INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

The current human immunodeficiency virus (HIV) pandemic has affected a cumulative total approaching 40 million people, and the search for an AIDS vaccine continues. Live viral vectors are leading candidates in the hunt for a potential vaccine. Several viral vectors have showed promise in simian immunodeficiency virus (SIV) protection experiments in monkeys (11, 18, 53, 58), and numerous other viral vector systems are in earlier testing phases of vaccine development (8, 12, 14, 71, 73).

Poliovirus is an attractive live viral vector for several reasons. The Sabin live poliovirus vaccine is one of the best human vaccines in the world. It produces long-lasting immunity (59, 75) and herd immunity (75); it is very safe and easy to experimentally manipulate (47); it has a proven safety and efficacy record in over 1 billion vaccinees (75); it is inexpensive to produce and to distribute in developing countries (29); and, most importantly, it produces a potent mucosal immune response (51, 56, 79). The capacity of poliovirus to generate a strong mucosal immune response is particularly important given that more than 90% of HIV type 1 (HIV-1) infections worldwide have occurred via sexual transmission (77). Any strategy to control the AIDS pandemic must include a vaccine that prevents sexual transmission of HIV-1.

With the exception of live-attenuated viruses (which are generally considered too pathogenic for use in humans [7, 68]), no candidate AIDS vaccine has been demonstrated to consistently provide protection against mucosal challenge with a highly virulent simian immunodeficiency virus (SIV). Direct inoculation of a subunit vaccine into the iliac lymph nodes of macaques did provide protection against a rectal mucosal challenge with a virulent SIV (34), although that subunit vaccine was unable to consistently protect against infection after a vaginal challenge with the highly virulent SIVmac251 (40). Those experiments suggest that generating local mucosal immunity may be as important as other characteristics of the anti-SIV immune response generated by candidate vaccines.

More vaginal challenge experiments need to be done, because an AIDS vaccine needs to protect against vaginal-penile sexual transmission of HIV. At this point in time, there have been relatively few SIV vaginal-challenge experiments, and no vaccine vector has been demonstrated to provide any protection against a vaginal challenge.

We have previously reported the development of a recombinant poliovirus live viral vector system in which we inserted an immunogenic gene fragment of interest at the junction between the genes encoding the capsid proteins and the nonstructural proteins (the P1/P2 junction) in the poliovirus polyprotein reading frame (76). The gene fragment is expressed with the rest of the poliovirus genome as part of the polyprotein and is cleaved away from the polyprotein via the activity of poliovirus-encoded protease 2A^pro, which cleaves at engineered proteolytic sites flanking the insert (76). That recombinant poliovirus live viral vector was tested in mice susceptible to poliovirus infection and was demonstrated to elicit strong antibody (76) and cytotoxic-T-lymphocyte (42, 72) responses.

In a study in which we immunized four cynomolgus macaques with two recombinant polioviruses expressing SIV antigens, we further demonstrated that poliovirus vectors are immunogenic in primates. Significant humoral, mucosal, and cellular anti-SIV immune responses were elicited (15). Notably, all macaques generated a mucosal anti-SIV immunoglobulin A (IgA) antibody response in rectal secretions, and strong anti-SIV serum IgG antibody responses lasting for at least 1 year were detected in two of the four monkeys (15).

Here we report the development of Sabin vaccine-based vectors that we used to produce a defined series of SabRV1- and SabRV2-SIV viruses containing SIV gag, pol, env, nef, and tat in overlapping fragments. We then evaluated the safety, immunogenicity, and protective efficacy of the SabRV1-SIV-SabRV2-SIV candidate SIV vaccine. Strikingly, four of seven vaccinated monkeys showed substantial protection against SIV viremia after a vaginal challenge with the highly virulent SIVmac251. Two of those vaccinated animals appear to have been completely protected by the SabRV1-SabRV2-SIV vaccine; all seven of the vaccinated monkeys have remained healthy for over 48 weeks postchallenge, while three of six control monkeys developed clinical AIDS. These results suggest that a Sabin-based viral vector may be a promising approach for developing a vaccine for the prevention of mucosal transmission of HIV.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Plasmids. The Sabin 1 plasmid (which we call pS1 for simplicity) was kindly provided by A. Nomoto [construct pVS(1)IC-0 (25, 33, 57)]. The entire Sabin 1 cDNA in pS1 was sequenced in our laboratory by the fluorescent dye terminator method, using an ABI 310 machine (Perkin-Elmer Applied Biosystems, Foster City, Calif.). The accuracy of the genome sequence as published (54) was confirmed. To construct pSabRV1, first the EcoRI and XhoI sites upstream of the T7 promoter of pS1 were eliminated by inserting a SalI linker (oligonucleotides C and D) at that position to create plasmid pS1XT. Then the 747-bp BstEII fragment of pMoV2.11containing the duplicated 2A^pro cleavage site, the 5-glycine spacer, and the EcoRI, NotI, and XhoI cloning siteswas swapped into pS1XT to create pSabRV1. The accuracy of the pSabRV1 construct was confirmed by restriction digestion and sequencing of the DNA. This DNA swap between pMoV2.11 and Sabin 1 results in Sabin 1 gaining three wild-type (wt) coding changes in 2A and one in 2B. None of the changes is associated with neurovirulence or other wt phenotypes. All pSabRV1 plasmids contain an Amp^r selectable marker. Plasmids pS1, pS1XT, and pSabRV1 were electroporated into SURE cells (Stratagene, La Jolla, Calif.), which were plated on Luria-Bertani (LB) plus ampicillin agar plates and incubated for 20 to 24 h at 37°C. Single colonies were then inoculated into 50-ml cultures of Luria broth plus ampicillin (50 µg/ml) and grown at 30°C for 16 to 18 h. (Note that growth conditions for the Sabin 1 derivative plasmids [pS1, pS1XT, and pSabRV1] are specific because rearrangements of the plasmids and very low plasmid yields are frequently seen otherwise.) Plasmid DNA was isolated from cells by the QiaFilter Midiprep technique (Qiagen, Santa Clarita, Calif.).

View larger version (93K): [in this window] [in a new window]   FIG. 1.   (A) Recombinant Sabin poliovirus vector plasmid clones. Grey boxes indicate 2A proteolytic cleavage sites (GLTTY/GFGH). In both the pSabRV1 and pSabRV2 vectors, the first proteolytic-cleavage-site coding sequence is followed by a 5-glycine spacer (not marked) and, immediately prior to the second proteolytic cleavage site, the in-frame cloning sites (white boxes). In total, an additional 60 to 70 nt are added to the viral genome to create the vector. (B) Plaque assay of cloned Sabin 1 virus (pS1 derived) and the Sabin 1 recombinant virus vector (SabRV1) at 32°C. (C) Plaque assay of cloned Sabin 2 (pS2-10F derived) and the Sabin 2 recombinant virus vector (SabRV2) at 37°C. (D) SabRV1-SIV plaque assays. The titers of all SabRV1-SIV viruses made were determined by plaque assay. Growth of several representative viruses at 32°C is shown here. SabRV1 without an insert is shown as a control. (E) SabRV2-SIV plaque assays. The titers of all SabRV2-SIV virus constructs were determined by plaque assay. Growth of several representative viruses at 37°C is shown here. SabRV2 without an insert is shown as a control. (F) Library schematic. Map of SIV antigens used in SabRV1-SIV and SabRV2-SIV vaccine cocktails. Each of the numerically labeled fragments corresponds to the different SabRV-SIV constructs defined in Table 1.

Oligonucleotides. The oligonucleotides used in this study were as follows: A, GGTGGGGGAGGTGAATTCATGGTGAGCAAGGGCGAGGAG; E, GTGGTCAGATCCTCGAGCTTGTACAGCTCGTCCATGCCG; C, AATTGGTTCCTGGTCGACCGATGATCCGCG; D, TCGACGCGGATCATCGGTCGACCAGGAACC; B1, ACATATTCGAGATTTGAC; B2, TGCGGCCGCTGCCCTAGGCCCTCCGCCACCTCCATGACCGAAACCGTATGTGGTCAGACCCTTTTCTGG; S1, GGTTTCGGTCATGGAGGTGGCGGAGGGCCTAGGGCAGCGGCCGCAGGATTAACGACTTATGGA; S2, GCTCAATACGGTGCTTGC; SAB21, AAAAGGTCGACTAATACGACTCACTATAGGTTAAAACAGCTCTGGGGTTG; SAB24, GGGGGAAGCTTAGGCCTTTTTTTTTTTTTTTTTTTTCCTCCGAATTAAAGAAAAAT; S1-3240F, CCTCCAAAATCAGAGTGTATC; S1-3580R, GCCCTGGGCTCTTGATTCTGT; S2-3151F, GAAGGCGATTCGTTGTAC; and S2-3518R, CTTGATTCAGCCACTAAG.

Transcriptions and electroporations. Transcriptions were generally performed with T7 RNA polymerase (150 U; New England Biolabs), using the supplied transcription buffer supplemented with 40 U of RNasin (Promega, Madison, Wis.) and 1.25 mM each nucleoside triphosphate. Plasmid templates (1 to 3 µg) were first linearized with ClaI (pS1 or pSabRV1 vector) or HindIII (pS2-10F or pSabRV2) for 1 h at 37°C in a 20-µl volume. The restriction enzyme was then inactivated for 10 min at 65°C. Once linearized, plasmid template was added to the complete transcription mixture (total volume, 200 µl), and transcription was allowed to proceed for 60 to 90 min at 37°C before the reaction was terminated by freezing the mixture at 80°C. The RNA's quality and quantity were assessed by agarose gel electrophoresis before its use in subsequent experiments. RNA from transcription reactions was used directly, without purification, in electroporations.

Viral stocks, passages, and plaque assays. P₀ viral stocks were harvested from electroporated cells exhibiting full CPE by taking the cells and supernatant and freezing-thawing three times, using a dry ice-ethanol bath and a 37°C water bath. Cellular debris was then pelleted by a 5-min, 300 × g centrifugation, and P₀ viral stock supernatant was transferred to a fresh tube. The titers of some of the MoV2.11, SabRV1, and SabRV2 recombinant viral stocks appeared to be reduced by multiple freeze-thaw cycles. (This was not observed with normal wt poliovirus.) Therefore, viral stocks were stored in constant-temperature 30°C or 80°C freezers.

View larger version (33K): [in this window] [in a new window]   FIG. 2.   Propagation of vaccine viruses. (A) Stability of SabRV2 recombinant viruses passaged as a cocktail. Nine SabRV2-SIV viruses were mixed in equal amounts and passaged five times at an MOI of 0.1, for a total of at least 10 generations of viral replication. The P1 virus is conservatively estimated as generation 2. Cocktail stocks were tested for the presence of the SIV inserts by RT-PCR using primers corresponding to the poliovirus sequence flanking the SIV inserts. The lane containing the SabRV2 empty-vector RT-PCR product is indicated by a V. The size of the SabRV2 band (427 bp) is the size of the virus containing no insert. Inserts were fully retained throughout all five passages. (B) Composition of SabRV2 cocktail over a series of passages. The passaged cocktail stocks were checked for the presence of the individual viruses by RT-PCR with primers specific for each SIV insert. Generation 1 indicates the original cocktail in which the nine P0 viral stocks obtained directly from high-efficiency transfections were mixed in equal proportions. The generation 1 stock contained all nine viruses, as determined by RT-PCR. The middle and right panels show the presence of all nine SabRV2-SIV viruses both at generation 6 and at generation 10. The small bands present in Env15C and Env17 are minor deletion products representing less than 1% of the virus population (data not shown).

RT-PCR of recombinant polioviruses. HeLa cells (2 × 10⁵ to 5 × 10⁵) in six-well dishes were infected with the appropriate virus at an MOI of 0.5 to 10 (an MOI of 10 was used if possible). Cells were incubated at 37°C in 1 ml of DMEM-F12 plus 10% FCS for 6 to 8 h and then harvested by scraping or trypsinization. RNA was collected by using an RNeasy kit, and cDNA was synthesized by using randomly primed Superscript II (Life Technologies) reactions. PCR was done using rTth (Perkin-Elmer XL polymerase) and primers S1-3240F and S1-3580R (MoV2.11, S1, and SabRV1 recombinants) or primers S2-3151F and S2-3518R (S2-10F and SabRV2 recombinants). Conditions were as follows: 0.5 µl of cDNA, 2.2 mM magnesium acetate, 0.5 µl of XL polymerase, and manufacturer-recommended buffer and primer concentrations in a 50-µl reaction mixture, with 30 cycles consisting of 94°C for 1 min, 50°C for 1 min, and 72°C for 1 min. Generally 1 to 5 µl of the final product was loaded on a 1.5% agarose gel for analysis.

Animals. All animals used in this study were mature, cycling, female cynomolgus macaques from the California Regional Primate Research Center. The animals were housed in accordance with American Association for Accreditation of Laboratory Animal Care standards. When necessary, animals were immobilized by intramuscular injection of 10 mg of ketamine HCl (Parke-Davis, Morris Plains, N.J.) per kg of body weight. The investigators adhered to the recommendations set forth in the Guide for the Care and Use of Laboratory Animals (14a). Prior to use, animals were negative for antibodies to HIV-2, SIV, type D retrovirus, and simian T-cell leukemia virus type 1.

Serum and vaginal- and rectal-lavage antibody responses. Anti-SIV IgG and IgA responses in vaginal and rectal washes and serum were measured at weekly time points during the study. Vaginal and rectal wash samples were collected and analyzed as previously described (38, 40, 48). Briefly, vaginal washes were collected by infusing 2 ml of sterile phosphate-buffered saline into the vaginal canal and aspirating the instilled volume. Rectal washes were collected in a comparable manner. Samples were immediately snap-frozen on dry ice and stored at 80°C until analysis. To account for the presence of IgG interfering with and reducing the detection of IgA, serum was first depleted of IgG by using protein G-Sepharose beads (Pharmacia Biotech, Uppsala, Sweden) prior to its use in the IgA enzyme-linked immunosorbent assay (ELISA). To deplete IgG, 25 µl of serum sample was incubated with 100 µl of protein G-Sepharose beads for 1 h at 37°C and then at 4°C overnight; subsequently, the protein G-Sepharose was pelleted and the supernatant was collected. During this process, samples were diluted 1:3. The change in optical density (OD) between test and control wells was defined as the difference between the mean OD of sample tested in two antigen-coated wells and the mean OD of the sample tested in two antigen-free control wells. The negative-control OD value was determined from 12 uninfected monkey serum samples and defined stringently as the average OD plus 3 standard deviations. Endpoint titers were determined if the OD of the test sample exceeded the negative-control value by a factor of 2. To then quantify anti-SIV antibody titers, serial fourfold dilutions of duplicate samples of serum, vaginal wash, or rectal wash were tested by an ELISA using whole pelleted SIVmac251 (Advanced Biologics Inc., Columbia, Md.). Antibody binding was detected with peroxidase-conjugated goat anti-monkey-IgG (Fc) or -IgA (Fc) (Nordic Laboratories, San Juan Capistrano, Calif.) and developed with o-phenylenediamine dihydrochloride (Sigma). The endpoint titer was defined as the reciprocal of the last dilution giving a OD greater than 0.1 (15).

Neutralizing-antibody responses. Neutralizing-antibody assays were performed as previously described (11, 50). A neutralizing-antibody titer was defined as the dilution resulting in 50% inhibition of cell killing by lab-adapted SIVmac251.

SIV isolation and serum viral RNA load determination. Virus was isolated from heparinized whole blood obtained from the SIV-inoculated cynomolgus macaques. Peripheral blood mononuclear cells (PBMCs) were isolated by Ficoll gradient separation (Lymphocyte Separation Medium; Organon Teknika, West Chester, Pa.) and cocultured with CEMx174 cells (28) (provided by James A. Hoxie, University of Pennsylvania, Philadelphia) as previously described (37). PBMCs (5 × 10⁶) were cocultivated with CEMx174 cells (2 × 10⁶ to 3 × 10⁶). Aliquots of the culture medium were regularly obtained and assayed for the presence of the SIV major core protein (p27) by antigen capture ELISA (37). Cultures were considered positive if they were antigen positive at two consecutive time points. A detailed description of the technique and criteria used to determine whether the culture medium was antigen positive has been published (43). All cultures were maintained for 8 weeks and tested for SIV p27 by ELISA before being scored as virus negative. Blood samples for virus isolation were collected at the times indicated in Table 2. SIV RNA loads (see Fig. 9) were determined by a modification (J. D. Lifson, unpublished data) of a real-time RT-PCR assay on monkey plasma samples, performed essentially as previously described (74). The assay has a threshold sensitivity of 100 copy equivalents/ml of plasma and an interassay coefficient of variation of <25%.

SIV provirus PCR analysis. Nested PCR was carried out on PBMC genomic DNA in a DNA thermal cycler (Perkin-Elmer) as previously described (48). Briefly, cryopreserved PBMCs isolated from whole blood of each monkey in the experiment were washed three times in Tris buffer at 4°C and resuspended at a density of 10⁷ cells/ml. Ten microliters of the cell suspension was added to 10 µl of PCR lysis buffer (50 mM Tris-HCl [pH 8.3], 0.45% NP-40, 0.45% Tween 20) with 200 µg of proteinase K/ml. The cells were incubated for 3 h at 55°C and then for 10 min at 96°C. Two 30-cycle rounds of amplification were performed on aliquots of plasmid DNA containing the complete genome of SIVmac1A11 (positive control) or aliquots of cell lysates, using conditions described elsewhere (48). The primers used specifically amplify SIV Gag. DNA from uninfected CEMx174 cells was amplified as a negative control in all assays to monitor potential reagent contamination. -Actin DNA sequences were amplified from all PBMC lysates by two rounds of PCR (30 cycles/round) to detect potential inhibitors of Taq polymerase. Following the second round of amplification, a 10-µl aliquot of the reaction product was removed and electrophoresed on a 1.5% agarose gel. Amplified products in the gel were visualized by ethidium bromide staining. Blood samples for PCR analysis were collected at the times indicated in Table 3.

Western blot analysis of serum antibody responses. HeLa cells (2 × 10⁶) infected with wt poliovirus were incubated for 7 h at 37°C. Cells were harvested and lysed on ice for 1 min (the lysis buffer consisted of 10 mM Tris [pH 7.5], 140 mM NaCl, 5 mM KCl, and 1% IGEPAL [Sigma, St. Louis, Mo.]), and the nuclei were removed by centrifugation. Poliovirus-infected whole-cell lysate (20 µl) and sucrose-gradient-purified SIVmac251 (ABI, Columbia, Md.; 22 µg) were electrophoresed in parallel lanes through a sodium dodecyl sulfate-10 or 12% polyacrylamide gel and analyzed by immunoblotting. The anti-SIV serum used as a positive control for SIV proteins was pooled serum from SIV-infected rhesus macaques. The antipoliovirus serum used as a positive control for poliovirus proteins was obtained from a poliovirus-immune human. Antisera from all vaccinated cynomolgus macaques were used as primary antibodies (serum collected on the day of challenge was used for monkeys 27270, 27244, 28508, 27273, and 27253, while serum collected 1 month prior to challenge was used for monkeys 25231 and 27250). Also, preimmune serum from monkey 27250 was used. The secondary antibody (horseradish peroxidase-conjugated rabbit anti-human IgG) was obtained from DAKO (Carpinteria, Calif.) and used for monkeys 27270, 27244, 28508, 27273, 27253, and 27250 (preimmune). A horseradish peroxidase-conjugated rabbit anti-rhesus monkey IgG (Sigma, St. Louis, Mo.) was used for monkeys 25231 and 27250, employing serum obtained 1 month prechallenge. Blots were probed with 1:100-diluted monkey serum in TBST (10 mM Tris-HCl [pH 7.5], 150 mM NaCl, 0.15% Tween 20) with 10% fat-free dry milk (Bio-Rad, Hercules, Calif.), washed twice in TBST containing 0.15% Tween 20 and once in TBST containing 0.5% Tween 20, probed with the secondary antibody (1:2,000 dilution), and then detected by enhanced chemiluminescence (ECL; Amersham, Arlington Heights, Ill.) as specified by the manufacturer. Rhesus monkey serum was used at a dilution of 1:200, and poliovirus-immune human serum was used at a dilution of 1:25. Films were digitally scanned and exported to Photoshop 5.5 (Adobe, San Jose, Calif.).

Statistical methods. SIV viremia levels were analyzed by Student's t test by comparison of the 24- to 32-week average log viral load of each animal in the two groups (vaccinated:control) with a two-tailed distribution. Weight gain (or loss) was analyzed by the Mann-Whitney rank test of the 33- to 44-week average weight change (from day of challenge) of each animal in the two groups (vaccinated versus control) with a two-tailed distribution. Mortality differences between the two groups at week 48 were analyzed by Fisher's exact test.

Lymphocyte proliferative responses to SIV antigens. Antigen-specific proliferation was tested as described elsewhere, using PBMCs from fresh blood samples (46). The cells were suspended at a density of 2 × 10⁶ per ml in RPMI 1640 medium supplemented with 10% FCS and plated in triplicate at 50 µl per well in 96-well round-bottom microtiter plates. Antigen dilutions or control reagents were plated at 50 µl per well. Fresh medium (100-µl volumes) was added after 48 h, and the plates were incubated for 7 days in a CO₂ incubator. The wells were pulsed with [³H]thymidine (1 µCi per well; NEN-DuPont Co., Wilmington, Del.) overnight prior to harvest. The plates were aspirated onto fiberglass filters and washed with a cell harvester (Inotech Biosystems International, Lansing, Mich.). The filters were saturated with scintillation cocktail, and counts in the ³H window were measured with a 96-well scintillation counter (Microbeta 1450; Wallac Biosystems, Gaithersburg, Md.). The SIV antigen was whole inactivated SIVmac239 (kindly provided by Larry Arthur). Concanavalin A (ConA) was tested as a positive-control antigen. Medium alone was used as a control for spontaneous proliferation. The antigens were tested at 0.1, 1.0, and 10 µg/ml in every assay. This assay was used in our previous study (15). Lymphocyte proliferation assays were performed before immunization and at regular intervals after immunization (data not shown), using PBMCs. Because of an unusually high level of spontaneous proliferation (~10,000 to 100,000 cpm/well) in negative-control wells (PBMCs plus medium alone) at all time points tested over a 28-week period, it was difficult to assess SIV-specific CD4⁺ T-cell responses in the immunized animals, since minimal additional stimulation was seen in the presence of antigen or ConA.

SIV-specific CTL responses. The presence of SIV-specific cytotoxic T lymphocytes (CTLs) in cynomolgus PBMCs was assessed as previously reported (15). Briefly, PBMCs from immunized monkeys were stimulated with ConA (Sigma) at a concentration of 10 µg/ml and cultured for 14 days in complete RPMI 1640 medium supplemented with 5% human-lymphocyte-conditioned medium (human interleukin-2; Hemagen Diagnostics, Waltham, Mass.). Autologous B cells were transformed by herpesvirus papio (595Sx1055 producer cell line, provided by M. Sharp, Southwest Foundation for Biomedical Research, San Antonio, Tex.) and infected overnight at an MOI of 30 with wt vaccinia virus (vvWR) or a recombinant vaccinia virus expressing the p55^gag (vv-gag) or gp160^env (vv-env) protein of SIVmac239 (provided by L. Giavedoni and T. Yilma, University of California, Davis). The level of vaccinia virus infection of target cells was estimated by an indirect-immunofluorescence technique using a monkey anti-vaccinia virus antibody followed by fluoresceinated goat anti-human IgG (Vector Laboratories, Burlingame, Calif.). The level of vaccinia virus infection of target cells in this series of experiments was estimated to fall between 5 and 15%. Target cells were labeled with 50 µCi of ⁵¹Cr (Na₂CrO_4; Amersham, Arlington Heights, Ill.) per 10⁶ cells. Effector and target cells were added together at multiple effector/target ratios in a 4-h chromium release assay. Assays were considered reliable if specific lysis was >10% and at least twice the level of spontaneous lysis of vvWR-infected cells. At many time points, the data from the CTL assays could not be meaningfully interpreted because of a high level of spontaneous lysis of the cynomolgus macaque transformed B-cell targets. Lysis was not due to NK cell activity, since no lysis was seen when the NK target cell line K562 was substituted as a negative control (data not shown). Numerous variations of the CTL assay were attempted in an effort to generate consistently reliable chromium release assay data for immunized or infected cynomolgus macaques. Cold-target inhibition, a variety of stimulation procedures, and enrichment of CD8⁺ cells by using anti-CD8 bead purification failed to consistently resolve this problem.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Sabin-based vaccine vector construction and production. Given the excellent safety record of Sabin vaccine strain polioviruses in humans (75), we wished to do all future experiments, in primates and humans, with only Sabin-based viruses produced from molecularly defined constructs. Hence, we engineered new plasmid clones of Sabin 1- and Sabin 2-derived vectors (pSabRV1 and pSabRV2, respectively) (Fig. 1A to C). We then constructed a collection of 20 SabRV1 viruses, expressing SIV gag, pol, env, and nef, which represent nearly the entire SIV genome (Fig. 1F and Table 1). These viruses grew well, as assessed by plaque assay (Fig. 1D). Twenty SabRV2-SIV viruses were produced in a comparable manner, being selected to represent a similar coverage of the major SIV genes plus Tat (Fig. 1F and Table 1). These viruses also grew well, as assessed by plaque assay (Fig. 1E). In some cases, there were difficulties in producing genetically pure stocks by the use of recombinant polioviruses, since viruses with deletions in their insert sequences can accumulate as recombinant polioviruses replicate through a number of generations (15, 52, 76). Therefore, we took great care to check the viral stocks for deletions. We did so by using a sensitive RT-PCR assay capable of detecting deleted virus comprising as little as 0.1% of the stock (data not shown). The SabRV1-SIV vaccine stocks were more than 99.9% pure in total (data not shown), as were the SabRV2-SIV stocks (Fig. 2B). To further test the viability and stability of the recombinant viruses, a cocktail of nine of the SabRV2-SIV viruses was then passaged repeatedly and assessed by RT-PCR (Fig. 2). The vaccine cocktail as a whole maintained the SIV sequences for at least 10 generations (Fig. 2A), and all of the individual component viruses maintained their inserts and viability (Fig. 2B).

Monkey immunizations. Producing a candidate SIV vaccine in two different serotypes of poliovirus (type 1 and type 2 strains) was a strategy employed in our last macaque study to create a better opportunity for an effective booster immunization with the second vector serotype, since there is no significant cross-neutralization or cross-protection between these two serotypes. That approach resulted in anemnestic booster responses in the immunized animals (15) and led us to utilize the same strategy in the study reported here.

View larger version (7K): [in this window] [in a new window]   FIG. 3.   Time line of vaccination and challenge. The numbers above the line indicate the weeks at which the various steps were performed.

Immunization induces strong serum anti-SIV IgG and IgA responses. The results of ELISAs for serum IgG and IgA responses against SIV are shown in Fig. 4. All seven monkeys exhibited a rapid and strong anti-SIV IgG response after immunization with SabRV1-SIV (Fig. 4A). Three of the seven monkeys showed serum anti-SIV IgA responses, and in two of those animals the SabRV1-SIV-elicited IgA responses persisted for at least 19 weeks (Fig. 4B).

View larger version (17K): [in this window] [in a new window]   FIG. 4.   Serum anti-SIV antibodies. (A) Anti-SIV IgG titers in the sera of monkeys immunized with SabRV1-SIV and SabRV2-SIV. Seven cynomolgus macaques were inoculated intranasally with SabRV1-SIV at weeks 0 and 2 (indicated by  below) and given intranasal boosters at weeks 19 and 21 with SabRV2-SIV (indicated by  below). Monkeys are labeled as follows: 25231, ; 27244, ; 27250, ; 27253, ; 27270, ; 27273, ; and 28508, . Titers indicated are reciprocal dilutions. A titer of 1 is stringently defined as an ELISA optical density reading 3 standard deviations above the average optical density for a group of negative-control monkeys (see Materials and Methods). (B) Anti-SIV IgA titers in the sera of SabRV1-SIV- and SabRV2-SIV-immunized monkeys. Symbols are as noted above. A clear anemnestic IgA response is evident for all seven macaques after SabRV2-SIV immunization at week 19. Symbols are as for panel A.

Immunization induces vaginal and rectal anti-SIV antibody responses. We found in our previous study (15) that recombinant polioviruses expressing SIV antigens could induce anti-SIV vaginal and rectal antibody responses after intranasal inoculation. In this study, we again analyzed antibody samples taken from the surfaces of the vaginal and rectal mucosae. It was recently shown that macaque vaginal antibody secretions are affected by the menstrual cycle (38), and therefore in this study we took mucosal antibody samples on a weekly basis to assess the antibody levels more accurately.

View larger version (27K): [in this window] [in a new window]   FIG. 5.   Rectal anti-SIV antibodies. (A) Anti-SIV IgG titers in the rectal washes of monkeys immunized with SabRV1-SIV and SabRV2-SIV. Vaccinated monkeys were divided into two groups (upper and lower panels) for easier viewing of data. Titers indicated are reciprocal dilutions. A titer of 1 is stringently defined as an ELISA optical density reading 3 standard deviations above the average optical density for a group of negative-control monkeys (see Materials and Methods). (B) Anti-SIV IgA titers in the rectal washes of monkeys immunized with SabRV1-SIV and SabRV2-SIV. Vaccinated monkeys were divided into the same two groups (upper and lower panels) as in part A, for easier viewing of data. Monkeys are labeled as described in the legend to Fig. 4.

View larger version (29K): [in this window] [in a new window]   FIG. 6.   Vaginal anti-SIV antibodies. (A) Anti-SIV IgG titers in the vaginal secretions of monkeys immunized with SabRV1-SIV and SabRV2-SIV. Vaccinated monkeys are divided into two groups (upper and lower panels) for easier viewing of data, as was done in Fig. 4 and 5. (B) Anti-SIV IgA titers in the vaginal secretions of monkeys immunized with SabRV1-SIV and SabRV2-SIV. Monkeys are labeled as described for Fig. 4.

Diversity of antigens recognized in monkeys immunized with SabRV1-SIV-SabRV2-SIV. We are unaware of any precedent for immunization of primates with a viral vector (or any vector) expressing a defined library of antigens. Therefore, it was important to determine whether the measured antibody responses were against a single antigen (expressed by a single SabRV-SIV virus) or multiple antigens (expressed by different SabRV-SIV viruses). To explore this issue, we examined the anti-SIV and antipoliovirus specificities of the serum antibodies in immunized animals by Western blotting. All seven monkeys seroconverted to poliovirus antigen positivity, generally with a strong response against capsid protein VP1 and weaker responses against two to four other poliovirus proteins (Fig. 7). All seven monkeys also seroconverted to SIV antigen positivity, as determined by Western blot analysis, confirming the SIV ELISA results shown in Fig. 4. Importantly, a majority of monkeys demonstrated substantial antibody responses to multiple SIV proteins (Fig. 7). Antibody responses against reverse transcriptase (p51/65; all seven monkeys), Gag (p55; six monkeys [27244, 28508, 27270, 27273, 27253, and 27250]), p17 (monkeys 27270 and 27253), p27 (monkeys 27244 and 27250), Env gp41 (monkeys 27270 and 27253), and Env gp120 (monkeys 27244, 28508, 27270, 25231, and 27253) were all apparent (Fig. 7). Antibodies against Nef and Tat (also represented in the SabRV1-SIV and/or SabRV2-SIV cocktail) were not assayed in this experiment because they are not packaged in SIV virions, which is the target material for the immunoblot analyses. At least five different SabRV1-SIV or SabRV2-SIV viruses, and possibly many more, were immunogenic and elicited antibody responses, since the responses against SIV p27, reverse transcriptase, p17, gp41, and gp120 must have been elicited from different SabRV-SIVs. In summary, a majority of monkeys responded to multiple poliovirus and SIV proteins, indicating that the library vaccine approach is successful at eliciting responses to multiple expressed proteins, even in a complex cocktail of 20 different viruses.

View larger version (111K): [in this window] [in a new window]   FIG. 7.   Western blotting. All seven monkeys had anti-SIV and anti-poliovirus antibody responses that were detectable by Western blotting. Each serum was immunoblotted against purified SIV virion-infected (left lanes) and poliovirus-infected (PV; right lanes) HeLa cell extracts. Positive controls used were SIV-positive rhesus serum (SIV+) and human poliovirus-immune serum (Polio+). Preimmune serum from monkey 27250 was used as a negative control (preimm.). SIV antigens recognized by each monkey are indicated by symbols on the left of the blot as follows: reverse transcriptase (RT), ; Gag, -; gp120, ; and gp41, . Poliovirus VP1, recognized by all monkeys, is indicated by the leftward-pointing black triangles to the right of each blot. Bands do not necessarily line up precisely because several of the blots were done at different times, but SIV and poliovirus positive controls were always run as markers.

Cellular immune responses. Poliovirus vectors can elicit potent CTL responses in both mice (42, 72) and primates (15). In the present study, we were able to detect SIV Env-specific CTLs in three of seven monkeys (25231, 27244, and 27250) after SabRV1-SIV vaccination by a standard bulk PBMC cytolytic assay (Fig. 8A). After the SabRV2-SIV vaccinations, we detected SIV Gag- and Env-specific CTLs in monkey 25231 (Fig. 8B). Cellular immune responses are technically difficult to assess in cynomolgus macaques (see Materials and Methods), and we frequently experienced difficulties because of a high level of background lysis. This technical complication prevented accurate assessment of CTL activity at additional time points.

View larger version (35K): [in this window] [in a new window]   FIG. 8.   SIV-specific CTLs. (A) SIV-specific CTLs after immunization with SabRV1-SIV. SIV-specific CTLs were detected using bulk PBMCs collected 2 weeks after immunization with SabRV1-SIV. Monkeys 25231, 27244, and 27250 tested positive for SIV Env-specific CTLs. , negative-control target cells; , Env-expressing target cells. (B) SIV-specific CTLs after immunization with SabRV2-SIV. SIV-specific CTLs were detected using bulk PBMCs collected 6 weeks after immunization with SabRV2-SIV. Monkey 25231 tested positive for SIV Gag-specific CTLs and possibly Env-specific CTLs. , negative-control target cells; , Gag-expressing target cells; , Env-expressing target cells. E:T, effector/target ratio.

Virologic outcome of vaginal challenge with SIVmac251. All 7 vaccinated monkeys and a total of 12 control monkeys were challenged with a vaginal inoculum of SIVmac251. SIVmac251 is an uncloned and highly virulent virus that has proven to be extremely difficult to protect against (i.e., prevention of infection is not easily achieved) or control with vaccine-induced immune responses (14, 17, 22, 25, 39, 40, 69). The vaginal challenge route was chosen because our primary interest in the SabRV vector is as a vaccine capable of protecting against sexually transmitted HIV.

View larger version (15K): [in this window] [in a new window]   FIG. 9.   Serum anti-SIV IgG antibody responses postchallenge. Antibody titers are shown for all animals postchallenge. Vaccinated monkeys (right panel) are indicated by the symbols used in previous figures: 25231, ; 27244, ; 27250, ; 27253, ; 27270, ; 27273, ; and 28508, . Control monkeys (left panel) are indicated by symbols as follows: 26383, ; 26385, ; 23414, ; 26405, ; 26560, ; and 28118, .

View larger version (20K): [in this window] [in a new window]   FIG. 10.   SIV RNA loads. SIV RNA levels in plasma were measured postchallenge. All seven vaccinated monkeys and six control monkeys were challenged with an intravaginal inoculation of highly virulent SIVmac251 at week 30 of the experiment (challenge was at week 0). Vaccinated monkeys (right panel) are indicated by the symbols used in previous figures: 25231, ; 27244, ; 27250, ; 27253, ; 27270, ; 27273, ; and 28508, . Control monkeys (left panel) are indicated by symbols as follows: 26383, ; 26385, ; 23414, ; 26405, ; 26560, ; and 28118, . Vaccinated monkeys 27270 and 27244 were never positive for SIV RNA and appeared to be completely protected. The threshold sensitivity of the assay (indicated by a dashed line) is 100 RNA copy equivalents/ml. Data points below the threshold value are shown at 100. , animal died between weeks 32 and 44 postchallenge.

Clinical outcome of vaginal challenge with SIVmac251. The clinical outcome of SIV infection was much worse in the control animals than in the SabRV-SIV-immunized animals. Five of six control animals had marked decreases in CD4⁺ T-lymphocyte counts (Fig. 11A) and body weight (Fig. 11B) over the 48-week postchallenge observation period. Three of the six control animals were euthanatized, at 34, 35, and 44 weeks postchallenge, because of severe clinical AIDS (Fig. 11C). At necropsy, two of the animals (23414 and 26560) had lymphoma and the other animal (28118) had severe nonresponsive enteritis and wasting.

View larger version (29K): [in this window] [in a new window]   FIG. 11.   Clinical outcomes of vaginal challenge with SIVmac251. (A) Postchallenge CD4+ T-lymphocyte counts. CD3+ CD4+ T-lymphocyte counts in the peripheral blood of naive control cynomolgus macaques (left) and SabRV1-SIV- and SabRV2-SIV-vaccinated macaques (right) were determined on the day of challenge and through 36 weeks postchallenge. Symbols are as defined in the legend to Fig. 10. (B) Body weight. Weights of control macaques (left) and SabRV1-SIV- and SabRV2-SIV-vaccinated macaques (right) were measured on the day of challenge and through 44 weeks postchallenge. Weight is indicated as a percentage of the body weight measured on the day of challenge. Body weight changes of vaccinated animals were significantly better (P < 0.003) than those of the control monkeys. Symbols used are the same as for panel A. (C) Mortality curve. SabRV-SIV-vaccinated animals, ; control animals, .

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

The primary goals of this study were to construct SabRV-SIV candidate SIV vaccine viruses and assess their immunogenicity and efficacy in preventing vaginal transmission of SIV. A vaginal challenge was chosen because our primary interest in the SabRV vector is as a vaccine vector capable of protecting against sexually transmitted HIV. Given that more than 90% of HIV-1 infections worldwide occur via sexual transmission, any strategy to truly control the AIDS pandemic must include a vaccine that prevents sexual transmission of HIV-1. SIVmac251 is an uncloned and highly virulent virus that has proven to be extremely difficult to protect against in rhesus and cynomolgus macaque challenge experiments (14, 17, 22, 25, 39, 69). We decided to use SIVmac251 as the challenge virus because the use of a pathogenic, uncloned, difficult-to-neutralize virus models "real-world" HIV transmission.

The SabRV1-SIV-SabRV2-SIV vaccine provided protection from SIV infection in two of seven vaccinated monkeys and rendered protection from disease progression in all vaccinated monkeys. SIV replication was controlled (650 copies/ml and <100 copies/ml at week 32) in two monkeys. Thus, there was a clear difference between the clinical courses of the postchallenge SIV infection in the control and vaccinated animals. Half of the control animals developed end-stage clinical AIDS, while all of the vaccinated monkeys were protected from AIDS through the 48-week postchallenge observation period (P < 0.07). Although not all vaccinated monkeys were protected from infection, the SabRV-SIV vaccine protected all of the immunized monkeys from SIV-related disease progression, in terms of both viral load (P < 0.01) and general health (body weight; P < 0.003). This is the first report of a vaccine vector providing protection against a vaginal challenge with a highly virulent SIV. Indeed, although experiments with cynomolgus macaques and rhesus macaques are not necessarily directly comparable, the results reported here appear equivalent to or better than the highest levels of mucosal protection afforded by any published subunit vaccine (40), DNA vaccine (25), or viral vector system (3, 11, 14, 24) in macaques challenged with a highly virulent uncloned SIV. The significant levels of protection observed in this study indicate that SabRV has considerable potential as a human vaccine vector.

Immunogenicity. We previously showed that live poliovirus-based vaccine vectors elicit humoral, mucosal, and cellular immune responses in primates (15). In the present study, we observed better serum and mucosal antibody responses than we observed with the previous poliovirus vector system, in terms of the proportion of monkeys responding, maximum antibody titers, and the consistency of the immune responses. We believe that these enhanced responses are due to higher-quality virus stocks, the use of vectors based on Sabin 1 and Sabin 2 molecular clones, and the use of a cocktail vaccine approach that allowed the expression of a 10-fold-larger number of SIV antigens. This was our first use of pSabRV2- or pSabRV1-derived viruses, and the results demonstrate that Sabin 1- and Sabin 2-based constructs are immunogenic as viral vectors. Also, these data show the effectiveness of a prime-and-boost strategy using two serotypes of the same viral vector.