change from Q21 to
L.
Glycoprotein synthesis and trafficking in BHK cells electroporated
with SV Del6K and SV Del6K-revQ21L RNAs.
Since electroporation of
cells with Del6K RNA followed by virus harvesting leads to the
production of revertant viruses with mutations in the partially deleted
6K gene, it was of interest to directly electroporate cells with viral
RNAs. Initially, protein synthesis and glycoprotein processing were
tested. To this end, BHK cells were electroporated with wt SV, SV
Del6K, or SV Del6K-revQ21L RNAs made by in vitro transcription.
Electroporated cells were labeled with
[35S]methionine-cysteine at 16 h
postelectroporation (h.p.e.) for 30 min and chased by incubation in
nonradioactive medium for 1 or 2 h (Fig.
2A). In
addition to protein C, two major bands corresponding to PE2 and E1 were
apparent in BHK cells electroporated with wt SV RNA. The precursor
containing E3-E2-6K-E1 was not detected. Mature E2 glycoprotein was
detected after a chase. In the case of SV Del6K, however, the
precursor E3-E2-Del6K-E1 (P160) was clearly apparent and did not
diminish significantly after the 2-h chase period. Part of the
precursor was proteolytically processed, but only one band was detected
in the region of processed glycoproteins. This band likely corresponds
to product PE2 and a fusion product, Del6K-E1. Almost no mature
glycoprotein E2 was observed after a chase. Notably, SV Del6K-revQ21L
showed a protein pattern similar to wt SV. A thin band was detected
above PE2 in the pulse-labeled cells, perhaps corresponding to a fusion
product, PE2-Del6K. This product disappeared during a chase, while
mature E2 and E1 appeared. According to these data, the SV Del6K
variant showed defects in the cleavage of both scissile bonds, E2-6K
and 6K-E1, that occur in the ER lumen. Cleavage of 6K-E1 was
particularly resistant. This defect is largely corrected in the
revertant SV Del6K-revQ21L.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 2.
(A) Analysis of protein synthesis by pulse-chase
labeling. At 16 h.p.e., cells were labeled for 30 min with
[35S]methionine-cysteine (lanes 0), and some cultures
were chased for 1 (lanes 1) or 2 (lanes 2) h as indicated. (B)
Detection of 6K by Western blot analysis using anti-6K antiserum.
Samples were collected after 16 h.p.e. Lanes: B, no RNA was added;
1, cells electroporated with RNA from wt SV; 2, RNA from SV Del6K; 3, RNA from SV Del6K-revQ21L. (C) Endo H sensitivity analysis of viral
glycoproteins. (Left) Samples of BHK cells labeled with
[35S]methionine-cysteine for 30 min at 16 h.p.e.
were lysed and treated with (+) or without (-) endo H (EH). (Right) BHK
cells electroporated with SV wt RNA were treated as described for the
left-hand panel, but after lysis the samples were divided in
three aliquots. Lanes: left, mock treated; center, denatured sample;
right, denatured and incubated with endo H.
|
|
Further insights into the pattern of cleavages between E2-6K and 6K-E1
were obtained by immunodetection. Samples of BHK cells
electroporated
with the different RNAs were analyzed by Western
blotting with
previously described anti-6K antibodies (
6) (Fig.
2B).
Mature 6K was observed only in wt SV electroporated cells,
while a
fusion band was observed with SV Del6K electroporated
cells bound
either to PE2 or most probably to glycoprotein E1.
This fusion band
does not appear with SV Del6K-revQ21L. The cleaved
Del6K protein formed
by the revQ21L virus was not detected by
Western blotting because it
was too small to be retained by nitrocellulose
membranes. However,
synthesis of Del6K protein was demonstrated
by immunoprecipitation
(data not shown). Moreover, the product
P160 present in the pulse-chase
experiment with SV Del6K was not
recognized by the anti-6K antibody.
This result supports the view
that the attenuated phenotype of
revertant SV Del6K-revQ21L was
due to the deficient functioning of the
deleted 6K. It also rules
out the possibility that this phenotype is a
consequence of the
permanent fusion of Del6K with glycoprotein E2 or
E1.
Additional analysis of the processing of E1 glycoprotein was carried
out by examining endo-

-
N-acetylglucosaminidase H (endo
H) sensitivity. Extracts from electroporated cells were treated
with or without endo H glycosidase and immunoprecipitated with
anti-E1
antibodies. The anti-E1 antiserum was raised in rabbits
immunized with
fusion protein MBP-

SV E1. Protein MBP-

SV E1 contains
amino acids
186 to 343 from E1 sequence fused to maltose-binding
protein. The
immunoprecipitated material was analyzed by sodium
dodecyl sulfate
(SDS)-polyacrylamide gel electrophoresis (Fig.
2C). No bands were
detected with wt SV untreated extracts, although
a band appeared after
endo H treatment. A similar result was seen
with SV Del6K-revQ21L
extract, but in this case two faint bands
were clearly seen in the
untreated sample, one corresponding to
the P160 precursor and the other
to E1. In the case of SV Del6K,
these two bands were clearly visible in
the untreated sample.
Both of these bands migrated faster after endo H
treatment, suggesting
that they became glycosylated. These results
indicate that with
the three viral RNAs assayed all forms of E1 become
glycosylated.
In addition, the experiment revealed differences in the
immunoprecipitation
behavior of E1 from wt SV or SV Del6K-revQ21L
compared to SV Del6K.
E1 was not immunoprecipitated from wt SV or SV
Del6K-revQ21L untreated
samples, but it was immunoprecipitated from SV
Del6K cell extracts
(Fig.
2C). Perhaps these differences reflect a
different conformation
of E1. The fact that anti-E1 antibodies
immunoreact well with
the P160 precursor suggests that the correct
association of processed
E1 and E2 glycoproteins masks the epitope. In
the absence of endo
H treatment, E1 was immunoprecipitated from wt SV
samples only
after denaturation (Fig.
2C).
After precursor processing, alphavirus glycoproteins are delivered to
the plasma membrane ready for virus budding. Subcellular
localization
of E1 or its precursor products was analyzed in BHK
cells
electroporated with wt SV, SV Del6K, and SV Del6K-revQ21L
RNAs.
Immunofluorescence analysis with anti-E1 antibodies was
carried out
with permeabilized or unpermeabilized cells to determine
the proportion
of E1 delivered to the plasma membrane. E1 immunofluorescence
was
clearly visible at the plasma membrane of unpermeabilized
wt SV or SV
Del6K-revQ21L cells, but not when SV Del6K was tested
(results not
shown). The presence of E1 (or its precursors) was
seen in all three
cases when cells were permeabilized to the anti-E1
antibodies (results
not shown). In addition, we examined electroporated
cells by electron
microscopy. At 16 h.p.e., the cells were fixed,
dehydrated,
embedded, and examined. Representative micrographs
are shown in Fig.
3. The main feature of cells
electroporated
with SV Del6K RNA is the virtual absence of virus
budding from
the plasma membrane. Only a few cells showed virus
budding, while
the nucleocapsids were scattered in the cytoplasm. No
cytopathic
vacuoles in BHK cells electroporated with SV Del6K RNA were
observed.
In contrast, cells electroporated with SV Del6K-revQ21L RNA
showed
a picture very similar to wt SV. Virus budding occurred in these
cells, and aggregates of nucleocapsids and cytopathic vacuoles
were
observed in the cytoplasm. However, the revertant virus particles
are
associated with membranes to a greater extent than wt SV particles
after budding. The last event of virus budding, i.e., pinching
off, is
inefficient in SV Del6K-revQ21L. Chains and groups of
viruses
associated with membranes are commonly observed.

View larger version (137K):
[in this window]
[in a new window]
|
FIG. 3.
Electron microscopy of BHK cells electroporated with wt
SV (A), SV Del6K (B), and SV Del6K-revQ21L (C and D) RNAs. At 16 h.p.e., the cells were processed for electron microscopy analysis. Thin
sections were cut and stained with uranyl acetate and lead citrate.
Small arrows, nucleocapsids; large arrows, virus particles. Large bars,
500 nm; small bars, 200 nm.
|
|
Lack of complementation of SV 6K in trans.
The
revertant virus SV Del6K-revQ21L partially recovered the capacity to
process the P160 precursor proteolytically. In addition, the viral
glycoproteins associate with the cell membrane, in contrast to what
happens with SV Del6K. However, SV Del6K-revQ21L still shows defects,
with an intermediate-plaque-size phenotype. This defect may be due to
the impaired activity of the deleted 6K. Since SV Del6K-revQ21L is able
to cleave P160, it was of interest to test whether wt 6K provided in
trans complemented the plaque size of the revertant
virus. To this end, the SV 6K gene was placed under a second subgenomic
promoter (see Fig. 1A) and cloned into either pT7 SV Del6K or pT7 SV
Del6K-revQ21L to generate the constructs pT7 SV Del6K + 6K and pT7 SV
Del6K-revQ21L + 6K, respectively. Both of them contain the 6K sequence
downstream of the duplicated 26S promoter. They were constructed by
subcloning the 6K sequence generated by PCR using the oligonucleotides
5' GCCCGGATCCTTATTAGGCGTCTACCTTCGCCAG 3' and 5'
CCCGGGCCATGGAAACGTTCACCGAGACC 3' via subcloning into the
NcoI/BamHI sites present in pH3'2J1
(9) in ApaI/XhoI sites of
pT7 SV Del6K or pT7 SV Del6K-RevQ21L. The plaques produced by cells
electroporated with RNA derived from these constructs were similar in
size to those of the parental SV Del6K and SV Del6K-revQ21L. Next, the
synthesis of viral proteins and, particularly, of 6K was examined.
Thus, cells were electroporated with viral RNAs and labeled with
[35S]methionine-cysteine at 16 h.p.e. The pattern of
proteins synthesized by all viruses bearing the additional 6K gene was
unaltered (Fig. 4A). 6K is synthesized at
lower levels than in wt SV, but the 6K protein can be seen by labeling
(Fig. 4B). In addition, the amount of 6K was examined by
immunoprecipitation with anti-6K antibodies. In this case, the
experiment was made with BHK cells infected with viruses obtained by
RNA electroporation. The immunoprecipitated proteins were analyzed by
SDS-polyacrylamide gel electrophoresis (Fig. 4C). With this method, it
was possible to detect the processed Del6K protein. The protein 6K
analyzed by high-resolution gels (20% acrylamide) migrates as two
bands and a smear (Fig. 4C). It is possible that the 6K forms
aggregates that are resistant to denaturing agents such as
dithiothreitol and SDS.

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 4.
Expression of SV 6K gene in trans. (A)
[35S]methionine-cysteine protein labeling from 16 to17
h.p.e in BHK cells electroporated with different RNAs. Lanes: B, no RNA
was added; 1, wt SV; 2, SV Del6K; 3, SV Del6K + 6K; 4, SV
Del6K-revQ21L; 5, SV Del6K-revQ21L + 6K. (B) Overexposure of the lower
part of the field shown in panel A. (C) Immunoprecipitation analysis
with anti-6K antibodies of lysates obtained from cells infected with
mock-infected BHK cells (lane B), wt SV virus (lane 1), SV
Del6K-revQ21L virus (lane 2), and SV Del6K-revQ21L + 6K virus (lane
3).
|
|
Conclusions.
The main defects associated with the SV Del6K
variant described in this work appeared to be a consequence of
inefficient proteolytic processing of the viral glycoprotein precursor.
The revertant SV Del6K-revQ21L virus has resolved the defects of
cleavage by the signalase and the transport of viral glycoproteins to
the plasma membrane. This reversion can be ascribed to the substitution Q21L that renders the Del6K protein more hydrophobic. This reversion to
a higher hydrophobicity of the Del6K protein may permit stronger association of Del6K with membranes, which may favor the signalase activity. Nevertheless, the revertant SV Del6K-revQ21L still has an
attenuated phenotype, with defects in the release of virions from
cells. These findings support another function for the 6K protein
besides providing the signal sequences to signalase.
It was proposed that the 6K protein promotes membrane deformation and
bending during the budding process (
5,
17). Further
evidence for the functioning of 6K comes from membrane permeabilization
upon expression of the SFV 6K in
Escherichia coli cells
(
21).
The 6K protein of SV behaves similarly in this
respect (unpublished
results). This permeabilizing activity promotes
local changes
in membrane potential that would generate forces favoring
the
budding process. In this regard, there is evidence that
budding
of alphavirus particles is influenced by ionic gradients
(
14,
25). However, little is known about the molecular
basis underlying
this phenomenon. Another possible role for the 6K
protein during
budding is that it promotes lateral interactions between
glycoprotein
heterodimers or between spikes by 6K-6K interactions. In
this
way, 6K could favor glycoprotein concentration in the cytoplasmic
membrane before its dissociation from viral glycoproteins. The
coexpression of a genuine 6K protein did not revert the SV Del6K
or SV
Del6K-revQ21L phenotypes. The absence of complementation
by 6K
expressed in
trans could be ascribed to one of the following
factors. (i) Association with the PE2-E1 heterodimers is impaired.
(ii)
The 6K generated in
trans contains an additional methionine
in its N-terminal end. (iii) The 6K does not fold correctly in
the
cellular membranes, since it is expressed out of the context
of the
viral
polyprotein.
Other animal viruses encode proteins with physical or biological
similarities to 6K. These physical characteristics include
a low
molecular weight in very hydrophobic proteins that oligomerize
and
interact with membranes. The main biological function of these
proteins is to participate in budding of virus particles, although
they
are excluded from mature virions. Proteins with these features
are
collectively termed viroporins (
3). Typical viroporins
are
Vpu from human immunodeficiency virus (
8,
13), M2 from
influenza virus (
10,
27), SH from respiratory syncitial
virus
(
19), 2B from picornaviruses (
1,
2,
24), or protein
E from coronavirus (
4,
20). Both M2
and Vpu form ion channels
in biological membranes (
3).
Comparative studies of the biological
functioning of these proteins
will indicate to what extent they
share analogous functions during the
replicative cycle of animal
viruses.
 |
ACKNOWLEDGMENTS |
DGICYT project number PB94-0148 and the institutional grant to the
CBM of Fundación Ramón Areces are acknowledged for
financial support.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Centro de
Biología Molecular (CSIC-UAM), Universidad Autónoma
de Madrid, Cantoblanco, 28049 Madrid, Spain. Phone:
34-91-397-8450. Fax: 34-91-397-4799. E-mail:
lcarrasco{at}cbm.uam.es.
 |
REFERENCES |
| 1.
|
Barco, A., and L. Carrasco.
1995.
A human virus protein, poliovirus protein 2BC, induces membrane proliferation and blocks the exocytic pathway in the yeast Saccharomyces cerevisiae.
EMBO J.
14:3349-3364[Medline].
|
| 2.
|
Barco, A., and L. Carrasco.
1998.
Identification of regions of poliovirus 2BC protein that are involved in cytotoxicity.
J. Virol.
72:3560-3570[Abstract/Free Full Text].
|
| 3.
|
Carrasco, L.
1995.
Modification of membrane permeability by animal viruses.
Adv. Virus Res.
45:61-112[Medline].
|
| 4.
|
Corse, E., and C. E. Machamer.
2000.
Infectious bronchitis virus E protein is targeted to the Golgi complex and directs release of virus-like particles.
J. Virol.
74:4319-4326[Abstract/Free Full Text].
|
| 5.
|
Gaedigk-Nitschko, K.,
M. X. Ding,
M. A. Levy, and M. J. Schlesinger.
1990.
Site-directed mutations in the Sindbis virus 6K protein reveal sites for fatty acylation and the underacylated protein affects virus release and virion structure.
Virology
175:282-291[CrossRef][Medline].
|
| 6.
|
Gaedigk-Nitschko, K., and M. J. Schlesinger.
1990.
The Sindbis virus 6K protein can be detected in virions and is acylated with fatty acids.
Virology
175:274-281[CrossRef][Medline].
|
| 7.
|
Gaedigk-Nitschko, K., and M. J. Schlesinger.
1991.
Site-directed mutations in Sindbis virus E2 glycoprotein's cytoplasmic domain and the 6K protein lead to similar defects in virus assembly and budding.
Virology
183:206-214[CrossRef][Medline].
|
| 8.
|
González, M. E., and L. Carrasco.
1998.
The human immunodeficiency virus type 1 Vpu protein enhances membrane permeability.
Biochemistry
37:13710-13719[CrossRef][Medline].
|
| 9.
|
Hahn, C. S.,
Y. S. Hahn,
T. J. Braciale, and C. M. Rice.
1992.
Infectious Sindbis virus transient expression vectors for studying antigen processing and presentation.
Proc. Natl. Acad. Sci. USA
89:2679-2683[Abstract/Free Full Text].
|
| 10.
|
Hughey, P. G.,
R. W. Compans,
S. L. Zebedee, and R. A. Lamb.
1992.
Expression of the influenza A virus M2 protein is restricted to apical surfaces of polarized epithelial cells.
J. Virol.
66:5542-5552[Abstract/Free Full Text].
|
| 11.
|
Ivanova, L.,
L. Le, and M. J. Schlesinger.
1995.
Characterization of revertants of a Sindbis virus 6K gene mutant that affects proteolytic processing and virus assembly.
Virus Res.
39:165-179[CrossRef][Medline].
|
| 12.
|
Ivanova, L.,
S. Lustig, and M. J. Schlesinger.
1995.
A pseudo-revertant of a Sindbis virus 6K protein mutant, which corrects for aberrant particle formation, contains two new mutations that map to the ectodomain of the E2 glycoprotein.
Virology
206:1027-1034[CrossRef][Medline].
|
| 13.
|
Klimkait, T.,
K. Strebel,
M. D. Hoggan,
M. A. Martin, and J. M. Orenstein.
1990.
The human immunodeficiency virus type 1-specific protein vpu is required for efficient virus maturation and release.
J. Virol.
64:621-629[Abstract/Free Full Text].
|
| 14.
|
Li, M. L., and V. Stollar.
1995.
A mutant of Sindbis virus which is released efficiently from cells maintained in low strength medium.
Virology
210:237-243[CrossRef][Medline].
|
| 15.
|
Liljeström, P., and H. Garoff.
1991.
Internally located cleavable signal sequences direct the formation of Semliki Forest virus membrane proteins from a polyprotein precursor.
J. Virol.
65:147-154[Abstract/Free Full Text].
|
| 16.
|
Liljeström, P.,
S. Lusa,
D. Huylebroeck, and H. Garoff.
1991.
In vitro mutagenesis of a full-length cDNA clone of Semliki Forest virus: the small 6,000-molecular-weight membrane protein modulates virus release.
J. Virol.
65:4107-4113[Abstract/Free Full Text].
|
| 17.
|
Loewy, A.,
J. Smyth,
C.-H. Von Bonsdorff,
P. Liljeström, and M. J. Schlesinger.
1995.
The 6-kilodalton membrane protein of Semliki Forest virus is involved in the budding process.
J. Virol.
69:469-475[Abstract].
|
| 18.
|
Lusa, S.,
H. Garoff, and P. Liljeström.
1991.
Fate of the 6K membrane protein of Semliki Forest virus during virus assembly.
Virology
185:843-846[CrossRef][Medline].
|
| 19.
|
Pérez, M.,
B. García-Barreno,
J. A. Melero,
L. Carrasco, and R. Guinea.
1997.
Membrane permeability changes induced in Escherichia coli by the SH protein of human respiratory syncytial virus.
Virology
235:342-351[CrossRef][Medline].
|
| 20.
|
Raamsman, M. J.,
J. K. Locker,
A. de Hooge,
A. A. de Vries,
G. Griffiths,
H. Vennema, and P. J. Rottier.
2000.
Characterization of the coronavirus mouse hepatitis virus strain A59 small membrane protein E.
J. Virol.
74:2333-2342[Abstract/Free Full Text].
|
| 21.
|
Sanz, M. A.,
L. Pérez, and L. Carrasco.
1994.
Semliki Forest virus 6K protein modifies membrane permeability after inducible expression in Escherichia coli cells.
J. Biol. Chem.
269:12106-12110[Abstract/Free Full Text].
|
| 22.
|
Schlesinger, M. J.,
S. D. London, and C. Ryan.
1993.
An in-frame insertion into the Sindbis virus 6K gene leads to defective proteolytic processing of the virus glycoproteins, a trans-dominant negative inhibition of normal virus formation, and interference in virus shut off of host-cell protein synthesis.
Virology
193:424-432[CrossRef][Medline].
|
| 23.
|
Strauss, J. H., and E. G. Strauss.
1994.
The alphaviruses: gene expression, replication, and evolution.
Microbiol. Rev.
58:491-562[Abstract/Free Full Text].
|
| 24.
|
Van Kuppeveld, F. J. M.,
J. G. J. Hoenderop,
R. L. L. Smeets,
P. H. G. M. Willems,
H. B. P. M. Kijkman,
J. M. D. Galama, and J. G. Melchers.
1997.
Coxsackievirus protein 2B modifies endoplasmic reticulum membrane and plasma membrane permeability and facilitates virus release.
EMBO J.
16:3519-3532[CrossRef][Medline].
|
| 25.
|
Waite, M. R., and E. R. Pfefferkorn.
1970.
Inhibition of Sindbis virus production by media of low ionic strength: intracellular events and requirements for reversal.
J. Virol.
5:60-71[Abstract/Free Full Text].
|
| 26.
|
Yao, J. S.,
E. G. Strauss, and J. H. Strauss.
1996.
Interactions between PE2, E1, and 6K required for assembly of alphaviruses studied with chimeric viruses.
J. Virol.
70:7910-7920[Abstract].
|
| 27.
|
Zebedee, S. L., and R. A. Lamb.
1989.
Growth restriction of influenza A virus by M2 protein antibody is genetically linked to the M1 protein.
Proc. Natl. Acad. Sci. USA
86:1061-1065[Abstract/Free Full Text].
|
Journal of Virology, August 2001, p. 7778-7784, Vol. 75, No. 16
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.16.7778-7784.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Sanz, M. A., Castello, A., Carrasco, L.
(2007). Viral Translation Is Coupled to Transcription in Sindbis Virus-Infected Cells. J. Virol.
81: 7061-7068
[Abstract]
[Full Text]
-
Sanz, M. A., Madan, V., Carrasco, L., Nieva, J. L.
(2003). Interfacial Domains in Sindbis Virus 6K Protein. DETECTION AND FUNCTIONAL CHARACTERIZATION. J. Biol. Chem.
278: 2051-2057
[Abstract]
[Full Text]
-
Melton, J. V., Ewart, G. D., Weir, R. C., Board, P. G., Lee, E., Gage, P. W.
(2002). Alphavirus 6K Proteins Form Ion Channels. J. Biol. Chem.
277: 46923-46931
[Abstract]
[Full Text]