Previous Article | Next Article 
Journal of Virology, August 2001, p. 7592-7601, Vol. 75, No. 16
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.16.7592-7601.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Requirement for Uracil-DNA Glycosylase during the
Transition to Late-Phase Cytomegalovirus DNA Replication
Charmain Tan
Courcelle,1,
Justin
Courcelle,2
Mark N.
Prichard,3 and
Edward
S.
Mocarski1,*
Department of Microbiology and Immunology,
Stanford University, Stanford, California
943051; Department of Biological
Sciences, Mississippi State University, Mississippi State, Mississippi
397622; and Aviron Inc., Mountain
View, California 940863
Received 31 January 2001/Accepted 4 May 2001
 |
ABSTRACT |
Cytomegalovirus gene UL114, a homolog of mammalian uracil-DNA
glycosylase (UNG), is required for efficient viral DNA replication. In
quiescent fibroblasts, UNG mutant virus replication is delayed for
48 h and follows the virus-induced expression of cellular UNG. In
contrast, mutant virus replication proceeds without delay in actively
growing fibroblasts that express host cell UNG. In the absence of viral
or host cell UNG expression, mutant virus fails to proceed to
late-phase DNA replication, characterized by rapid DNA amplification.
The data suggest that uracil incorporated early during wild-type viral
DNA replication must be removed by virus or host UNG prior to
late-phase amplification and encapsidation into progeny virions. The
process of uracil incorporation and excision may introduce strand
breaks to facilitate the transition from early-phase replication to
late-phase amplification.
 |
INTRODUCTION |
Uracil incorporation into DNA arises
through misincorporation of dUTP by DNA polymerase (2, 51,
54) or from spontaneous deamination of cytosine creating U:G
base pair mismatches that resolve into A:T transition mutations upon
further rounds of replication (23, 44). To avoid the
potential mutagenenic impact of uracil, free-living organisms such as
Escherichia coli, yeast, and human beings encode a
uracil-DNA glycosylase (UNG) that excises this base from DNA (20,
33, 37, 52). A homolog of the mammalian enzyme is encoded by all
poxviruses and herpesviruses, including cytomegaloviruses (CMV), and is
a highly conserved in evolution (8, 25, 38, 39, 50). CMV
UL114 is the most highly conserved open reading frame in mammalian
herpesviruses and retains approximately 40% identity with the major
UNG expressed in human cells. Interestingly, although the major form of
UNG seems to be dispensable in free-living organisms because of backup
uracil-excising activities (3, 6, 35), viral UNG mutants
are impaired in their ability to replicate efficiently under certain
conditions (8, 25, 38, 39, 50). CMV UNG substitution
mutant RC2620 was previously shown to replicate poorly in permissive
human fibroblasts (HF cells) due to a delay in viral DNA accumulation
(38). This phenotype suggested a specialized role for
uracil excision during viral DNA replication.
DNA replication in CMV and other herpesviruses is thought to proceed as
a biphasic process (22). Origin-specific initiation on a
circularized input genome leads to an early, theta mechanism that later
undergoes a switch to a rolling-circle form of replication (1,
16, 17, 22, 40, 48, 49). Rolling-circle replication is
responsible for the bulk of viral DNA produced during infection. This
switch is believed to be a requisite step in replication, but little is
known about the process or how it is regulated (22). Viral
DNA replication is a highly recombinagenic process (7, 41,
55), with late replication, in particular, accompanied by the
accumulation of complex branched DNA structures (43, 45).
Any role for viral UNG in these processes remains poorly understood and
is complicated by the fact that the viral enzyme is dispensable for
replication of herpes simplex virus type 1 (HSV-1) in cultured cell
lines but essential for viral pathogenesis in mice (32).
With the exception of hyperthermophilic archaea (13),
uracil is itself efficiently incorporated and recognized as a template
for the incorporation of adenine by all DNA polymerases. Furthermore,
the observations that DNA replication proceeds normally in E. coli, yeast, and mammals even in the absence of UNG (3, 6,
35) demonstrates that excess uracil is not detrimental to either
DNA replication or cell viability.
Several models have sought to explain the unique requirement of UNG in
viral DNA replication. In poxviruses, where the host UNG cannot
substitute for the viral protein due to the cytoplasmic site of viral
replication, viral UNG plays an essential role in replication, possibly
in association with other proteins of the replication complex
(8). In the herpesviruses HSV-1 and CMV, viral UNG is not
required for replication. Because of the nuclear site of herpesvirus
replication, cellular UNG may substitute for viral UNG (32,
38). Based on the altered in vitro binding characteristics of
the HSV-1 origin-binding protein to a uracil-substituted origin of
replication, Focher and colleagues proposed that UNG may facilitate
removal of uracil before initiation factors bind to this region
(11). This work suggested that UNG may play a role early
in DNA replication. Alternatively, UNG could function later, during the
switch from the theta to the rolling-circle form of replication that
amplifies the viral genome. Base excision may contribute to high levels
of recombination (7, 41, 55) that generates complex
branched DNA structures (43, 45) in infected cells. Uracil
excision or some more direct role carried out by UNG might make free
ends available for recombination and might facilitate the early-to-late
switch in replication. Mammalian UNG is known to interact directly with
the replication fork proteins, DNA polymerase
, replication protein
A, and proliferating nuclear antigen (36, 42) and to
localize with replication complexes in cells (19, 21, 36).
Similarly, CMV UNG associates with the viral DNA polymerase accessory
protein ppUL44 (M. N. Prichard, unpublished results), raising the
possibility that viral UNG may as well be intimately associated with
the viral replication machinery during productive infection.
We set out to distinguish between different models and to better
understand the functional role of UNG in CMV DNA replication. We
identified growth conditions that affect UNG mutant virus replication and have characterized both the uracil content and genomic integrity of
the parental laboratory strain and mutant viruses during the infection cycle.
 |
MATERIALS AND METHODS |
Cells and virus.
Primary human HF cells and human embryonic
lung fibroblasts were maintained in Dulbecco's modified Eagle's
medium (Gibco BRL) supplemented with 10% NuSerum I (Collaborative
Research Inc.), penicillin G (100 U/ml) streptomycin sulfate (100 µg/ml), L-arginine, (0.58 mg/ml), L-glutamine
(1.08 mg/ml), and L-asparagine (180 µg/ml). PA317 cells
(14) were maintained in medium supplemented with 10%
fetal calf serum. Human CMV strain AD169varATCC, here referred to as AD169, was obtained from the American Type Culture Collection and cultured as previously described (26, 47). The recombinant human CMV UNG mutant RC2620, derived from strain AD169varATCC, was described previously (38).
Plasmids.
Plasmid pGEM-3Zf/UNG1A was described previously
(32). Plasmid pON2260 contains a 7.36-kbp
EcoRI-XhoI fragment from cosmid pCM1007
(10), representing nucleotides 119499 to 126856 of the published AD169 strain sequence (4), inserted between
EcoRI and SalI sites of pGEM
3Zf+ (Promega).
Plasmid pON2159 contains a 1.78-kbp EcoRI fragment
(nucleotides 163071 to 164853 of the AD169 genome) encoding the viral
UNG ORF in the MfeI site of pWZLNeo (30).
Infection under serum starvation conditions.
HF cells
(3 × 106) were seeded into 90-mm-diameter tissue
culture plates. Once monolayers were confluent, culture medium was replaced with medium supplemented with 0.2% NuSerum and maintained under these conditions for 72 h. Following this treatment, HF cells were infected with parental AD169 or mutant RC2620 at a multiplicity of infection (MOI) of 5, using 0.2% NuSerum-supplemented medium. At the indicated times postinfection, infected monolayers were
rinsed twice with phosphate-buffered saline, collected by trypsinization, and counted. The cell suspension was pelleted at
1,000 × g in a tabletop centrifuge for 5 min and
stored at
20°C until the time course was completed.
PFA inhibition and release.
Following serum starvation as
described above, monolayers were infected with AD169 or RC2620 at an
MOI of 5 in medium supplemented with 0.2% NuSerum and phosphonoformate
(PFA) at 300 µg/ml. Following adsorption for 1 h, the inoculum
was replaced and infected cell monolayers were maintained in
PFA-containing medium until 72 h postinfection (hpi). At 72 hpi,
PFA inhibition was reversed by extensive rinsing followed by addition
of PFA-free medium supplemented with 0.2% NuSerum. At various times
after reversal, infected cell monolayers were rinsed with
phosphate-buffered saline, trypsinized, counted, sedimented by
centrifugation, and stored at
20°C until the time course was completed.
Isolation of viral DNA and Southern analysis.
Frozen
infected cell pellets were suspended in Tris-EDTA containing 0.5%
sodium dodecyl sulfate and 0.5 mg of proteinase K per ml and incubated
at 55°C overnight. Viral nucleic acids were subjected to
phenol-chloroform extraction with the addition of phase-lock gel (5 Prime
3 Prime) and then ethanol precipitated. Viral DNA from
105 infected cell equivalents was digested with
BamHI, separated on a 0.7% agarose gel, transferred to
nitrocellulose membranes, and hybridized with the indicated
32P-radiolabeled probe. The results were quantitated by
exposure to a PhosphorImager and analyzed using ImageQuant software
(Molecular Dynamics). The data were expressed as a ratio of signal
intensity at each time point compared to intensity at 24 hpi.
Transcript analysis.
Total cellular RNA was purified using
Trizol reagent as recommended by the manufacturer (Gibco BRL). For RNA
blot analysis, 10-µg RNA samples were separated by electrophoresis on
denaturing formaldehyde-1% agarose gels, transferred to
BrightStar-Plus nylon membranes (Ambion), and hybridized with the
indicated biotinylated riboprobes as specified by manufacturer (Ambion).
To prepare a specific probe, cellular UNG was PCR amplified from
pGEM-3Zf/UNG1A using the primer set UNG F1
(5'ATGATCGGCCAGAAGACG3') plus T7 UNG R1
(5'TAATACGACTCACTATAGGGATGATATGGATCCTGTCC3') or UNG F2
(5'CATGGACCTAATCAAGC3') plus T7 UNG R2
(5'TAATACGACTCACTATAGGGGCTCCTTCCAGTCAATGGG3'). Psoralen-biotin-labeled UNG antisense riboprobes were then
generated from the PCR products by in vitro transcription using T7 RNA
polymerase as suggested by the manufacturer (Ambion). Bound
biotin-labeled probes were detected with streptavidin conjugated with
alkaline phosphatase and developed with a chemiluminescent substrate
for the enzyme (Ambion).
HL114 cell construction.
PA317 cells were transfected with
pON2159 by the calcium phosphate method (5). The
transiently produced retrovirus was used to transduce UL114 expression
in low-passage primary human embryonic lung fibroblasts
(28). Infected cell cultures were selected with 400 µg
of Geneticin (G418; Gibco BRL) per ml commencing at 24 hpi and
continuing for 10 days.
CMV virion isolation.
HF or HL114 cells were infected with
AD169 or RC2620 at an MOI of 0.01. Four days after the cells exhibited
100% cytopathic effect, infected cell supernatants were harvested and
cleared of cell debris by centrifugation at 3,300 rpm in a Beckman
J2-21C centrifuge for 30 min at 4°C. Virion particles were sedimented by centrifugation at 28,000 rpm using a SW28 rotor in a Beckman ultracentrifuge for 1 h at 4°C, suspended in medium without
serum, and stored at
80°C.
Uracil content assessment on alkaline denaturing gels.
Viral
DNA was isolated from AD169- or RC2620-infected cells under serum
starvation conditions at the indicated times postinfection. For each
time point, 2-µg samples of viral DNA in 25 µl of Tris-EDTA were
either treated with E. coli 4U UNG (New England Biolabs) or
mock treated for 2 h at 37°C prior to the addition of 0.1 M NaOH
to cleave alkali-labile, apyrimidinic sites created by uracil excision.
The samples were then separated on a 0.5% alkaline denaturing agarose
gel and hybridized overnight with nick-translated (Gibco BRL),
32P-radiolabeled CMV AD169 virion DNA. Results were
quantitated by exposure to a PhosphorImager and analyzed using
ImageQuant software. The average lengths of UNG-treated and
mock-treated viral DNA fragments were then compared. Assay sensitivity
was determined with UV-irradiated viral DNA as described in the text. The irradiated DNA was then processed as described above except that
where indicated, T4 endonuclease V (TEV; New England Biolabs) was used
to specifically cleave pyrimidine dimer sites of DNA.
 |
RESULTS |
Viral UNG is required for efficient CMV replication in confluent
cells.
CMV UNG mutant RC2620, carrying a substitution mutation in
UL114, was previously shown to lack UNG function and exhibit delayed viral DNA synthesis compared to control virus (38). During
the preparation of virus stocks, we observed that the mutant grew slower in confluent HF cell cultures than in subconfluent cultures, suggesting that the requirement for viral UNG was dependent on the
growth status of the infected cell. First, we compared the rates of DNA
accumulation in control AD169 and mutant RC2620 virus-infected contact-inhibited, serum-starved cells. DNA blot analysis (Fig. 1A and
B) revealed that mutant viral DNA levels
in confluent, resting cells were lower than control virus levels at 24, 48, 72, and 96 h hpi. Mutant virus DNA levels became equivalent to control virus levels only at 120 hpi and later over the time course of
infection. Although mutant viral DNA levels were low over the first 96 hpi, some DNA synthesis was clearly detectable during this period. This
observation suggested that the early phase of viral DNA replication had
occurred, but transition to late-phase replication had been delayed in
the absence of viral UNG.

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 1.
Viral DNA accumulation in parental AD169- and mutant
RC2620-infected cells. Shown are DNA blot hybridizations and
corresponding PhosphorImager analyses of AD169 ( ) and mutant RC2620
( ) viral DNA accumulating in confluent, serum-starved HF cells (A
and B) or subconfluent monolayers (C and D) of HF cells. Blots were
probed with 32P-radiolabeled pON2260, specific for CMV
nucleotides 122699 to 124902, to assess the level of viral DNA. Error
bars (B and D) represent standard deviation of the geometric mean of
three replicate samples. m, mock-infected DNA.
|
|
When this analysis was undertaken in subconfluent, actively dividing
cells, mutant RC2620 viral DNA synthesis proceeded with
similar
kinetics as the control virus and even reached slightly
higher levels
(Fig.
1C and D). Thus, the UNG mutant phenotype
that was observed so
clearly in quiescent cells was not observed
in proliferating cells,
suggesting that a cellular factor(s) present
in these cells
complemented viral UNG activity. Previous work
has shown that human UNG
is activated during the cell cycle (
15,
34,
46) and is
highly expressed in proliferating cells (
15).
Based on
these observations, we speculated that the human UNG
present in
actively replicating cells may be responsible for the
efficient mutant
virus
replication.
Complementation of CMV UNG mutant follows induction of human UNG
transcript expression.
The sequence similarity between human UNG
and CMV UL114 extends across all known essential regions (Fig.
2A), consistent with a role for the
cellular enzyme in complementing mutant virus growth. To confirm that
cellular UNG was expressed differently in proliferating cells compared
to confluent cells, we subjected total RNA isolated from cells
maintained under both conditions to blot hybridization analysis using a
human UNG probe (Fig. 2B). As expected (15), UNG
transcript levels were higher in subconfluent, dividing cells than in
confluent, serum-starved cells, suggesting a correlation with their
ability to support UNG mutant virus replication.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 2.
(A) Sequence alignment for UNG proteins encoded by
viruses (CMV, HSV-1, and vaccinia virus) and humans. Regions of
identity are shaded; regions of similarity are shown in blocks.
Asterisks denote the residues which are known to abrogate human UNG
activity (29). (B) RNA blot of total cellular RNA (10 µg/lane) isolated from uninfected, actively dividing cells (lane 1)
and confluent, serum-starved cells (lane 2), hybridized with a
biotinylated antisense riboprobe to human UNG. The arrow indicates the
position of the UNG transcript; positions of the rRNA subunits are
indicated on the left. rRNA was equivalent in all lanes (data not
shown).
|
|
The impact of CMV infection on cellular UNG transcript levels was also
investigated in confluent HF cells collected at 0,
8, and 24 hpi.
Parental virus was found to exhibit a marked induction
of host cell UNG
transcript by 24 hpi (Fig.
3) that
continued
through later times of infection (data not shown). A similar
pattern
was observed in UNG mutant virus-infected cells (data not
shown),
indicating that cellular UNG expression was induced at later
times
following viral infection, independent of viral UNG expression.
These results were consistent with the idea that cellular UNG
may
complement mutant virus and promote the abrupt increase in
mutant virus
DNA replication between 96 and 120 hpi in confluent
cells (Fig.
1A and
B). To address this possibility further, we
investigated mutant and
parental viral DNA accumulation under
conditions where viral DNA
replication was reversibly inhibited
for the initial 72 h of
infection. This block would allow expression
of CMV-induced host genes,
including UNG. If cellular UNG was
able to complement mutant virus
replication, DNA replication of
mutant and parental virus would be
expected to rise in parallel
when the block was released. Serum-starved
HF cells were infected
with mutant RC2620 or control AD169 virus and
maintained in the
presence of the viral DNA polymerase inhibitor PFA
for 72 h. At
this time, the inhibitor was washed out and infection
was allowed
to proceed in the absence of drug for an additional
120 h until
192 hpi, when cells were collected for DNA blot
analysis with
a CMV DNA-specific probe. Autoradiographic and
PhosphorImager
analyses of this blot are shown in Fig.
4. As expected, neither
mutant nor
control viral DNA levels changed during the PFA block;
however, UNG
mutant virus DNA accumulated as rapidly as AD169
following release.
Mutant viral DNA accumulated to maximum levels
within a 2-day period
similar to that observed with parental virus
in the absence of any drug
block (Fig.
1). The UNG mutant defect
was completely reversed under
these conditions, consistent with
a role for host cell UNG in place of
the viral enzyme. Given that
proliferating cells support unhindered
replication of the UNG
mutant and that confluent cells support
replication of this mutant
only after the UNG transcript was induced,
UNG appears to be very
important for late phase viral DNA replication.

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 3.
RNA blot analysis of human UNG transcript during CMV
infection. Total cellular RNA was isolated from uninfected (0 hpi) and
AD169 virus-infected HF cells at 8 and 24 hpi, separated by gel
electrophoresis (10 µg/lane), and transferred to a nylon membrane.
The blot was hybridized with a biotinylated antisense riboprobe to
human UNG; the arrow indicates the position of the cellular UNG
transcript. Positions of the rRNA subunits are indicated on the left.
rRNA was equivalent in all lanes (data not shown).
|
|

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 4.
Viral DNA accumulation in parental AD169 and mutant
RC2620-infected cells in the presence of the DNA replication inhibitor
PFA and following the reversal of the PFA block at 72 hpi (wash-out).
(A) DNA blot of AD169 and mutant RC2620 viral DNA probed with
32P-radiolabeled pON2260. (B) PhosphorImager analysis of
AD169 ( ) and RC2620 ( ). Duration of PFA treatment is indicated by
an open box (+PFA). Error bars represent standard deviation of the
geometric mean of three replicate samples. m, mock-infected DNA.
|
|
Uracil content in virion DNA.
Our observations suggested that
cellular or viral UNG suffices to provide a function that allows viral
DNA amplification to proceed at late times in infection. One possible
explanation for the prolonged growth cycle of mutant RC2620 was that
uracil present in input viral DNA inhibited binding of replication
initiation factors to the viral origin of replication, as suggested in
another herpesvirus replication system (11). We evaluated
the level of uracil incorporation into CMV DNA isolated from parental
and mutant progeny virus particles collected from either normal HF or
HL114 cell culture supernatants. HL114 cells expressed constitutive levels of viral UNG and were capable of complementing the growth defect
of mutant virus (Prichard, unpublished).
To assess the uracil load in CMV DNA, we collected virions from cells
infected at low MOI (0.01), isolated virion DNA, and
treated isolated
DNA with purified
E. coli UNG followed by alkaline
hydrolysis to introduce nicks at sites of uracil incorporatation
into
DNA. The length distribution of DNA fragments arising from
UNG
treatment was compared to that in untreated DNA samples by
alkaline
denaturing agarose gel electrophoresis. The results of
this assay are
shown in Fig.
5 (lanes 1 to 8). We did
not observe
any detectable differences in the size distribution of
parental
or mutant viral DNA regardless of whether viruses were
propagated
on HF or HL114 cells. The majority of UNG-treated viral DNA
migrated
close to the wells and exhibited a size range of greater than
10 kbp. Virion DNA isolated from mutant RC2620 passaged on HF
cells was
observed to contain small DNA species (approximately
0.5 kb) in both
mock-treated and UNG-treated samples. It is unclear
whether these
fragments arise as a result of site-specific cleavage;
however, we have
also observed a similar species in control virion
DNA on occasion. As a
control, viral DNA samples were UV irradiated
at 40 or 80 J/m
2, doses that have previously been shown to induce
cyclobutane
pyrimidine dimers at frequencies of one in 3 kb or one in 6 kb,
respectively (
18,
24). Subsequent (TEV) treatment of
these
samples revealed DNA fragments migrating at the expected sizes,
which validated the assay sensitivity (Fig.
5, lanes 9 to 12).
Comparison of the UNG-treated lanes with the UV-irradiated lanes
indicated that uracil is rare in virion DNA, with less than one
uracil
residue incorporated per 10 kb of DNA (the limit of detection
by this
assay). The low level of uracil present in mutant DNA
argues against
the idea that UNG is strictly required to repair
misincorporated
uracil. This result contrasts somewhat with our
previous determination
that approximately 0.1% of thymidines in
parental virion DNA were
substituted with uracil and that there
were about threefold-greater
levels of uracil in UNG mutant virions
(
38). Measured
either way, levels of uracil in virions were
low, and may have been
further influenced by the use of a different
MOIs or cells for
infection. The low amounts of uracil incorporation
in infecting virus
particles suggests that UNG is not expressed
exclusively to repair
damaged viral DNA prior to the initiation
of early rounds of DNA
replication.

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 5.
Uracil load in parental AD169 and mutant RC2620 virus
particles. DNA was isolated from AD169 (lanes 1, 2, 5, and 6) and
RC2620 (lanes 3, 4, 7, and 8) virions following passage on HF cells
(lanes 1 to 4) or CMV UNG-expressing HL114 cells (lanes 5 to 8). Half
of the viral DNA from each sample was treated with E. coli
UNG to determine uracil levels (lanes 2, 4, 6, and 8). AD169 virion DNA
was also treated with UV and TEV as described in Materials and Methods.
Reaction products were subjected to alkaline denaturing agarose gel
electrophoresis, transferred to a nylon membrane, and probed with
32P-radiolabeled total CMV DNA. The blot is shown
overexposed to reveal minor bands. Positions of the molecular weight
markers are indicated on the left.
|
|
Uracil incorporation and excision during CMV infection.
Delayed initiation of UNG mutant viral DNA synthesis at early times of
infection was not apparently due to increased uracil content of viral
DNA. The behavior of the mutant virus was consistent with a role for
UNG-mediated uracil excision in the transition to late-phase viral DNA
replication. To determine when UNG exerts its impact on CMV DNA
replication, we compared the patterns of uracil incorporation and
excision during a time course of mutant RC2620 and control AD169 virus
replication in serum-starved cells. Equal amounts of isolated total
cellular DNA were denatured and separated on an alkaline denaturing
agarose gels and then probed with CMV DNA to determine the size and
quantity of viral DNA over the course of the viral replication cycle
(Fig. 6). The analysis was performed on
DNA either treated with E. coli UNG or left untreated to
reveal levels of uracil incorporation. Consistent with the experiments
described above, input AD169 DNA exhibited similar patterns of
digestion before and after E. coli UNG treatment, confirming
that the uracil content of input virus DNA was low (Fig. 6A, lane 1, top and bottom). In the early phase of infection, up to 24 hpi, we
observed a gradual loss of viral DNA (Fig. 6A, lanes 3 to 6). Although
the total amount of viral DNA present was at the limit of detection at
these times, uracil incorporation was not detected. By 72 hpi, when
robust DNA amplification had begun in AD169 virus-infected cells, high
levels of uracil incorporation were detected and remained detectable
through later times (Fig. 6A, lanes 8 and 9; Fig. 6B). Thus, these
results demonstrate that although uracil is not abundant in the
infecting genome, CMV incorporates significant amounts of uracil
beginning at the time of rapid DNA amplification late in infection.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 6.
Uracil incorporation during parental AD169 and mutant
RC2620 virus infection. (A and C) DNA blot analysis of viral DNA
isolated from AD169 (A)- and RC2620 (C)-infected HF cells probed with
32P-radiolabeled total viral DNA. Parallel DNA samples from
each time point were treated with E. coli UNG (bottom) or
left untreated (top). Mock-infected cellular DNA (m) is shown in lane 2 of each blot. Positions of the molecular weight markers are indicated
on the left. (B and D) PhosphorImager analyses for selected samples of
AD169 (B) and RC2620 (D) viral DNA either treated with E. coli UNG (+ UNG) or left untreated ( UNG) plotted as a function
of time.
|
|
We next determined whether mutant virus DNA incorporated uracil in a
similar manner. We found that input mutant DNA behaved
similarly to
control virus with or without
E. coli UNG treatment
(Fig.
6C, lane 1), and we detected a similar gradual loss in the
amount of
infecting viral DNA up to 24 hpi (Fig.
6C, lanes 3 to
6). During the
time that corresponded to the period of rapid viral
DNA amplification
(48 hpi and later) in the control virus, we
observed a much more modest
increase of signal with mutant virus
(Fig.
6D). The DNA replication in
UNG mutant virus-infected cells
was not as robust as that in
AD169-infected cells at this time,
with mutant virus DNA accumulating
to approximately 10-fold-lower
levels between 24 and 96 hpi (Fig.
1).
In contrast to parental
virus, we did not detect uracil incorporation
in the smaller amounts
of mutant viral DNA that was replicated during
these times (Fig.
6C, lanes 8 and 9). These results were consistent
with an association
between rapid DNA amplification and incorporation
of uracil that
was dependent on UNG expression. Taken together, these
results
show that the incorporation of uracil into viral DNA late in
infection
is reduced in the UNG mutant at times when replication fails
to
keep up with parental virus. This phenotype correlates with a
role
for UNG in the removal of uracil to promote the transition
to efficient
late phase genome
amplification.
 |
DISCUSSION |
Previously, UNG mutant CMV was found to exhibit a prolonged
replication cycle that corresponded to a delay in DNA replication (38). Here we show that mutant virus replication is slowed
significantly because of a need for UNG to remove uracils from viral
DNA prior to or during robust viral DNA amplification that takes place
late in replication. UNG mutant and control virus DNA carried similar low levels of uracils at the beginning of infection. Uracil
incorporation increased during the transition to the late phase of
infection in control virus. High levels of uracil incorporation appear
to be part of the rapid DNA amplification process during infection, raising the intriguing possibility that uracil turnover controlled the
transition from early- to late-phase CMV DNA replication. The UNG
mutant virus appeared to begin DNA replication at the same time as
parental virus but failed to make the transition to late phase until
levels of induced cellular UNG complemented the defect. The fact that
the initial stages of mutant virus replication proceeded normally, but
the transition to high-level viral DNA amplification was compromised
until host cell UNG was induced, implicates host UNG function in this
process. Thus, our studies suggest that virus-induced host UNG may
replace viral UNG and provide a key viral replication function in
particular cell types during natural infection.
It is thought that herpesvirus DNA replication occurs as a biphasic
process involving a theta mechanism early in replication and proceeding
to rolling-circle form late in replication during which the bulk of
viral DNA is synthesized (1, 16, 17, 22, 40, 48, 49). Much
of the information on replication forms during herpesvirus infection
has been derived from studies of HSV-1. CMV shares a common set of core
replication fork proteins and a similar replication mechanism
(22, 27). Although the most highly conserved of the
herpesvirus-common functions, UNG has not been ascribed a key role in
the herpesvirus replication process. This situation may reflect the
fact that studies on most herpesviruses are carried out with malignant
cell lines where cellular UNG levels are constitutively high, and thus
replication does not rely on the virus-encoded enzyme. An important
role for HSV-1 UNG has been suggested by animal studies where mutant
virus exhibits an attenuated phenotype for both replication and
reactivation from latency in the mouse host (39). These
studies are consistent with a role for this enzyme in certain cell
types that may be reflected in cultured cells such as HF cells,
although this remains to be studied.
Based on in vitro binding studies, Focher and colleagues
(11) proposed that HSV-1-UNG-removes uracils from the
viral replication origin, allowing better recognition of origin
sequences by the initiator protein. In contrast to the predictions of
this hypothesis and to earlier studies carried out with UNG mutant
RC2620 using high-MOI infection (38), we found that
neither parental nor mutant CMV contained significant levels of uracil
in virion DNA or in the input DNA that can be detected early during
infection. Indeed, the uracil content of either control or UNG mutant
virion DNA was very low, representing less than one uracil residue per 10 kb. UNG activity did not appear to be needed for events that lead up
to the initiation of replication. The low level of uracil carried into
cells with the input viral genome seems to preclude a role for uracils
in the early phase of viral DNA synthesis. Uracils incorporated later
during replication must be removed prior to packaging viral DNA, and
this may be carried out by either viral or induced cellular UNG.
During infection, the uracil content of control and mutant viral DNA
remained at similar low levels through 48 hpi. This surprising lack of
uracil incorporation in the presence or absence of UNG expression
suggests that only the late-phase replication machinery may be affected
by this enzyme. We observed a transient increase in uracil
incorporation into CMV DNA corresponding to the start of rapid viral
DNA amplification that normally occurs at this time. The failure of the
viral UNG mutant to enter rapid DNA amplification was associated with a
low uracil content. Rapid DNA amplification occurred at a time when
significant increases in uracil incorporation can be observed. The fact
that the UNG mutant is restricted in its replication at a time when
uracil begins to be incorporated into control virus DNA is most
consistent with a model where CMV UNG promotes some aspect of the amplification.
The mechanism involved in the transition from early- to late-phase
viral DNA replication in any herpesvirus is not known. In the
bacteriophage T4 and lambda systems, efficient late-phase DNA
amplification occurs following a switch from origin-dependent to
recombination-dependent replication (9, 31). Recombination and DNA replication occur at similar times during the herpesvirus life
cycle (7, 55), and frequent recombination is thought to
produce the complex branched DNA structures that have been observed in
studies aimed at resolving HSV-1 replication intermediates (43,
45). These characteristics suggest that the mode of replication seen in the large bacteriophages may occur in herpesviruses as well.
An intriguing possibility suggested by the point of constriction in the
CMV UNG mutant replication cycle is that UNG excises uracils from
replicating DNA to create sites that serve as substrates for initiation
of recombination-dependent replication late in infection (Fig.
7). During the early phase of
replication, DNA synthesis has been proposed (22, 27) to
initiate in a bidirectional, theta mechanism from an origin of
replication (Fig. 7i). During or after the switch to late-phase,
rolling-circle DNA replication, incorporated uracils would become
substrates for the uracil excision by UNG (Fig. 7ii and iii). This
process would lead to free 3' hydroxyl groups in viral DNA due to
cleavage at abasic sites by apurinic/apyrimidinic endonucleases (Fig.
7iii). The induced nicks would occur throughout the genome and would be
available to facilitate the transition to a rolling-circle form of DNA
replication (Fig. 7iv) in a manner similar to that proposed for
bacteriophage lambda (9). UNG-initiated nicks may also
serve as substrates for recombination-mediated strand exchange. Strand
invasion by single-stranded DNA tails generated by the activities of
nucleases or helicases in bacteriophage T4 are thought to promote
pathways of recombination-dependent replication during the late-phase
DNA amplification in this system (31). By analogy, nicks
induced by herpesvirus or mammalian UNG may promote strand invasion and
recombination-mediated replication (Fig. 7v), contributing to levels of
late-phase amplification. In support of a nicking model of initiation,
newly synthesized HSV-1 DNA is known to contain a greater number of
fragments than mature virion DNA arising from single-stranded DNA
breaks and multiple initiation sites (12, 53). Taken
together, these results suggest that nicks generated by UNG may serve a
functional role in herpesvirus DNA replication.

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 7.
Model for late-phase CMV DNA replication using uracil
excision activity (explained in the text). The viral lytic origin of
replication (ori) and sites of single uracil residues (U) are
indicated. The viral replication machinery includes DNA polymerase
(ppUL54), polymerase accessory protein (ppUL44), helicase-primase
complex (ppUL70-ppUL102-ppUL105), and single-stranded DNA binding
protein (ppUL57). AP, apurinic/apyrimidic.
|
|
Consistent with the possibility that viral UNG is involved in the
switch to late-phase DNA amplification, we found that UNG mutant virus
was restricted to low levels of DNA synthesis (approximately 10% of
the parental level) under suboptimal culture conditions. Robust levels
of viral DNA replication were seen only following induction of cellular
UNG. Interestingly, bacteriophage
red mutants replicate
DNA at an abnormally low rate and exhibit a decrease in the total
amount of phage DNA synthesized (9). The similarity in
phenotypes between
recombination mutants and RC2620 further
suggests a link between recombination and late-phase DNA replication in CMV.
Similar mechanisms of late-phase DNA amplification may also be utilized
by other DNA viruses. A vaccinia virus UNG mutant is able to replicate
DNA at approximately 2% of the levels of control virus and does not
transition to high-level, late-phase DNA amplification
(25). The cytoplasmic location of poxvirus DNA replication
apparently prevents the host UNG from complementing the defect in the
way we have observed with CMV. Such studies reinforce a role for UNG in
the early to late-phase DNA replication switch during infection by
poxviruses as well as herpesviruses. Viral UNG may be particularly
important in quiescent or terminally differentiated, nondividing cells
encountered by these viruses in the host.
 |
ACKNOWLEDGMENTS |
We thank Shinya Watanabe for helpful discussions and A. Louise
McCormick and Philip Hanawalt for critical reading of the manuscript. We also thank Ann Ganesan for kindly providing TEV, Sal Caradonna for
plasmid pGEM-3Zf/UNG1A, Denise Galloway for the PA317 packaging cell
line, and Garry Nolan for the retroviral vector pWZLNeo.
This work was supported by PHS grant AI20211.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, Stanford University, Stanford, CA
94305-5124. Phone: (650) 723-6435. Fax: (650) 723-1606. E-mail:
mocarski{at}stanford.edu.
Present address: Office of Agricultural Communications, Mississippi
State University, Mississippi State, MS 39762.
 |
REFERENCES |
| 1.
|
Ben-Porat, T., and S. A. Tokazewski.
1977.
Replication of herpesvirus DNA. II. Sedimentation characteristics of newly synthesized DNA.
Virology
79:292-301[CrossRef][Medline].
|
| 2.
|
Brynolf, K.,
R. Eliasson, and P. Reichard.
1978.
Formation of Okazaki fragments in polyoma DNA synthesis caused by misincorporation of uracil.
Cell
13:573-580[CrossRef][Medline].
|
| 3.
|
Burgers, P. M., and M. B. Klein.
1986.
Selection by genetic transformation of a Saccharomyces cerevisiae mutant defective for the nuclear uracil-DNA-glycosylase.
J. Bacteriol.
166:905-913[Abstract/Free Full Text].
|
| 4.
|
Chee, M. S.,
A. T. Bankier,
S. Beck,
R. Bohni,
C. M. Brown,
R. Cerny,
T. Horsnell,
C. A. I. Hutchison,
T. Kouzarides,
J. A. Martignetti,
E. Preddie,
S. C. Satchwell,
P. Tomlinson,
K. M. Weston, and B. G. Barrell.
1990.
Analysis of the protein-coding content of the sequence of human cytomegalovirus strain AD169.
Curr. Top. Microbiol. Immunol.
154:125-170[Medline].
|
| 5.
|
Chen, C., and H. Okayama.
1987.
High-efficiency transformation of mammalian cells by plasmid DNA.
Mol. Cell. Biol.
7:2745-2752[Abstract/Free Full Text].
|
| 6.
|
Duncan, B. K., and B. Weiss.
1982.
Specific mutator effects of ung (uracil-DNA glycosylase) mutations in Escherichia coli.
J. Bacteriol.
151:750-755[Abstract/Free Full Text].
|
| 7.
|
Dutch, R. E.,
R. C. Bruckner,
E. S. Mocarski, and I. R. Lehman.
1992.
Herpes simplex virus type 1 recombination: role of DNA replication and viral a sequences.
J. Virol.
66:277-285[Abstract/Free Full Text].
|
| 8.
|
Ellison, K. S.,
W. Peng, and G. McFadden.
1996.
Mutations in active-site residues of the uracil-DNA glycosylase encoded by vaccinia virus are incompatible with virus viability.
J. Virol.
70:7965-7973[Abstract].
|
| 9.
|
Enquist, L. W., and A. Skalka.
1973.
Replication of bacteriophage lambda DNA dependent on the function of host and viral genes. I. Interaction of red, gam and rec.
J. Mol. Biol.
75:185-212[CrossRef][Medline].
|
| 10.
|
Fleckenstein, B.,
I. Muller, and J. Collins.
1982.
Cloning of the complete human cytomegalovirus genome in cosmids.
Gene
18:39-46[CrossRef][Medline].
|
| 11.
|
Focher, F.,
A. Verri,
S. Verzeletti,
P. Mazzarello, and S. Spadari.
1992.
Uracil in OriS of herpes simplex 1 alters its specific recognition by origin binding protein (OBP): does virus induced uracil-DNA glycosylase play a key role in viral reactivation and replication?
Chromosoma
102:S67-S71[CrossRef][Medline].
|
| 12.
|
Frenkel, N., and B. Roizman.
1972.
Separation of the herpesvirus deoxyribonucleic acid duplex into unique fragments and intact strand on sedimentation in alkaline gradients.
J. Virol.
10:565-572[Abstract/Free Full Text].
|
| 13.
|
Greagg, M. A.,
M. J. Fogg,
G. Panayotou,
S. J. Evans,
B. A. Connolly, and L. H. Pearl.
1999.
A read-ahead function in archaeal DNA polymerases detects promutagenic template-strand uracil.
Proc. Natl. Acad. Sci. USA
96:9045-9050[Abstract/Free Full Text].
|
| 14.
|
Halbert, C. L.,
G. W. Demers, and D. A. Galloway.
1991.
The E7 gene of human papillomavirus type 16 is sufficient for immortalization of human epithelial cells.
J. Virol.
65:473-478[Abstract/Free Full Text].
|
| 15.
|
Haug, T.,
F. Skorpen,
P. A. Aas,
V. Malm,
C. Skjelbred, and H. E. Krokan.
1998.
Regulation of expression of nuclear and mitochondrial forms of human uracil-DNA glycosylase.
Nucleic Acids Res.
26:1449-1457[Abstract/Free Full Text].
|
| 16.
|
Igarashi, K.,
R. Fawl,
R. J. Roller, and B. Roizman.
1993.
Construction and properties of a recombinant herpes simplex virus 1 lacking both S-component origins of DNA synthesis.
J. Virol.
67:2123-2132[Abstract/Free Full Text].
|
| 17.
|
Jacob, R. J.,
L. S. Morse, and B. Roizman.
1979.
Anatomy of herpes simplex virus DNA. XII. Accumulation of head-to-tail concatemers in nuclei of infected cells and their role in the generation of the four isomeric arrangements of viral DNA.
J. Virol.
29:448-457[Abstract/Free Full Text].
|
| 18.
|
Koehler, D. R.,
J. C. Courcelle, and P. C. Hanawalt.
1996.
Kinetics of pyrimidine (6-4)pyrimidone photoproduct repair in Escherichia coli.
J. Bacteriol.
178:1347-1350[Abstract/Free Full Text].
|
| 19.
|
Krokan, H.
1981.
Preferential association of uracil-DNA glycosylase activity with replicating SV40 minichromosomes.
FEBS Lett.
133:89-91[CrossRef][Medline].
|
| 20.
|
Krokan, H.,
A. Haugen,
B. Myrnes, and P. H. Guddal.
1983.
Repair of premutagenic DNA lesions in human fetal tissues: evidence for low levels of O6-methylguanine-DNA methyltransferase and uracil-DNA glycosylase activity in some tissues.
Carcinogenesis
4:1559-1564[Abstract/Free Full Text].
|
| 21.
|
Lee, K. A., and M. A. Sirover.
1989.
Physical association of base excision repair enzymes with parental and replicating DNA in BHK-21 cells.
Cancer Res.
49:3037-3044[Abstract/Free Full Text].
|
| 22.
|
Lehman, I. R., and P. E. Boehmer.
1999.
Replication of herpes simplex virus DNA.
J. Biol. Chem.
274:28059-28062[Free Full Text].
|
| 23.
|
Lindahl, T., and B. Nyberg.
1974.
Heat-induced deamination of cytosine residues in deoxyribonucleic acid.
Biochemistry
13:3405-3410[CrossRef][Medline].
|
| 24.
|
Mellon, I., and P. C. Hanawalt.
1989.
Induction of the Escherichia coli lactose operon selectively increases repair of its transcribed DNA strand.
Nature
342:95-98[CrossRef][Medline].
|
| 25.
|
Millns, A. K.,
M. S. Carpenter, and A. M. DeLange.
1994.
The vaccinia virus-encoded uracil DNA glycosylase has an essential role in viral DNA replication.
Virology
198:504-513[CrossRef][Medline].
|
| 26.
|
Mocarski, E. S.,
M. Bonyhadi,
S. Salimi,
J. M. McCune, and H. Kaneshima.
1993.
Human cytomegalovirus in a SCID-hu mouse: thymic epithelial cells are prominent targets of viral replication.
Proc. Natl. Acad. Sci. USA
90:104-108[Abstract/Free Full Text].
|
| 27.
|
Mocarski, E. S., and C. T. Courcelle.
2001.
Cytomegaloviruses and their replication, p. 2629-2673.
In
D. M. Knipe, and P. M. Howley (ed.), Fields virology. Lippincott-Raven, New York, N.Y.
|
| 28.
|
Mocarski, E. S.,
G. W. Kemble,
J. M. Lyle, and R. F. Greaves.
1996.
A deletion mutant in the human cytomegalovirus gene encoding IE1(491aa) is replication defective due to a failure in autoregulation.
Proc. Natl. Acad. Sci. USA
93:11321-11326[Abstract/Free Full Text].
|
| 29.
|
Mol, C. D.,
A. S. Arvai,
G. Slupphaug,
B. Kavli,
I. Alseth,
H. E. Krokan, and J. A. Tainer.
1995.
Crystal structure and mutational analysis of human uracil-DNA glycosylase: structural basis for specificity and.
Cell
80:869-878[CrossRef][Medline].
|
| 30.
|
Morgenstern, J. P., and H. Land.
1990.
Advanced mammalian gene transfer: high titre retroviral vectors with multiple drug selection markers and a complementary helper-free packaging cell line.
Nucleic Acids Res.
18:3587-3596[Abstract/Free Full Text].
|
| 31.
|
Mosig, G.
1998.
Recombination and recombination-dependent DNA replication in bacteriophage T4.
Annu. Rev. Genet.
32:379-413[CrossRef][Medline].
|
| 32.
|
Muller-Weeks, S.,
B. Mastran, and S. Caradonna.
1998.
The nuclear isoform of the highly conserved human uracil-DNA glycosylase is an Mr 36,000 phosphoprotein.
J. Biol. Chem.
273:21909-21917[Abstract/Free Full Text].
|
| 33.
|
Myrnes, B.,
K. E. Giercksky, and H. Krokan.
1983.
Interindividual variation in the activity of O6-methyl guanine-DNA methyltransferase and uracil-DNA glycosylase in human organs.
Carcinogenesis
4:1565-1568[Abstract/Free Full Text].
|
| 34.
|
Nagelhus, T. A.,
G. Slupphaug,
T. Lindmo, and H. E. Krokan.
1995.
Cell cycle regulation and subcellular localization of the major human uracil-DNA glycosylase.
Exp. Cell Res.
220:292-297[CrossRef][Medline].
|
| 35.
|
Nilsen, H.,
I. Rosewell,
P. Robins,
C. F. Skjelbred,
G. Daly,
H. E. Krokan,
T. Lindahl, and D. E. Barnes.
2000.
Uracil-DNA glycosylase (UNG)-deficient mice reveal a primary role of the enzyme during DNA replication.
Mol. Cell
5:1059-1065[CrossRef][Medline].
|
| 36.
|
Otterlei, M.,
E. Warbrick,
T. A. Nagelhus,
T. Haug,
G. Slupphaug,
M. Akbari,
P. A. Aas,
K. Steinsbekk,
O. Bakke, and H. E. Krokan.
1999.
Post-replicative base excision repair in replication foci.
EMBO J.
18:3834-3844[CrossRef][Medline].
|
| 37.
|
Percival, K. J.,
M. B. Klein, and P. M. Burgers.
1989.
Molecular cloning and primary structure of the uracil-DNA-glycosylase gene from Saccharomyces cerevisiae.
J. Biol. Chem.
264:2593-2598[Abstract/Free Full Text].
|
| 38.
|
Prichard, M. N.,
G. M. Duke, and E. S. Mocarski.
1996.
Human cytomegalovirus uracil DNA glycosylase is required for the normal temporal regulation of both DNA synthesis and viral replication.
J. Virol.
70:3018-3025[Abstract].
|
| 39.
|
Pyles, R. B., and R. L. Thompson.
1994.
Evidence that the herpes simplex virus type 1 uracil DNA glycosylase is required for efficient viral replication and latency in the murine nervous system.
J. Virol.
68:4963-4972[Abstract/Free Full Text].
|
| 40.
|
Roizman, B.,
G. S. Borman, and M. Kamali-Rousta.
1965.
Macromolecular synthesis in cells infected with herpes simplex virus.
Nature
206:1374-1375[CrossRef][Medline].
|
| 41.
|
Sarisky, R. T., and P. C. Weber.
1994.
Requirement for double-strand breaks but not for specific DNA sequences in herpes simplex virus type 1 genome isomerization events.
J. Virol.
68:34-47[Abstract/Free Full Text].
|
| 42.
|
Seal, G., and M. A. Sirover.
1986.
Physical association of the human base-excision repair enzyme uracil DNA glycosylase with the 70,000-dalton catalytic subunit of DNA polymerase alpha.
Proc. Natl. Acad. Sci. USA
83:7608-7612[Abstract/Free Full Text].
|
| 43.
|
Severini, A.,
D. G. Scraba, and D. L. Tyrrell.
1996.
Branched structures in the intracellular DNA of herpes simplex virus type 1.
J. Virol.
70:3169-3175[Abstract].
|
| 44.
|
Shapiro, R.
1981.
Damage to DNA caused by hydrolysis, p. 3-18.
In
E. Seeburg, and K. Kleppe (ed.), Chromosome damage and repair. Plenum Press, New York, N.Y.
|
| 45.
|
Shlomai, J.,
A. Friedmann, and Y. Becker.
1976.
Replication intermediates of herpes simplex virus DNA.
Virology
69:647-659[CrossRef][Medline].
|
| 46.
|
Slupphaug, G.,
L. C. Olsen,
D. Helland,
R. Aasland, and H. E. Krokan.
1991.
Cell cycle regulation and in vitro hybrid arrest analysis of the major human uracil-DNA glycosylase.
Nucleic Acids Res.
19:5131-5137[Abstract/Free Full Text].
|
| 47.
|
Spaete, R. R., and E. S. Mocarski.
1985.
Regulation of cytomegalovirus gene expression: and promoters are trans activated by viral functions in permissive human fibroblasts.
J. Virol.
56:135-143[Abstract/Free Full Text].
|
| 48.
|
St Jeor, S., and R. Hutt.
1977.
Cell DNA replication as a function in the synthesis of human cytomegalovirus.
J. Gen. Virol.
37:65-73[Abstract/Free Full Text].
|
| 49.
|
Stinski, M. F.
1978.
Sequence of protein synthesis in cells infected by human cytomegalovirus: early and late virus-induced polypeptides.
J. Virol.
26:686-701[Abstract/Free Full Text].
|
| 50.
|
Stuart, D. T.,
C. Upton,
M. A. Higman,
E. G. Niles, and G. McFadden.
1993.
A poxvirus-encoded uracil DNA glycosylase is essential for virus viability.
J. Virol.
67:2503-2512[Abstract/Free Full Text].
|
| 51.
|
Tye, B. K., and I. R. Lehman.
1977.
Excision repair of uracil incorporated in DNA as a result of a defect in dUTPase.
J. Mol. Biol.
117:293-306[CrossRef][Medline].
|
| 52.
|
Varshney, U.,
T. Hutcheon, and J. H. van de Sande.
1988.
Sequence analysis, expression, and conservation of Escherichia coli uracil DNA glycosylase and its gene (ung).
J. Biol. Chem.
263:7776-7784[Abstract/Free Full Text].
|
| 53.
|
Wilkie, N. M.
1973.
The synthesis and substructure of herpesvirus DNA: the distribution of alkali-labile single strand interruptions in HSV-1 DNA.
J. Gen. Virol.
21:453-467[Abstract/Free Full Text].
|
| 54.
|
Wist, E.,
O. Unhjem, and H. Krokan.
1978.
Accumulation of small fragments of DNA in isolated HeLa cell nuclei due to transient incorporation of dUMP.
Biochim. Biophys. Acta
520:253-270[Medline].
|
| 55.
|
Zhang, X.,
S. Efstathiou, and A. Simmons.
1994.
Identification of novel herpes simplex virus replicative intermediates by field inversion gel electrophoresis: implications for viral DNA amplification strategies.
Virology
202:530-539[CrossRef][Medline].
|
Journal of Virology, August 2001, p. 7592-7601, Vol. 75, No. 16
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.16.7592-7601.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Bogani, F., Chua, C. N., Boehmer, P. E.
(2009). Reconstitution of Uracil DNA Glycosylase-initiated Base Excision Repair in Herpes Simplex Virus-1. J. Biol. Chem.
284: 16784-16790
[Abstract]
[Full Text]
-
Bogani, F., Boehmer, P. E.
(2008). The replicative DNA polymerase of herpes simplex virus 1 exhibits apurinic/apyrimidinic and 5'-deoxyribose phosphate lyase activities. Proc. Natl. Acad. Sci. USA
105: 11709-11714
[Abstract]
[Full Text]
-
Luo, M. H., Rosenke, K., Czornak, K., Fortunato, E. A.
(2007). Human Cytomegalovirus Disrupts both Ataxia Telangiectasia Mutated Protein (ATM)- and ATM-Rad3-Related Kinase-Mediated DNA Damage Responses during Lytic Infection. J. Virol.
81: 1934-1950
[Abstract]
[Full Text]
-
Lu, C.-C., Huang, H.-T., Wang, J.-T., Slupphaug, G., Li, T.-K., Wu, M.-C., Chen, Y.-C., Lee, C.-P., Chen, M.-R.
(2007). Characterization of the Uracil-DNA Glycosylase Activity of Epstein-Barr Virus BKRF3 and Its Role in Lytic Viral DNA Replication. J. Virol.
81: 1195-1208
[Abstract]
[Full Text]
-
Lee, A. W., Hertel, L., Louie, R. K., Burster, T., Lacaille, V., Pashine, A., Abate, D. A., Mocarski, E. S., Mellins, E. D.
(2006). Human Cytomegalovirus Alters Localization of MHC Class II and Dendrite Morphology in Mature Langerhans Cells. J. Immunol.
177: 3960-3971
[Abstract]
[Full Text]
-
Hertel, L., Mocarski, E. S.
(2004). Global Analysis of Host Cell Gene Expression Late during Cytomegalovirus Infection Reveals Extensive Dysregulation of Cell Cycle Gene Expression and Induction of Pseudomitosis Independent of US28 Function. J. Virol.
78: 11988-12011
[Abstract]
[Full Text]
-
Abate, D. A., Watanabe, S., Mocarski, E. S.
(2004). Major Human Cytomegalovirus Structural Protein pp65 (ppUL83) Prevents Interferon Response Factor 3 Activation in the Interferon Response. J. Virol.
78: 10995-11006
[Abstract]
[Full Text]
-
Yu, D., Silva, M. C., Shenk, T.
(2003). Functional map of human cytomegalovirus AD169 defined by global mutational analysis. Proc. Natl. Acad. Sci. USA
100: 12396-12401
[Abstract]
[Full Text]
-
Hertel, L., Lacaille, V. G., Strobl, H., Mellins, E. D., Mocarski, E. S.
(2003). Susceptibility of Immature and Mature Langerhans Cell-Type Dendritic Cells to Infection and Immunomodulation by Human Cytomegalovirus. J. Virol.
77: 7563-7574
[Abstract]
[Full Text]
-
Priet, S., Navarro, J.-M., Gros, N., Querat, G., Sire, J.
(2003). Functional Role of HIV-1 Virion-associated Uracil DNA Glycosylase 2 in the Correction of G:U Mispairs to G:C Pairs. J. Biol. Chem.
278: 4566-4571
[Abstract]
[Full Text]
-
De Silva, F. S., Moss, B.
(2002). Vaccinia Virus Uracil DNA Glycosylase Has an Essential Role in DNA Synthesis That Is Independent of Its Glycosylase Activity: Catalytic Site Mutations Reduce Virulence but Not Virus Replication in Cultured Cells. J. Virol.
77: 159-166
[Abstract]
[Full Text]
-
Chen, R., Wang, H., Mansky, L. M.
(2002). Roles of uracil-DNA glycosylase and dUTPase in virus replication. J. Gen. Virol.
83: 2339-2345
[Abstract]
[Full Text]
-
Strive, T., Borst, E., Messerle, M., Radsak, K.
(2002). Proteolytic Processing of Human Cytomegalovirus Glycoprotein B Is Dispensable for Viral Growth in Culture. J. Virol.
76: 1252-1264
[Abstract]
[Full Text]