Division of Human Biology, Fred Hutchinson
Cancer Research Center, Seattle, Washington
98109,1, and Molecular and Cellular
Biology Program, University of Washington, Seattle, Washington
981952
Human papillomavirus type 16 (HPV-16) E6 activates telomerase
specifically in epithelial cells. The oncogene c-myc has
also been shown to activate telomerase in several cell types. Here we
show that while both HPV-16 E6 and c-myc require intact E
boxes to transactivate the hTERT promoter, E6 does not induce hTERT transcription simply by inducing expression of c-myc.
Moreover, hTERT transactivation by HPV-16 E6 correlates with its
ability to bind the cellular E6-associated protein (E6AP), suggesting that E6 and E6AP may target a regulator of hTERT expression.
 |
TEXT |
Activation of telomerase is a
critical step in cellular transformation (7, 12).
Telomerase activity is primarily regulated at the level of expression
of the hTERT gene, encoding the catalytic subunit of telomerase
(4, 24, 26, 33). Ectopic expression of hTERT in a number
of different telomerase-negative cell types has been shown to confer
immortality (2, 4, 18, 30). Therefore, much research is
now focused on determining the transcriptional regulators of hTERT.
The hTERT promoter contains a number of putative transcription factor
binding sites. Several studies have defined the minimal core promoter
as the proximal 200 bp upstream of the transcription start site
(15, 29). This core promoter contains numerous SP1 binding
sites and two canonical E boxes (Myc-Max binding sites) (3, 15,
29, 34). Previous in vitro studies have shown that Myc-Max
heterodimers can bind these E boxes in the context of the hTERT
promoter and can activate hTERT reporter constructs (15, 29,
35). Myc expression has also been shown to induce telomerase
activity in post M0 human mammary epithelial cells (HMECs),
the fibroblast lines IMR90 and WI38 (32), and Epstein-Barr virus-immortalized B cells (35). These studies implicate
c-Myc as an important transactivator of hTERT.
The human papillomavirus type 16 (HPV-16) E6 oncoprotein can also
induce telomerase expression, specifically in epithelial cell types
(20). Expression of HPV-16 E6 in either human foreskin keratinocytes (HFKs) or HMECs induces telomerase activity. Another well-established function of HPV-16 E6 is its association with the
cellular E6-associated protein (E6AP) to form a ubiquitin protein
ligase that specifically targets p53 for degradation (16, 17,
28). The HPV-16 E6-8S/9A/10T mutant is defective in p53 degradation yet retains the ability to activate telomerase,
demonstrating that these two functions of E6 are separate and
distinct(20). Expression of HPV-16 E6 does not induce
telomerase in human foreskin fibroblasts (20) or in IMR90
cells (32). It has been suggested that a
cell-type-specific ability of HPV-16 E6 to induce c-myc expression is responsible for this differential telomerase activation (35). In this study, we show that upregulation of
c-myc does not directly correlate with telomerase
activation, indicating that other regulators of hTERT expression are
also involved. We also demonstrate that activation of telomerase by
HPV-16 E6 does not require upregulation of c-myc, yet intact
E boxes in the hTERT promoter are required for HPV-16 E6-mediated
transactivation. In addition, the ability of E6 to bind its cellular
partner E6AP appears to be important for the induction of hTERT.
Expression levels of c-myc do not correlate with
telomerase activity.
To address the mechanism by which HPV-16 E6
activates telomerase in HFKs, we transduced HFKs with retroviruses
encoding HPV-16 E6, E6-8S/9A/10T, and E6-
9-13 (5, 8,
25). In addition, the HPV-16 oncogene E7, E6-E7
(13), c-myc (provided by R. Eisenman), and
vector controls (LXSN and LXSH) were transduced into HFKs. After
selection in 50 µg of G418 (GIBCO BRL)/ml or 8 µg of hygromycin B
(Roche)/ml, cells were harvested in parallel for telomeric repeat amplification protocol (TRAP) assay as previously described
(18), reverse transcription (RT)-PCR, and Western blotting
of nuclear extracts. Nuclear extracts were made as previously described
(27), except that the homogenization step was omitted. The
transformed cell lines C33A, HeLa, and 293T were also harvested in
parallel to serve as positive controls for telomerase activity.
Expression of HPV-16 E6, E6-8S/9A/10T, c-myc, or E6 and E7
activated telomerase, as seen in Fig. 1B.
As recently published, E6 activates telomerase by inducing
transcription of the telomerase hTERT gene (31) (Fig. 1C).
In each case, induction of telomerase activity was directly correlated
with expression of hTERT RNA (Fig. 1C). Overexpression of
c-myc was sufficient to activate telomerase in HFKs and may
be necessary for hTERT induction, as c-Myc protein was detected in all
cells with active telomerase. Interestingly, the steady-state levels of
c-Myc protein in each of these cell lines did not correlate with
expression of hTERT (Fig. 1). Telomerase was activated both with high
(lanes 6, 7, 9, 10, and 11) and with low (lanes 2 and 3) levels of
c-Myc nuclear protein (Fig. 1A and B). Conversely, no telomerase
activation was detected in the HPV-16 E7-expressing cells, which
contain high levels of c-Myc (lane 5). Therefore, activation of
telomerase by HPV-16 E6 in HFKs is independent of c-Myc induction. It
should be noted that c-myc expression is elevated in cells
actively proliferating and decreased in cells with lower proliferation
rates (14). We have observed slightly elevated levels of
c-Myc in HFKs expressing HPV-16 E6 and E6 mutants in some experiments
(data not shown). However, in those experiments, LXSN-HFKs had
undetectable c-Myc expression. Therefore, we attribute the differences
in expression of c-Myc to variation in the proliferation rate rather
than to specific induction of c-myc by HPV-16 E6.

View larger version (71K):
[in this window]
[in a new window]
|
FIG. 1.
c-Myc expression levels do not correlate with telomerase
activity in HFKs. Cells were transduced with retroviruses to express
the indicated genes. (A) Western blots. Nuclear extracts were made and
20 µg of total protein was loaded per lane on an SDS-8%
polyacrylamide gel and subsequently transferred to a polyvinylidene
difluoride membrane. Blots were probed with c-Myc mouse monoclonal
antibody (C-33; Santa Cruz), p53 mouse monoclonal antibody (Ab-6;
Calbiochem), and actin goat polyclonal antibody (Santa Cruz). (B)
Telomerase activity. TRAP assays were performed using 5 µg of
whole-cell extract per lane (17). Lysis buffer was used as
a negative control. TSR8 is a synthetic oligonucleotide of eight
telomeric repeats (Intergen). (C) hTERT RNA expression. RT-PCR was
carried out with RNA isolated from the transduced HFKs. The RT reaction
was done using random hexamers (GIBCO) and the Superscript II System
(GIBCO) and followed by RNase H treatment. Specific amplification of
hTERT and the positive control 36B4 was done using forward primer
5'CGAGCTGCTCAGGTCTTTCTTTTATG3' and reverse primer
5'CCACGACGTAGTCCATGTTCACAATC3' for hTERT and forward primer
5'TGCCAGTGTCTGTCTGCAGA3' and reverse primer
5'ACAAAGGCAGATGGATCAGC3' for 36B4. The negative control ( )
contained no RNA. M, marker lanes.
|
|
The induction of c-myc by HPV-16 E7 was not sufficient to
activate telomerase. Presumably, E7 induces c-myc by binding
retinoblastoma protein, thereby releasing E2F to activate
c-myc in a manner similar to that demonstrated for simian
virus 40 large T antigen (1, 6). Given the comparable
c-Myc expression levels in lanes 5 and 6 of Fig. 1A, it is perplexing
that HPV-16 E7 does not induce hTERT. Perhaps E7 inhibits
c-myc-mediated telomerase activation. However, as shown with
the cells expressing both E6 and E7, E7 did not inhibit E6-mediated
telomerase activation. Interestingly, in a previous study, Garbe et al.
found that E7 expression promoted telomerase activation
(11). Benzo[a]pyrene treatment of HMECs generated mortal extended-life cultures. Subsequent E7 transduction did
not immediately activate telomerase, but after 2 to 4 months of
culture, these cells had detectable telomerase activity that gradually
increased with further passaging (11). This finding suggests an epigenetic mechanism of telomerase activation facilitated by E7 (11). Activation of telomerase by HPV-16 E6, on the
other hand, is detectable within the first passage after selection, arguing that E6 directly affects another regulator of hTERT
transcription (11, 20).
Both HPV-16 E6 and c-myc require intact E boxes to
activate the hTERT promoter.
The in vivo expression data suggested
that activation of hTERT by HPV-16 E6 was independent of c-Myc protein
levels. To address which transcription factor binding sites are
required for activation by E6 and c-myc, we performed hTERT
reporter luciferase assays in HFKs. First, two pGL3 luciferase reporter
constructs were generated. An approximately 800-bp region of the hTERT
promoter (from
710 to +76, the translation start site) was cloned
into pGL3-Basic (Promega) from pXP2 constructs provided by K.-J. Wu
(35). An identical clone was made, with mutations at both
proximal E boxes (CACGTG mutated to CACCTG). The constructs were
cotransfected with retrovirus expression vectors LXSN, LXSN-E6, and
LXSN-c-myc into HFKs using FuGENE6 (Roche). Cells were
harvested 24 h after transfection, and lysates were assayed for
luciferase activity (Promega) and total protein concentration
(Bio-Rad). As previously published, c-myc activated the
hTERT promoter approximately threefold and activation is dependent on
intact E boxes (29, 35) (Fig. 2). Coexpression of HPV-16 E6 activated
the hTERT promoter twofold. In comparison to the in vivo induction of
hTERT by E6 seen in Fig. 1, the rather modest transactivation of this
fragment of the hTERT promoter by E6 may indicate that the reporter
assays do not accurately reflect the endogenous promoter. Nevertheless, E6-mediated activation of the hTERT promoter was completely abolished by point mutations within the E box, indicating that E6-mediated induction of hTERT is also E box dependent.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 2.
Intact E boxes are required for activation of hTERT by
either c-myc or HPV-16 E6. Cells were cotransfected with
pGL3-hTERT( 710) WT or DM and the indicated retrovirus construct.
Luciferase values were normalized for protein concentration and are
graphed relative to the vector control value for each promoter
construct. The graph represents four experiments done either in
duplicate or in triplicate. DM, double mutant E boxes.
|
|
Activation of telomerase by HPV-16 E6 is therefore independent of c-Myc
expression levels but dependent on intact E boxes within the hTERT
promoter. This finding suggests a few possible mechanisms of hTERT
activation by HPV-16 E6. First, E6 may allow c-Myc to have access
to the E boxes either by removing a repressor or by altering the local
chromatin structure. Second, E6 may alter the expression of cofactor
that preferentially targets c-Myc to the hTERT promoter. Both of these
mechanisms may be unnecessary when high levels of c-myc are
present, as suggested by the c-myc transductions. A third possible
mechanism involves another unidentified transcription factor that, in
the presence of E6, may transactivate the hTERT promoter independently
of c-Myc.
Ability of E6 to activate telomerase correlates with ability to
bind E6AP.
Though it has been shown that E6-mediated telomerase
activation is clearly independent of p53 degradation (20)
(Fig. 1), some studies have suggested that p53 is an inhibitor of
telomerase activity (21, 22). We observed no correlation
between p53 expression levels and hTERT expression (Fig. 1). Both the
c-myc-transduced and the E6-8S/9A/10T-transduced HFKs
induced hTERT despite the presence of p53. The E6-8S/9A/10T mutant does
not target p53 for degradation yet retains its ability to activate
telomerase. Interestingly, a deletion mutant in the same region,
E6-
9-13, cannot activate telomerase or target p53 for degradation.
While the ability to bind and target p53 for degradation strongly
correlates with ability to bind E6AP (8, 23), other
targets of E6- and E6AP-mediated ubiquitination appear to exist. Other
researchers have proposed that the human homolog of the
Drosophila discs large tumor suppressor protein (hDLG)
(19) and a novel putative GAP protein, E6 (E6-targeted protein 1) (9, 10), are targets of E6 and E6AP.
We hypothesize that the ability of E6 to bind E6AP may correlate with
its ability to activate telomerase, irrespective of its ability to
target p53 for degradation. To address this hypothesis, binding assays
were performed to determine whether the E6-8S/9A/10T and E6-
9-13
mutants, both having lost the ability to target p53 for degradation,
can bind to E6AP. Glutathione S-tranferase (GST)-tagged E6AP
proteins were produced and purified as previously described (17). These proteins were incubated with
35S-radiolabeled E6 proteins (TNT kit; Promega) for 2 h in binding buffer (phosphate-buffered saline, 1% NP-40, 2mM
dithiothreitol, protease inhibitors) at 4°C. Complexes were
precipitated with glutathione-Sepharose (Amersham Pharmacia) and
analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE) and autoradiography. Figure 3A
shows that while both wild-type (wt) E6 and E6-8S/9A/10T bind to E6AP,
E6-
9-13 does not. This interaction was further confirmed by
incubating GST-E6 proteins with lysates from HFKs transiently
transfected with an LXSN-hemagglutinin (HA)-E6AP construct. Again,
both wt E6 and E6-8S/9A/10T interact strongly with HA-E6AP, while
E6-
9-13 does not (Fig. 3B). This experiment also confirms that
though both wt E6 and E6-8S/9A/10T bind E6AP, only wt E6 interacts with
p53. Therefore, E6-mediated telomerase activation correlates well with
the ability of E6 to bind E6AP. Other investigators have also found
that E6 mutants with decreased binding to E6AP inefficiently
immortalize epithelial cells (23). In addition, all E6
mutants that bind E6AP and target p53 for degradation can activate
telomerase, further suggesting that E6AP binding is an important
component of E6-mediated telomerase activation (20). We
propose that E6 and E6AP may target a regulator of hTERT transcription.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 3.
Ability of E6 to activate telomerase correlates with
ability to bind E6AP. (A) E6 binding assay.
35S-radiolabeled E6 proteins were incubated with purified
GST proteins and precipitated with glutathione-Sepharose. E6AP is a
mutant with the E6-binding region (amino acids 391 to 408) deleted.
Protein complexes were analyzed by SDS-PAGE and autoradiography (upper
panel). Binding was subsequently quantitated by phosphorimaging using
ImageQuant. Percent binding indicates the average percent binding of
three independent experiments. Lower panel is a Coomassie blue-stained
gel to show loading of GST proteins. Arrows indicate GST-E6AP proteins
and GST. (B) E6AP binding assay. HFKs were transiently transfected with
HA-E6AP. Cells were lysed in binding buffer (phosphate-buffered saline,
1% NP-40, 2 mM dithiothreitol, 10% glycerol). Lysates were incubated
with purified GST proteins and precipitated with glutathione-Sepharose.
Protein complexes were separated by SDS-PAGE, transferred to
polyvinylidene difluoride membrane, and Western blotted for HA-E6AP
(mouse monoclonal antibody 16B12; Babco) and p53 (mouse monoclonal
antibody Ab-6; Calbiochem). Results represent four independent
experiments.
|
|
Given these data with HFKs, we suggest that while c-Myc is sufficient
to activate telomerase, the mechanism by which HPV-16 E6 activates
telomerase is not dependent on increasing c-Myc protein levels,
either by protein stabilization or by upregulation. Induction of hTERT
by E6 is, however, dependent on the presence of intact E boxes in the
hTERT proximal promoter. Since the ability of E6 to bind E6AP
correlates strongly with the ability to induce hTERT, we are currently
examining possible targets of E6 and E6AP for roles in hTERT
transcriptional regulation.
This work was supported by a grant from NIH, CA64795, to D.A.G.
L.G. is supported in part by a Viral Oncology Training Grant (PHS 5 T32
CA 09229-23).
| 1.
|
Batsche, E.,
M. Lipp, and C. Cremisi.
1994.
Transcriptional repression and activation in the same cell type of the human c-MYC promoter by the retinoblastoma gene protein: antagonisation of both effects by SV40 T antigen.
Oncogene
9:2235-2243[Medline].
|
| 2.
|
Bodnar, A. G.,
M. Ouellette,
M. Frolkis,
S. E. Holt,
C. P. Chiu,
G. B. Morin,
C. B. Harley,
J. W. Shay,
S. Lichtsteiner, and W. E. Wright.
1998.
Extension of life-span by introduction of telomerase into normal human cells.
Science
279:349-352[Abstract/Free Full Text].
|
| 3.
|
Cong, Y. S.,
J. Wen, and S. Bacchetti.
1999.
The human telomerase catalytic subunit hTERT: organization of the gene and characterization of the promoter.
Hum. Mol. Genet.
8:137-142[Abstract/Free Full Text].
|
| 4.
|
Counter, C. M.,
W. C. Hahn,
W. Wei,
S. D. Caddle,
R. L. Beijersbergen,
P. M. Lansdorp,
J. M. Sedivy, and R. A. Weinberg.
1998.
Dissociation among in vitro telomerase activity, telomere maintenance, and cellular immortalization.
Proc. Natl. Acad. Sci. USA
95:14723-14728[Abstract/Free Full Text].
|
| 5.
|
Crook, T.,
J. A. Tidy, and K. H. Vousden.
1991.
Degradation of p53 can be targeted by HPV E6 sequences distinct from those required for p53 binding and trans-activation.
Cell
67:547-556[CrossRef][Medline].
|
| 6.
|
Dyson, N.,
P. M. Howley,
K. Munger, and E. Harlow.
1989.
The human papilloma virus-16 E7 oncoprotein is able to bind to the retinoblastoma gene product.
Science
243:934-937[Abstract/Free Full Text].
|
| 7.
|
Elenbaas, B.,
L. Spirio,
F. Koerner,
M. D. Fleming,
D. B. Zimonjic,
J. L. Donaher,
N. C. Popescu,
W. C. Hahn, and R. A. Weinberg.
2001.
Human breast cancer cells generated by oncogenic transformation of primary mammary epithelial cells.
Genes Dev.
15:50-65[Abstract/Free Full Text].
|
| 8.
|
Foster, S. A.,
G. W. Demers,
B. G. Etscheid, and D. A. Galloway.
1994.
The ability of human papillomavirus E6 proteins to target p53 for degradation in vivo correlates with their ability to abrogate actinomycin D-induced growth arrest.
J. Virol.
68:5698-5705[Abstract/Free Full Text].
|
| 9.
|
Gao, Q.,
L. Singh,
A. Kumar,
S. Srinivasan,
D. E. Wazer, and V. Band.
2001.
Human papillomavirus type 16 E6-induced degradation of E6Tp1 correlates with its ability to immortalize human mammary epithelial cells.
J. Virol.
75:4459-4466[Abstract/Free Full Text].
|
| 10.
|
Gao, Q.,
S. Srinivasan,
S. N. Boyer,
D. E. Wazer, and V. Band.
1999.
The E6 oncoproteins of high-risk papillomaviruses bind to a novel putative GAP protein, E6TP1, and target it for degradation.
Mol. Cell. Biol.
19:733-744[Abstract/Free Full Text].
|
| 11.
|
Garbe, J.,
M. Wong,
D. Wigington,
P. Yaswen, and M. R. Stampfer.
1999.
Viral oncogenes accelerate conversion to immortality of cultured conditionally immortal human mammary epithelial cells.
Oncogene
18:2169-2180[CrossRef][Medline].
|
| 12.
|
Hahn, W. C.,
C. M. Counter,
A. S. Lundberg,
R. L. Beijersbergen,
M. W. Brooks, and R. A. Weinberg.
1999.
Creation of human tumour cells with defined genetic elements.
Nature
400:464-468[CrossRef][Medline].
|
| 13.
|
Halbert, C. L.,
G. W. Demers, and D. A. Galloway.
1991.
The E7 gene of human papillomavirus type 16 is sufficient for immortalization of human epithelial cells.
J. Virol.
65:473-478[Abstract/Free Full Text].
|
| 14.
|
Henriksson, M., and B. Luscher.
1996.
Proteins of the Myc network: essential regulators of cell growth and differentiation.
Adv. Cancer Res.
68:109-182[Medline].
|
| 15.
|
Horikawa, I.,
P. L. Cable,
C. Afshari, and J. C. Barrett.
1999.
Cloning and characterization of the promoter region of human telomerase reverse transcriptase gene.
Cancer Res.
59:826-830[Abstract/Free Full Text].
|
| 16.
|
Huibregtse, J. M.,
M. Scheffner, and P. M. Howley.
1991.
A cellular protein mediates association of p53 with the E6 oncoprotein of human papillomavirus types 16 or 18.
EMBO J.
10:4129-4135[Medline].
|
| 17.
|
Huibregtse, J. M.,
M. Scheffner, and P. M. Howley.
1993.
Localization of the E6-AP regions that direct human papillomavirus E6 binding, association with p53, and ubiquitination of associated proteins.
Mol. Cell. Biol.
13:4918-4927[Abstract/Free Full Text].
|
| 18.
|
Kiyono, T.,
S. A. Foster,
J. I. Koop,
J. K. McDougall,
D. A. Galloway, and A. J. Klingelhutz.
1998.
Both Rb/p16INK4a inactivation and telomerase activity are required to immortalize human epithelial cells.
Nature
396:84-88[CrossRef][Medline].
|
| 19.
|
Kiyono, T.,
A. Hiraiwa,
M. Fujita,
Y. Hayashi,
T. Akiyama, and M. Ishibashi.
1997.
Binding of high-risk human papillomavirus E6 oncoproteins to the human homologue of the Drosophila discs large tumor suppressor protein.
Proc. Natl. Acad. Sci. USA
94:11612-11616[Abstract/Free Full Text].
|
| 20.
|
Klingelhutz, A. J.,
S. A. Foster, and J. K. McDougall.
1996.
Telomerase activation by the E6 gene product of human papillomavirus type 16.
Nature
380:79-82[CrossRef][Medline].
|
| 21.
|
Kusumoto, M.,
T. Ogawa,
K. Mizumoto,
H. Ueno,
H. Niiyama,
N. Sato,
M. Nakamura, and M. Tanaka.
1999.
Adenovirus-mediated p53 gene transduction inhibits telomerase activity independent of its effects on cell cycle arrest and apoptosis in human pancreatic cancer cells.
Clin. Cancer Res.
5:2140-2147[Abstract/Free Full Text].
|
| 22.
|
Li, H.,
Y. Cao,
M. C. Berndt,
J. W. Funder, and J. P. Liu.
1999.
Molecular interactions between telomerase and the tumor suppressor protein p53 in vitro.
Oncogene
18:6785-6794[CrossRef][Medline].
|
| 23.
|
Liu, Y.,
J. J. Chen,
Q. Gao,
S. Dalal,
Y. Hong,
C. P. Mansur,
V. Band, and E. J. Androphy.
1999.
Multiple functions of human papillomavirus type 16 E6 contribute to the immortalization of mammary epithelial cells.
J. Virol.
73:7297-7307[Abstract/Free Full Text].
|
| 24.
|
Meyerson, M.,
C. M. Counter,
E. N. Eaton,
L. W. Ellisen,
P. Steiner,
S. D. Caddle,
L. Ziaugra,
R. L. Beijersbergen,
M. J. Davidoff,
Q. Liu,
S. Bacchetti,
D. A. Haber, and R. A. Weinberg.
1997.
hEST2, the putative human telomerase catalytic subunit gene, is upregulated in tumor cells and during immortalization.
Cell
90:785-795[CrossRef][Medline].
|
| 25.
|
Mietz, J. A.,
T. Unger,
J. M. Huibregtse, and P. M. Howley.
1992.
The transcriptional transactivation function of wild-type p53 is inhibited by SV40 large T-antigen and by HPV-16 E6 oncoprotein.
EMBO J.
11:5013-5020[Medline].
|
| 26.
|
Nakayama, J.,
H. Tahara,
E. Tahara,
M. Saito,
K. Ito,
H. Nakamura,
T. Nakanishi,
E. Tahara,
T. Ide, and F. Ishikawa.
1998.
Telomerase activation by hTRT in human normal fibroblasts and hepatocellular carcinomas.
Nat. Genet.
18:65-68[CrossRef][Medline].
|
| 27.
|
Sambrook, J., and D. W. Russell.
2001.
Molecular cloning: a laboratory manual, 3rd ed., p. 17.4-17.11.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 28.
|
Scheffner, M.,
B. A. Werness,
J. M. Huibregtse,
A. J. Levine, and P. M. Howley.
1990.
The E6 oncoprotein encoded by human papillomavirus types 16 and 18 promotes the degradation of p53.
Cell
63:1129-1136[CrossRef][Medline].
|
| 29.
|
Takakura, M.,
S. Kyo,
T. Kanaya,
H. Hirano,
J. Takeda,
M. Yutsudo, and M. Inoue.
1999.
Cloning of human telomerase catalytic subunit (hTERT) gene promoter and identification of proximal core promoter sequences essential for transcriptional activation in immortalized and cancer cells.
Cancer Res.
59:551-557[Abstract/Free Full Text].
|
| 30.
|
Vaziri, H., and S. Benchimol.
1998.
Reconstitution of telomerase activity in normal human cells leads to elongation of telomeres and extended replicative life span.
Curr. Biol.
8:279-282[CrossRef][Medline].
|
| 31.
|
Veldman, T.,
I. Horikawa,
J. C. Barrett, and R. Schlegel.
2001.
Transcriptional activation of the telomerase hTERT gene by human papillomavirus type 16 E6 oncoprotein.
J. Virol.
75:4467-4472[Abstract/Free Full Text].
|
| 32.
|
Wang, J.,
L. Y. Xie,
S. Allan,
D. Beach, and G. J. Hannon.
1998.
Myc activates telomerase.
Genes Dev.
12:1769-1774[Abstract/Free Full Text].
|
| 33.
|
Weinrich, S. L.,
R. Pruzan,
L. Ma,
M. Ouellette,
V. M. Tesmer,
S. E. Holt,
A. G. Bodnar,
S. Lichtsteiner,
N. W. Kim,
J. B. Trager,
R. D. Taylor,
R. Carlos,
W. H. Andrews,
W. E. Wright,
J. W. Shay,
C. B. Harley, and G. B. Morin.
1997.
Reconstitution of human telomerase with the template RNA component hTR and the catalytic protein subunit hTRT.
Nat. Genet.
17:498-502[CrossRef][Medline].
|
| 34.
|
Wick, M.,
D. Zubov, and G. Hagen.
1999.
Genomic organization and promoter characterization of the gene encoding the human telomerase reverse transcriptase (hTERT).
Gene
232:97-106[CrossRef][Medline].
|
| 35.
|
Wu, K. J.,
C. Grandori,
M. Amacker,
N. Simon-Vermot,
A. Polack,
J. Lingner, and R. Dalla-Favera.
1999.
Direct activation of TERT transcription by c-MYC.
Nat. Genet.
21:220-224[CrossRef][Medline].
|