Previous Article | Next Article 
Journal of Virology, August 2001, p. 7086-7096, Vol. 75, No. 15
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.15.7086-7096.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Wild Mandrillus sphinx Are Carriers of
Two Types of Lentivirus
Sandrine
Souquière,1
Frédéric
Bibollet-Ruche,2
David L.
Robertson,3
Maria
Makuwa,1
Cristian
Apetrei,1
Richard
Onanga,1
Christopher
Kornfeld,4
Jean-Christophe
Plantier,5
Feng
Gao,2
Katharine
Abernethy,1
Lee J. T.
White,6
William
Karesh,6
Paul
Telfer,1
E. Jean
Wickings,1
Philippe
Mauclère,7
Preston A.
Marx,8,9
Françoise
Barré-Sinoussi,4
Beatrice H.
Hahn,2
Michaela C.
Müller-Trutwin,4 and
François
Simon1,5,*
Laboratoire de Virologie, UGENET, SEGC, Réserve de la
Lopé, Centre International de Recherches Médicales,
Franceville, Gabon1; Department of
Medicine and Microbiology, University of Alabama at Birmingham,
Birmingham, Alabama2; Department of
Zoology, University of Oxford, Oxford, United
Kingdom3; Unité de Biologie des
Rétrovirus, Institut Pasteur, Paris,4
and Laboratoire de Virologie, GRAM-IFR23, Faculté de
Médecine, Centre Hospitalier Charles Nicolle,
Rouen,5 France; Wildlife Conservation
Society, Bronx,6 and Aaron Diamond AIDS
Research Center, The Rockefeller University, New
York,9 New York; Centre Pasteur,
Yaoundé, Cameroon7; and Tulane
University Health Sciences Center, New Orleans,
Louisiana8
Received 13 December 2000/Accepted 13 April 2001
 |
ABSTRACT |
Mandrillus sphinx, a large primate living in
Cameroon and Gabon and belonging to the Papionini tribe, was
reported to be infected by a simian immunodeficiency virus (SIV)
(SIVmndGB1) as early as 1988. Here, we have identified a second, highly
divergent SIVmnd (designated SIVmnd-2). Genomic organization differs
between the two viral types; SIVmnd-2 has the additional
vpx gene, like other SIVs naturally infecting the Papionini
tribe (SIVsm and SIVrcm) and in contrast to the other SIVmnd type (here
designated SIVmnd-1), which is more closely related to SIVs infecting
l'hoest (Cercopithecus lhoesti lhoesti) and sun-tailed
(Cercopithecus lhoesti solatus) monkeys. Importantly, our
epidemiological studies indicate a high prevalence of both types of
SIVmnd; all 10 sexually mature wild-living monkeys and 3 out of 17 wild-born juveniles tested were infected. The geographic distribution
of SIVmnd seems to be distinct for the two types: SIVmnd-1 viruses were
exclusively identified in mandrills from central and southern Gabon,
whereas SIVmnd-2 viruses were identified in monkeys from northern and
western Gabon, as well as in Cameroon. SIVmnd-2 full-length sequence
analysis, together with analysis of partial sequences from SIVmnd-1 and
SIVmnd-2 from wild-born or wild-living mandrills, shows that the
gag and pol regions of SIVmnd-2 are closest to
those of SIVrcm, isolated from red-capped mangabeys (Cercocebus
torquatus), while the env gene is closest to that of
SIVmnd-1. pol and env sequence analyses of SIV
from a related Papionini species, the drill (Mandrillus leucophaeus), shows a closer relationship of SIVdrl to SIVmnd-2 than to SIVmnd-1. Epidemiological surveys of human immunodeficiency virus revealed a case in Cameroon of a human infected by a virus serologically related to SIVmnd, raising the possibility that mandrills
represent a viral reservoir for humans similar to sooty mangabeys in
Western Africa and chimpanzees in Central Africa.
| |
INTRODUCTION |
Studies of the origin of human
immunodeficiency viruses (HIV) indicate that these viruses have entered
the human population as a result of zoonotic transmissions of simian
immunodeficiency viruses (SIV) (16). To date, SIV
infections have been detected in more than 20 species of African
nonhuman primates. Complete sequences of these viruses are now
available for 13. These fully characterized SIV can be classified into
at least six approximately equidistant lineages. Five of these are
represented by (i) SIVcpz from chimpanzees (Pan
troglodytes), which groups with HIV type 1 (HIV-1) (7, 16,
35); (ii) SIVsm from sooty mangabeys (Cercocebus
atys), which groups with HIV-2 (5, 22, 27); (iii)
SIVagm from the four African green monkey species (genus Chlorocebus) (1, 11, 21, 30); (iv) SIVsyk from
Sykes' monkeys (Cercopithecus mitis albogularis) (9,
20); and (v) SIVlhoest from L'hoest monkeys
(Cercopithecus lhoesti lhoesti) (2, 19), which
groups with SIVsun from sun-tailed monkeys (Cercopithecus
lhoesti solatus) (3). Note that prior to the identification of SIVlhoest, this fifth SIV lineage was represented by
SIVmnd from mandrills (Mandrillus sphinx) (38).
The sixth lineage, represented by the SIV infecting colobus
monkeys (Colobus guereza), has been described recently
(8).
Based on their genome organization, primate lentiviruses form three
groups. Viruses from the SIVagm, SIVsyk, SIVlhoest/SIVsun, and SIVcol
lineages have a common structure comprising the gag, pol, vif,
vpr, tat, rev, env, and nef genes. Viruses from the SIVcpz/HIV-1 lineage have an additional gene, vpu, in the
central part of the genome, whereas viruses from the SIVsm/HIV-2
lineage have a vpx gene in addition.
The divergence of SIV lineages often matches the divergence of their
primate species host lineages, underscoring the ancient nature of these
lentiviruses (1, 3, 18, 30). In addition to this apparent
host-dependent evolution, different cross-species or cross-subspecies
transmissions have occurred frequently between wild-living or captive
primates (4, 7, 23, 39). African green monkeys have thus
apparently transmitted their virus occasionally to patas monkeys and
baboons (4, 23). And it has been suggested recently that
the SIVmnd described in mandrills is the result of cross-species
transmission to mandrills of a virus related to SIVlhoest (3, 19,
38).
The mandrill is a large semiterrestrial primate belonging to the
Papionini tribe, living in the tropical rain forests of Cameroon and
Gabon (15). SIVmnd was first isolated from mandrills in Gabon in 1988, and from one isolate (SIVmndGB1) a molecular clone was
derived (38) that was the only representative of SIVmnd until now. The genetic divergences observed between SIVmndGB1 and other
SIV from the Papionini tribe preclude an evolutionary history of purely
host-dependent evolution (17, 18). The study of the
evolution of SIV is helpful for the understanding of the origin and
evolution of HIV in humans. SIV from sooty mangabeys belonging to the
Papionini genus have already given rise to a human virus (HIV-2)
(5, 13; R. Marlink, Editorial, AIDS
10:689-699, 1996). To elucidate the infection of M. sphinx by a SIV closely related to that infecting the
Cercopithecini tribe, we investigated the nature of the SIVmnd in
wild-born captive mandrills and in wild-living mandrills from Cameroon
and Gabon using new serological and virological tools. Similarly,
seropositive samples identified in an epidemiological study performed
on the human populations living in these countries were tested in order
to search for the presence of HIV closely related to SIVmnd.
| |
MATERIALS AND METHODS |
Simian samples.
Fifteen wild-born mandrills living in a
large semi-free-ranging colony, established in 1983 at the
International Center for Medical Research in Franceville, Gabon
(CIRMF), were studied. The geographic origins of the mandrills are
given in Table 1. Of the two viruses,
SIVmndGB1 and SIVmndGB2, isolated from two founder animals in 1989, only SIVmndGB1 was completely sequenced, because SIVmndGB2 was
considered very close (38). Viral transmission in the
colony has occurred mostly via aggressive male-to-male conflicts (five
males, designated M3, M9, M13, M14, and M15, were infected in the
colony between 1985 and 1992) (31). A case of vertical
transmission from a female, F17, to one of her offspring was suspected
(31). The six SIVmnd-infected males and F17 died at the
ages of 15 to 20 years of causes unrelated to immunodeficiency. Serum
samples have been collected every year from all mandrills in the colony
and stored at 
80°C. All founder wild-born mandrills in the colony
and their descendants were screened retrospectively for SIV using a new
serological assay designed for specific SIV screening.
Thirteen wild-living mandrills (Lop 1 through Lop 13) were captured,
sampled, and released in 1998 (
n = 6) and 1999 (
n = 7)
during ecological studies in central
Gabon.
Fourteen wild-born but captive mandrills and three drills captured in
the wild when juvenile and since then housed in sanctuaries
in Cameroon
or Gabon were tested on the date of capture, using
the same serological
assay. A female mandrill (BK) housed in the
San Diego Wild Animal Park
since 1984 was also
studied.
Human sera.
A total of 19,762 human blood samples from
Cameroon and Gabon were screened between 1994 and 1999. Of these, 6,515 and 15 were considered HIV-1 and HIV-2 positive, respectively (28; C. Tevi-Benissan, M. Okome, M. Makuwa, M. N. Nkoume, J. Lansoud-Soukate, A. Georges, M. C. Georges-Courbot, and L. Belec,
Letter, Emerg. Infect. Dis. 4:130-131, 1998). These HIV-2
samples were further studied for their specific reactivities against
SIV antigens.
V3 peptide EIA screening.
All the simian and human samples
were tested by a new peptide-based enzyme-linked immunoassay (EIA)
detecting and differentiating antibodies against the V3 regions
representative of the different SIV/HIV lineages (34).
Peptides corresponding to V3 loops of HIV-1, HIV-2, SIVcpz, SIVsm,
SIVagm, SIVrcm, and SIVmnd were synthesized. Wells of polyvinyl
microtiter plates (Falcon) were coated with 100 µl each of 2 µg of
antigen per ml diluted in 0.05 M bicarbonate buffer, pH 9.6, by
incubation for 20 h at 37°C. The wells were washed twice with
phosphate-buffered saline (PBS) containing 0.5% Tween 20 (PBS-TW), and
unoccupied sites were saturated with PBS containing 2% newborn calf
serum (NBCS) by incubation for 45 min at 37°C, followed by washing in
PBS-TW. Each serum sample was tested at a 1:100 dilution in 0.01 M
sodium phosphate buffer, pH 7.4, containing 0.75 M NaCl, 10% NBCS, and
0.5% Tween 20 (PBS-TW-NBCS). The reactivity of each sample to all the
peptides was tested. One hundred microliters of diluted serum was added
to the wells and incubated for 30 min at room temperature. The wells
were washed four times with PBS-TW, and peroxidase-conjugated goat
F(ab')2 anti-human immunoglobulin (Sigma; 100 µl of a
1:2,000 dilution in PBS-TW-NBCS) was added and incubated for 30 min at
room temperature. The wells were washed four times with PBS-TW, and the
reaction was revealed by incubation with hydrogen
peroxide-o-phenylendiamine for 15 min at room temperature. Color
development was stopped with 2 N H2SO4, and the
absorbance (expressed as the optical density [OD]) was read at 492 nm. The cutoff was established at 0.20.
Virus isolation.
Frozen or fresh peripheral blood
mononuclear cells (PBMC) from all infected adult mandrills but one (M3,
for which no PBMC samples were available) were cocultured with human
phytohemagglutinin (PHA)-stimulated PBMC as previously described
(35). Cultures were performed separately in time to avoid
cross-contamination. Viral replication was monitored by a reverse
transcriptase (RT) assay (Lenti-RT Kit; Cavidi Tech AB, Uppsala,
Sweden) and by measurement of p27 antigen with the SIV-monoclonal assay
(SIV p27; Coulter, Hialeah, Fla.) and the HIV-1-polyclonal assay
(Elavia p24; Sanofi-Pasteur, Paris, France).
PCR and sequences.
In order to amplify all SIVmnd,
degenerate primers (DR1 and Hpol4538 for the first round and Hpol4235
and Hpol4538 for the second round) were used to amplify a 303-bp
fragment of pol from total cellular DNA or plasma (7,
10, 35). The 303-bp PCR products were directly sequenced. For
the full-length genome of SIVmnd-2 M14, two specific primers (N-OR1,
CCAAAGGACATGAAAAATAGGCATC, and N-OF1,
AAGGTAGCCACAGTGTGTTGGTGG) were generated to amplify the 5'
and 3' parts of the genome by targeting unintegrated circular DNA from
cultured cells (Expand high-fidelity Taq polymerase; Roche
Diagnostics, Mannheim, Germany). Nested PCRs were performed with
another specific primer (N-OIR1, 5'-GGCCACTGTTTAATTCTKGGKCCATC-3') used with primer LPBS to amplify the 5' part. We used Hpol4235 with LPBS reverse to obtain the 3' part (10). The two
fragments were cloned into the pGEM-T Easy Vector (Promega, Madison,
Wis.). Serial SIVmnd-2 primers were then synthesized to walk along the cloned fragments.
The primers used for amplification of Gp41 were designed by alignment
of SIVmnd-1 GB1 and SIVmnd-2 M14 sequences. In the first
round we
amplified a 2.2-kb fragment by using EnvF1
(5'-ATAGGAAAACAATRTGTRACAGT-3')
and EnvR1
(5'-GTTTAGGCAGGGCTATCGACC-3'), and for the second
round
we used Gp41F (5'-CAGTGTCGGTGGCACTGACTGTC-3')
and Gp41R (5'-CAGTGTCGGTGGCACTGAC
TGTC-3'). PCR
products of 540 bp were sequenced
directly.
Sequence alignment.
Alignments were constructed for the
partial pol gene (integrase region), the partial
env gene (gp41 region), and the gag, pol, vif, vpr,
vpx, tat, env, and nef genes using CLUSTAL W
(37). Alignments were adjusted manually where necessary.
Exons that are entirely overlapped by other genes (the second
tat exon and both rev exons) were not included in
the analyses. Regions of ambiguous alignment and all gap-containing
sites were excluded.
SIVmnd type 2 diversity plot.
A concatenated amino acid
alignment (proteome) was constructed that included the genes gag,
pol, vif, and env. Note that the regions of
pol that overlapped gag and vif were
excluded from the concatenated alignment. The genetic distance between
SIVmnd-2 M14 and representative SIV was calculated in 300-amino-acid
windows that were incremented by 10 amino acids across the proteome
alignment. For each pairwise comparison, amino acid sequence
differences were plotted against the midpoint of each window.
Phylogenetic analyses.
Phylogenetic trees inferred from
amino acid sequence alignments were constructed by the neighbor-joining
method (33), implemented using NEIGHBOR from the Phylogeny
Inference Package (PHYLIP), version 3.5c, and distance matrices were
generated with the JTT model of amino acid substitution
(24), implemented using TREE-PUZZLE (36).
Phylogenetic clusterings were assessed by performing 1,000 bootstrap
replicates (implemented using SEQBOOT, NEIGHBOR, and CONSENSE from the
PHYLIP package), with the JTT distance matrices generated using
PUZZLEBOOT.sh (available from TREE-PUZZLE's website at
http://www.tree-puzzle.de). Phylogenetic trees inferred from nucleotide
sequence alignments were constructed by the neighbor-joining method
with the HKY model of nucleotide substitution, implemented by using
PAUP (Phylogenetic Analysis Using Parsimony), version 4. Phylogenetic
clusterings were assessed by performing 1,000 bootstrap replicates
using PAUP to implement neighbor joining with the HKY model of
nucleotide substitution. Maximum likelihood analysis, using 10 sequences from each alignment, was also implemented, by using PROTML
(with the JTT model of amino acid substitution) or NUCML (with the HKY
model of nucleotide substitution) from the MOLPHY package, version 2.2, to perform an exhaustive search of all possible tree topologies and to
identify the 100 best topologies with approximate likelihoods; the
maximum-likelihood tree was then identified among these.
Nucleotide sequence accession numbers.
All the SIVmnd
sequences obtained in this study have been submitted to GenBank
(accession numbers AF328276 to AF328295).
| |
RESULTS |
SIVmnd infects adult and juvenile mandrills in a
semi-free-ranging colony.
The retrospective serological screening
with the new SIV-specific EIA (34) confirmed that the two
founder mandrills, M7 and F17, were already SIV positive upon their
arrival at the CIRMF. EIA analysis also confirmed subsequent
intracolony infection of five adult males (M3, M9, M13, M14, and M15).
Five out of the 16 descendants of F17 (17B, 17D, 17D1, 17D2, and 17G)
were revealed to be seropositive as well (Table 1). We thus confirmed
the SIV infection in monkeys previously described as SIV infected (M7, F17, M3, M9, M13, M14, M15, and F17B) (31) and revealed
four new cases of SIV seropositivity in recently born descendants of the female F17, suggesting a mother-to-child transmission in the colony
(Fig. 1 and Table 1).
View larger version (70K):
[in this window]
[in a new window]
|
FIG. 1.
Geographic origins of the seropositive samples and range
of M. sphinx, M. leucophaeus, C. solatus, and C. torquatus.
|
|
In order to isolate the virus from all animals, frozen or fresh PBMC
from all seropositive mandrills except one (M3, for which
PBMC samples
were missing) were cocultured with human PHA-stimulated
PBMC. Cultures
were performed separately in time to avoid cross-contamination.
Strong
RT activity was detected in all culture supernatants after
7 to 14 days
of culture. SIVmnd isolates from males were positive
in both the
anti-SIV p27 monoclonal and anti-HIV-1 p24 polyclonal
assays, whereas
the Gag antigen of the SIVmnd isolated from F17
and her offspring was
detected only by the HIV-1 polyclonal assay
(data not shown). This
discrepancy between polyclonal and monoclonal
antibody detection
suggested strong antigenic differences between
the
strains.
Evidence for the cocirculation of a second SIVmnd strain within the
colony.
In order to further examine the antigenic differences
between the SIVmnd viruses derived from the founder animals M7 and F17, we tested the serum samples from the SIVmnd-infected animals with distinct commercial HIV-1/HIV-2 serological assays (Genscreen HIV1/2
[Bio-Rad-Sanofi] and HIV Determine [Abbott]). Interestingly, the
sera from F17 and three of the five infected offspring remained negative in these tests, whereas the sera from the adult males were
positive. To analyze whether these antigenic differences were
associated with genetic differences between the M7- and F17-derived strains, we performed PCR amplification with DNA from uncultured PBMC
from all seropositive mandrills. The PCRs were performed at different
times for each strain, in addition to the usual precautions, in order
to avoid contamination. By using primers specific for SIVmndGB1, we
obtained positive results only for samples from F17 and her five
seropositive descendants. In contrast, using these SIVmndGB1-related
primers, we failed to amplify the DNA from the PBMC collected from the
males. In order to exclude the possibility that the negative results
for the adult males were due to a lower viral load, we amplified a
region (pol integrase) of all SIVmnd in the colony by using
degenerated pol primers for PCR. This pol region
was sequenced for all viruses.
Phylogenetic analysis of these
pol sequences showed a very
close clustering of SIVmnd from F17 with that from her five descendants
(17B, 17D, 17D1, 17D2, and 17G), confirming that they are
epidemiologically
linked infections (Fig.
2). The integrase fragment of SIVmndF17
was also very closely related to the sequence of the SIVmndGB1
clone.
Pairwise sequence comparison indicated that SIVmndF17 shares
high
nucleotide identity with the SIVmndGB1 clone (99% identity),
strongly
suggesting that they are viruses from the same infected
individual.
Together with the SIVmndGB1 clone, SIVmndF17 sequences
were more
closely related to SIV from l'hoest monkeys than to
other SIV. In
contrast, SIVmnd from M7, M9, M13, M14, and M15
formed a group of
highly related sequences that are more closely
related to SIVdrl, a
virus from the drill (
Mandrillus leucophaeus)
(
6), than to SIVmndGB1 in this
pol region (Fig.
2), confirming
that the viruses from the males are epidemiologically
related
to each other (
31) and indicating that the founder
animal M7
was a carrier of a highly divergent SIV, distinct from
SIVmndF17/GB1.
These results show that two distinct SIVmnd are
cocirculating
in this colony, in contrast to what has been previously
published
(
31,
38).
View larger version (17K):
[in this window]
[in a new window]
|
FIG. 2.
Phylogenetic relationships in a pol region of
newly derived SIVmnd sequences from adult and juvenile mandrills living
in a semi-free-ranging colony at CIRMF in Gabon to other primate
lentiviruses. This unrooted neighbor-joining tree (see Materials and
Methods for further details) was inferred from amino acid comparisons
from the pol integrase region; 138 amino acid sites were
included. SIVmndGB1 corresponds to the sequence of the molecular clone
(38). The numbers correspond to bootstrap support for
phylogenetic clusterings. Bootstrap values lower than 75% are not
shown. Branch lengths are drawn to scale, with the scale bar indicating
amino acid replacements per site.
|
|
In order to exclude the possibility of contamination producing these
results, uncultured frozen PBMC sampled from M7 early
after his arrival
in the colony and stored since then were directly
amplified using the
same strategy. Resequencing confirmed that
this animal was infected in
the wild by a strain serologically
and genetically different from
SIVmndGB1, the sequence of which
was previously published. The female
F17, who was still alive,
was resampled, her proviral and plasma
viruses were directly sequenced,
and these sequences confirmed that her
virus corresponds to SIVmndGB1.
These data correlate with the antigenic
and serological discrepancies
observed between SIVmndM7 and
SIVmndF17.
Identification of a second SIVmnd type.
We decided to analyze
the full-length genome sequence from the divergent SIVmnd circulating
in the males. Due to the limited volume of the original M7 samples, we
sequenced the proviral genome from another male (M14) infected by M7 in
1988 (31). In contrast to SIVmndGB1, the genome
organization of SIVmndM14 was similar to that of SIVsm and HIV-2,
with the presence of an additional accessory gene, vpx.
SIVmndM14 also has an unusual long terminal repeat (LTR) structure, as
the potential
trans-activation response element (TAR)
structure is different from that of the other SIV. Three stem-loop
elements can be predicted. The first stem-loop is most similar
to that
found in SIVrcm, with a 2-base UU bulge, but is distinguished
by the
presence of a 7-base loop (CUGGGUU). The other two TAR
elements found in SIVmndM14 were more similar to the first stem-loop
structure found in SIVmndGB1, both presenting the characteristic
4-base
bulge. The loop sequences were indistinguishable from the
consensus
CUGGGX. Two Sp1 and two NF-
B binding sites were predicted
upstream of the TATA
box.
Whatever the causes of the previous misidentification of SIVmnd, due to
the distinct genome organizations and phylogenetic
relationships we
have identified, and for reasons of clarity,
we propose to classify the
SIVmndGB1-related viruses as SIVmnd
type 1 (SIVmnd-1) and the
SIVmndM14-related viruses as type 2
(SIVmnd-2).
SIVmnd-2 is a complex recombinant.
Genetic identities between
the SIVmnd-2 representative SIVmnd-2 M14 and other representative
SIV were determined (Table 2). Across
gag, pol, vif, vpx, and tat, SIVmnd-2 M14
is more closely related to SIVrcm. In vpr SIVmnd-2 M14 is
just as closely related to SIVsmH4 as to SIVrcm. Across env
and nef, SIVmnd-2 M14 is more closely related to SIVmndGB1,
the SIVmnd-1 representative. The env V3 loop sequences in
SIVmnd-1 (NRSVVSTPSATGLLFYHGLEPGKNLKKG) and SIVmnd-2
(NRSIVSVPSASGLIFYHGLEPGRNLKKG) are highly conserved relative to each other, explaining why our V3-based peptide EIA strategy succeeded in detecting these different viruses in the CIRMF
colony, regardless of the infecting type.
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Amino acid sequence identities from pairwise comparisons
of SIVmnd-2 M14 with other SIV representative of primate
lentiviruses
|
|
The distinct relationships of SIVmnd-2 M14 with other SIV according to
the genomic region analyzed were further investigated
by
constructing a proteome including the genes
gag, pol,
vif,
and
env and performing diversity plotting
comparing SIVmnd-2 M14
with representative SIV (Fig.
3). Across
gag, pol, and
vif, SIVmnd-2
M14 is more closely related to SIVrcm, while
across
env, SIVmnd-2
M14 is closest to SIVmnd-1 GB1. Such a
switch in pairwise genetic
distances between sequences is indicative of
a recombinant ancestry
of SIVmnd-2 M14.
View larger version (19K):
[in this window]
[in a new window]
|
FIG. 3.
Diversity plot comparing SIVmndM14 (the SIVmnd-2
representative) to SIVmndGB1 (the SIVmnd-1 representative), SIVrcm,
SIVsun, SIVlhoest, SIVsm, and SIVagm. For each pairwise comparison,
protein sequence difference was plotted against the midpoint of a
300-amino-acid window that was incremented by 10 amino acids across a
proteome alignment including the genes gag, pol, vif, and
env. The positions of these genes are shown beneath the
plot.
|
|
We further tested the hypothesis that SIVmnd-2 M14 is a recombinant
strain by phylogenetic analysis. Phylogenetic trees constructed
for
each gene region confirmed the relationship of SIVmnd-2 M14
with SIVrcm
in
gag, pol, vif,
vpr, and
vpx and
with SIVmnd-1 GB1
in
env and
nef. The discordant
phylogenetic position of SIVmnd-2
M14 according to genomic region is
shown in Fig.
4 and was inferred
from the
gag-pol-vif-env concatenated alignment. Note that both
SIVrcm and SIVmnd-2 M14 show similarity with SIVcpz and HIV-1
in at
least part of
pol, while in
env and
nef, SIVmnd-2 M14 clusters
with SIVmndGB1, close to
SIVlhoest. The phylogenetic clustering
of SIVmnd-2 M14 with either
SIVrcm or SIVmndGB1 was highly significant
(as assessed by bootstrap
values), and the same discordant relationships
were confirmed in tree
topologies chosen using maximum likelihood.
View larger version (31K):
[in this window]
[in a new window]
|
FIG. 4.
Discordant phylogenetic relationships of SIVmnd-2 M14
(highlighted) in the gag-pol-vif (A) and env (B)
regions. Rooted phylogenetic trees inferred by neighbor joining (see
Materials and Methods for details) show the relationships of SIVmnd
M14, the SIVmnd-2 representative, to other primate lentiviruses. The
gag-pol-vif (A) and env (B) regions used to
construct the trees correspond to positions 1 to 1403 and 1404 to 1959, respectively, in the proteome alignment (see Fig. 3). The numbers
correspond to bootstrap support for the clusters to the right.
|
|
Both SIVmnd types are present in the wild.
If the
recombination between SIVmnd-1 and SIVmnd-2 had happened in the colony,
we should have detected a dually infected animal. Since this was not
the case, we suspected that the SIVmnd-2 recombinant form was
circulating in the wild and was introduced into the colony by the
founder animal M7. We therefore screened wild animals for SIVmnd-2 and
addressed in parallel the question whether SIVmnd-1 is equally
distributed in the wild or rather resembles a "dead-end" infection.
Thirteen free-living mandrills in a large colony of 700 individuals in
the Lopé reserve (central Gabon [Fig. 1]), were tested first:
all 10 adults (6 males and 4 females) were strongly reactive against
SIVmnd V3 in the EIA, while the three juvenile mandrills were negative
(Table 1). PCR amplification of short fragments of pol
(integrase) or env (gp41) was successful in 4 out of 10 seropositive samples (Lop 4, 6, 7, and 12); cellular control DNA was
unamplifiable in the others, suggesting a low quality of the DNA
collected under field conditions. We first sequenced a region in
pol because it allows discrimination between SIVmnd-1 and
SIVmnd-2. We sequenced this region for SIVmndLop4 and SIVmndLop6.
Phylogenetic analysis shows that these adult wild M. sphinx
individuals were infected by viruses that cluster with SIVmnd-1 (Fig.
5A and B). Amino acid comparisons of
SIVmndLop4 to SIVmndLop6 show that these strains have 95.6% identity
with each other, SIVmndLop4 identities with SIVmnd-1 GB1 and SIVmnd-2 M7 being 96 and 63%, respectively. The sequence divergences between SIVmndLop4 and SIVmndLop6 were significantly higher than that among
SIVmnd-1 viruses from the semi-free-ranging colony at CIRMF, suggesting that they are not directly epidemiologically linked, but rather that they correspond to distinct viral representatives of
SIVmnd-1. For SIVmndLop7 and SIVmndLop12, we successfully sequenced a
short fragment (339 nucleotides) of gp41 env. The length of the sequence did not allow us to perform a phylogenetic analysis, but we observed 95 and 70% amino acid identify with
SIVmnd-1 GB1 and SIVmnd-2 M14, respectively. No
SIVmnd-2-infected mandrills were found in this group. Thus, the
first assessment of SIVmnd prevalence in wild-living monkeys indicates
that SIVmnd-1 circulates in wild mandrills of central Gabon. In
addition, the infection prevalence seems high in sexually mature
mandrills, irrespective of sex, and raises the possibility of sexual
transmission of SIVmnd-1 in the wild.
View larger version (17K):
[in this window]
[in a new window]
|
FIG. 5.
Phylogenetic relationships in a pol region of
SIVmnd and SIVdrl strains isolated from adult and juvenile mandrills
and drills of distinct geographic origins (Table 1). (A) Unrooted
phylogenetic tree showing both the SIVmnd-1 and SIVmnd-2 clades; (B and
C) rooted phylogenetic trees showing the SIVmnd-1 clade and the
SIVmnd-2 clade, respectively. The three phylogenetic trees were
inferred by neighbor joining. The unrooted phylogeny was inferred from
amino acid sequence comparisons (138 amino acid sites) of
pol integrase. The two rooted phylogenies were inferred from
nucleotide sequence comparisons (414 nucleotide sites) from the same
pol region.
|
|
We then screened mandrills originating from other geographic regions.
The animals studied correspond to 14 mandrills that
were captured at a
young age in southwestern Cameroon and northern
or western Gabon and
were subsequently kept as pets or housed
in rescue centers (Fig.
1; Table
1). These animals had been removed
from the wild before
the onset of sexual maturity and had had
no further contact with
infected animals. Three out of the 14
juvenile mandrills, one from
Cameroon (female 302) and two from
western Gabon (female PG13 and male
PL7), were V3 EIA positive.
Plasma amplification succeeded in two
cases (animals 302 and PG13).
Sequencing of the integrase
confirmed that these two
M. sphinx individuals were
infected by SIVmnd (Fig.
5A and C). Both SIVmndPG13
and SIVmnd302
clustered together with SIVmnd-2 in this region.
In order to study
whether they have a mosaic genome similar to
SIVmnd-2 M14, we analyzed
the gp41
env sequence from SIVmnd302.
This SIVmnd from
Cameroon is closely related to the SIVmnd-2 found
in Gabon, indicating
that it is also a recombinant (Fig.
6).
In
addition it provides evidence for a widespread distribution of
SIVmnd-2.
View larger version (21K):
[in this window]
[in a new window]
|
FIG. 6.
Phylogenetic relationships of SIVmnd-2 M14, SIVmnd302,
and SIVdrl007 isolated from mandrills and drills from Cameroon and
Gabon to other primate lentiviruses in an env region. This
unrooted tree is inferred from amino acid comparisons (146 amino acid
sites remained after gap stripping) from env (gp41
region).
|
|
Like type 1, SIVmnd-2 was found in both sexes. As the age range of the
SIVmnd-2-infected mandrills resembles that of mandrills
infected
vertically by SIVmnd-1 in the CIRMF colony, mother-to-child
transmission in the wild cannot be
excluded.
We identified another case of SIVmnd-2 infection in the United States
(Table
1). A female mandrill (BK) born in Sarasota,
Fla., in 1971 and
housed in the San Diego Wild Animal Park since
1984 was found to be
seropositive in 1989, and the virus was isolated.
Sequence comparision
in
gag, pol (Fig.
5A and C), and
env indicated
90% identity with the SIVmnd-2 from mandrill M14. BK died at the
age
of 18 years from persistent diarrhea and weight loss, invasive
Balantidium coli infection unresponsive to standard
therapies,
and disseminated atypical mycobacteriosis. However, despite
the
fact that such symptoms are indicative of immunodeficiency, one
should note that 18 years represents the natural life span of
a
mandrill in
captivity.
SIVdrl are more related to SIVmnd-2 than to SIVmnd-1.
Mandrills are closely related to drills (M. leucophaeus) and
allopatric with them (13). Drills have recently been
reported to carry SIV (6). In order to study the
relationship between SIVmnd and SIVdrl (Fig. 2), we characterized
SIVdrl further. We identified three drills (Drl 006, Drl 007, and Drl
207) whose sera reacted positively with the V3 SIVmnd peptide in an
EIA. All three were wild born in Cameroon. Drl 207, a sexually immature 4-year-old monkey, was already positive at the date of its rescue, confirming that this SIVdrl strain represents a natural infection. We
sequenced a pol region from all three SIVdrl (Fig. 5A and
C). They are the most closely related to the formerly described SIVdrl (6), which in turn is much more closely related to
SIVmnd-2 than to SIVmnd-1. A 339-bp sequence in gp41 of SIVdrl007
indicates that it has the same recombinant structure as SIVmnd-2 (Fig.
6). M. sphinx and M. leucophaeus are the two
species of the Mandrillus genus, and the phylogenetic
relationships between SIVdrl and SIVmnd-2 suggest that these related
viruses might have codiverged in their respective host species.
A human virus serologically related to V3 of SIVmnd.
Our
results show that SIVmnd-2 is related to SIV from the Papionini
tribe. Indeed, it has the same genomic organization as SIVsm, and it is phylogenetically related to SIVrcm and SIVdrl. Viruses
from the Papionini, such as SIVsm, seem to be transmissible to humans.
We addressed the question whether humans could be at risk for SIVmnd-2
by looking for SIVmnd-related viruses in humans. We screened samples
collected during a large survey of HIV diversity in Cameroon and Gabon
performed between 1994 and 1999 (28; Tevi-Benissan et al.,
letter, 1998). Among the 6,515 HIV-positive sera, 15 were positive by
HIV-2 Western blotting (WB). By our HIV and SIV V3-specific EIA, 14 out
of the 15 sera reacted specifically with the SIVsm/HIV-2 V3 loop. The
remaining subject (patient 97-6178) was a 65-year-old symptom-free man
attending a clinic in South Cameroon. His HIV-2 WB was positive for
transmembrane and core antigens but not for pol products.
Conversely, his HIV-1 WB was positive only for pol products.
On a commercial dot test using separate HIV-1 recombinant protein and
HIV-2 transmembrane peptide as antigens (Multispot; Bio-Rad-Pasteur),
the serum reacted only against the HIV-1 recombinant spot. These
unusual serological profiles prompted us to further characterize this
sample. We observed a high reactivity directed solely and strongly
against the SIVmnd V3 loop (Table 3). We then compared these results to
those obtained for 164 HIV-2-infected patients (150 living in France
and 14 from Cameroon and Gabon) and to those of our SIVmnd-infected
mandrills. Table 3 summarizes the
specificity of our V3 loop peptide assay. The HIV-2 samples reacted
strongly against the HIV-2/SIVsm V3 loop and displayed a low
cross-reactivity against the SIVagm V3 loop. None of these HIV-2
samples reacted against the SIVmnd loop. All the samples from
seropositive mandrills reacted only against their specific peptide,
with no cross-reactivity against the heterologous V3 peptides (Table
3).
All molecular investigations of this atypical human serum sample,
stored under local conditions before shipping to our laboratory,
were
unsuccessful. An attempt to isolate the strain was also negative.
A
poorly replicating virus could explain these failures. The patient
has
since been lost to follow-up, precluding firm diagnosis. However,
given
the high V3 loop sequence divergence between SIV and HIV,
the accuracy
and the high specificity of our peptide EIA, and
the strong and
specific reactivity of this human sample against
the SIVmnd V3 region,
this result can only be explained by infection
with a virus that is
SIVmnd-like, at least in this region of
Env.
| |
DISCUSSION |
SIVmnd classification.
Our results show that two distinct SIV
types infect wild-living mandrills. These two SIVmnd are
different with respect to (i) their phylogenetic relationships,
clustering in different SIV lineages in phylogenies inferred from
different genomic regions; (ii) genome structures, as SIVmnd-1
(represented by GB1) lacks the vpx gene whereas the second
virus, SIVmnd-2 (represented by M14), includes it; and (iii) antigenic
properties, as shown by a commercial EIA and a p24 antigen assay. These
data are analogous to the situation encountered in humans. The
human population is infected by two different lentiviral types, HIV-1
and HIV-2, which have different origins, different genome structures,
and different antigenic properties (Marlink, editorial, 1996). These
features, together with epidemiological evidence for the circulation of these two mandrill viruses in the wild, call for a classification system for SIVmnd. We propose, by analogy with HIV classification, that
these viruses be considered different "types" of SIVmnd. We suggest
that the original lineage of SIVmnd, which includes SIVmndGB1, be named
SIVmnd type 1 (SIVmnd-1) and that the second lineage, identified here,
be classified as SIVmnd type 2 (SIVmnd-2).
SIVmnd, an SIV diversity paradigm: host-dependent evolution
versus cross-species transmission.
The two types of SIVmnd
naturally infecting M. sphinx can be considered a
model for the complexity of HIV/SIV evolution. Both SIVmnd types
circulate in the wild, but they might have a distinct geographic
distribution. All SIVmnd-2-infected mandrills originated from Cameroon
(the region south of the Sanaga River) and the neighboring region
of north Gabon (north of the Ogooué River), (Fig. 1). Conversely,
the SIVmnd-1-infected mandrills were found south of the
Ogooué River. Studies of mitochondrial DNA from infected mandrills will determine if a differential haplotype distribution coincides with the SIVmnd type distribution.
SIVmnd-1 most likely originates from an ancient cross-species
transmission from a
Cercopithecinae ancestor (
2,
3,
19).
Our data demonstrate that this cross-transmission between
two
different genera is not a dead-end, as this virus is apparently
spreading among wild mandrills. According to our data, however,
SIVmnd-2 might have a more host-specific history than SIVmnd-1.
SIVmnd-2 shares a high degree of homology in the 5' end of the
genome
with SIVdrl and SIVrcm, which have been isolated from other
species
belonging to the Papionini tribe, favoring a common SIV
ancestor for
these strains. The ancestor of the current SIVmnd-2
is probably a
recombinant, as SIVmnd-2 is related to SIVrcm in
gag and
pol, and SIVrcm itself is a recombinant form, sharing
homology in
pol with SIVcpz and a relationship with SIVsm in
gag (
7,
14). Interestingly,
C. torquatus is the closest relative
of the
Mandrillus
genus (
17). Our data indicate that the prevalence
of both
types seems sufficiently high in nature to allow dual
infection. An
overlapping geographic range in the past between
mandrills infected by
the different types would explain how recombination
could occur between
the SIVmnd-2 parental virus and SIVmnd-1,
but although possible, this
remains to be
demonstrated.
These apparently successful recombination events between strains
infecting different genera illustrate the potential of lentiviral
diversification. Recent evidence suggests not only that recombination
between distinct lentiviruses is possible but also that this phenomenon
is responsible for the emergence of viruses which have succeeded
in
dominating the epidemics in both human and nonhuman primates.
HIV-1
group M recombinant forms are successfully spreading in
the world
(
12,
25,
29,
32). Also, at least two nonhuman
primate
species are infected with recombinant forms of lentiviruses:
Cercopithecus aethiops sabaeus (
23) and
red-capped mangabeys
(
14). Taken together, the
characterization of two SIVmnd types
epitomizes our knowledge of
SIV diversity, including codivergence
of SIV and host species, SIV
cross-species transmission between
primates, and, finally,
recombination. These data further demonstrate
that recombinant viral
forms have a great capacity to contribute
to epidemics and might
explain why the circulation of the parental,
nonrecombinant SIVmnd-2
ancestor, which might be rare or is now
extinct, went undetected in
epidemiological
studies.
Zoonotic transmission of SIVmnd?
A case of
retrovirus transmission from mandrills to humans has already been
documented. Simian T-cell lymphotrophic virus type 1 (STLV-1) from
M. sphinx has been described as the simian counterpart of
human T-cell lymphotrophic virus type 1 (HTLV-1) subtype D
(26). Indeed, a close molecular and phylogenetic
relationship has been reported between STLV-1 subtype D from mandrills
in Gabon and HTLV-1 strains obtained from pygmies living in Cameroon
and the Central African Republic and from a healthy nonpygmy carrier in Gabon.
The atypical serological reactivities observed with commercial assays
for a serum from an HIV-infected human in Cameroon already
indicated
that the patient could be infected by a virus which
is different from
known HIV-1 or HIV-2. Our peptide-based serological
test, which
displays a high discriminatory capacity between HIV
and SIV from
different lineages (
34), revealed a human case
of
lentiviral infection serologically reactive to the SIVmnd V3
peptide.
The high rate of SIV seropositivity in wild mandrills
favors the
probability of exposure of the population to infected
blood during
hunting or food preparation, as the wild troops of
mandrills in
Cameroon and Gabon are heavily hunted. Moreover,
juvenile mandrills are
often kept as pets. As SIVsm was able to
jump to the human population,
the possibility that SIVmnd-infected
mandrills could also represent a
reservoir posing a risk for humans
cannot be excluded. This single case
of human infection by a strain
serologically related to SIVmnd V3 may
represent a dead-end infection,
similar to those observed for subtypes
D and E of HIV-2 infection
(
13). However, this needs
confirmation by sequence identification.
This case, nonetheless, does
illustrate the potential for currently
unrecognized zoonotic
reservoirs of AIDS viruses for
humans.
In conclusion, we have identified a second SIV type naturally infecting
M. sphinx. Mandrills, naturally infected by two distinct
SIV
lineages, could be a useful model for coinfection studies.
The
observation of SIVmnd mother-to-child transmission opens up
research
opportunities for better understanding of one major public
health
problem of HIV/AIDS. Finally, our epidemiological study
of humans
illustrates that the HIV pandemic still calls for large-scale
and
longitudinal worldwide epidemiological
surveys.
| |
ACKNOWLEDGMENTS |
This work was supported by the French National Agency on AIDS
Research (ANRS), grant 2000/038, and grants NO1 AI 85338 (to B.H.H.) and RO1 AI 44596 (to P.M. and B.H.H.) from the
National Institutes of Health. D.L.R. is supported by a Wellcome Trust Biodiversity Fellowship, and C.K. is supported by the Daimler-Benz Foundation.
We thank John Clewley for permission to use an unpublished SIVdrl
sequence. Blood sampling from mandrills was performed by Pierre Rouquet
(CIRMF), Jack Allen, Kent Osbom, April Gorow (SDZ/WAP, San Diego,
Calif.), Stacey Hoffman, Myra Jennings, Nicholas W. Lerche (California
Regional Primate Research Center, University of California, Davis),
William Karesh, and John Lewis.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratoire de
Virologie, Centre Hospitalier Universitaire Charles Nicolle, 1 rue de Germont, 76031 Rouen, France. Phone: 33 2 32 88 82 36. Fax: 33 2 32 88 83 10. E-mail: francois.simon{at}chu-rouen.fr.
| |
REFERENCES |
| 1.
|
Allan, J. S.,
M. Short,
M. E. Taylor,
S. Su,
V. M. Hirsch,
P. R. Johnson,
G. M. Shaw, and B. H. Hahn.
1991.
Species-specific diversity among simian immunodeficiency viruses from African green monkeys.
J. Virol.
65:2816-2828[Abstract/Free Full Text].
|
| 2.
|
Beer, B. E.,
E. Bailes,
G. Dapolito,
B. J. Campbell,
R. M. Goeken,
M. K. Axthelm,
P. D. Markham,
J. Bernard,
D. Zagury,
G. Franchini,
P. M. Sharp, and V. M. Hirsch.
2000.
Patterns of genomic sequence diversity among their simian immunodeficiency viruses suggest that L'Hoest monkeys (Cercopithecus lhoesti) are a natural lentivirus reservoir.
J. Virol.
74:3892-3898[Abstract/Free Full Text].
|
| 3.
|
Beer, B. E.,
E. Bailes,
R. Goeken,
G. Dapolito,
C. Coulibaly,
S. G. Norley,
R. Kurth,
J. P. Gautier,
A. Gautier-Hion,
D. Vallet,
P. M. Sharp, and V. M. Hirsch.
1999.
Simian immunodeficiency virus (SIV) from sun-tailed monkeys (Cercopithecus solatus): evidence for host-dependent evolution of SIV within the C. lhoesti superspecies.
J. Virol.
73:7734-7744[Abstract/Free Full Text].
|
| 4.
|
Bibollet-Ruche, F.,
A. Galat-Luong,
G. Cuny,
P. Sarni-Manchado,
G. Galat,
J. P. Durand,
X. Pourrut, and F. Veas.
1996.
Simian immunodeficiency virus infection in a patas monkey (Erythrocebus patas): evidence for cross-species transmission from African green monkeys (Cercopithecus aethiops sabaeus) in the wild.
J. Gen. Virol.
77:773-781[Abstract/Free Full Text].
|
| 5.
|
Chen, Z.,
P. Telfer,
A. Gettie,
P. Reed,
L. Zhang,
D. D. Ho, and P. A. Marx.
1996.
Genetic characterization of new West African simian immunodeficiency virus SIVsm: geographic clustering of household-derived SIV strains with human immunodeficiency virus type 2 subtypes and genetically diverse viruses from a single feral sooty mangabey troop.
J. Virol.
70:3617-3627[Abstract].
|
| 6.
|
Clewley, J. P.,
J. C. Lewis,
D. W. Brown, and E. L. Gadsby.
1998.
A novel simian immunodeficiency virus (SIVdrl) pol sequence from the drill monkey, Mandrillus leucophaeus.
J. Virol.
72:10305-10309[Abstract/Free Full Text].
|
| 7.
|
Corbet, S.,
M. C. Müller-Trutwin,
P. Versmisse,
S. Delarue,
A. Ayouba,
J. Lewis,
S. Brunak,
P. Martin,
F. Brun-Vezinet,
F. Simon,
F. Barre-Sinoussi, and P. Mauclere.
2000.
env sequences of simian immunodeficiency viruses from chimpanzees in Cameroon are strongly related to those of human immunodeficiency virus group N from the same geographic area.
J. Virol.
74:529-534[Abstract/Free Full Text].
|
| 8.
|
Courgnaud, V.,
X. Pourrut,
F. Bibollet-Ruche,
E. Mpoudi-Ngole,
A. Bourgeois,
E. Delaporte, and M. Peeters.
2001.
Characterization of a novel simian immunodeficiency virus from guereza colobus monkeys (Colobus guereza) in Cameroon: a new lineage in the nonhuman primate lentivirus family.
J. Virol.
75:857-866[Abstract/Free Full Text].
|
| 9.
|
Emau, P.,
H. M. McClure,
M. Isahakia,
J. G. Else, and P. N. Fultz.
1991.
Isolation from African Sykes' monkeys (Cercopithecus mitis) of a lentivirus related to human and simian immunodeficiency viruses.
J. Virol.
65:2135-2140[Abstract/Free Full Text].
|
| 10.
|
Fransen, K.,
P. Zhong,
H. De Beenhouwer,
G. Carpels,
M. Peeters,
J. Louwagie,
W. Janssens,
P. Piot, and G. van der Groen.
1994.
Design and evaluation of new, highly sensitive and specific primers for polymerase chain reaction detection of HIV-1 infected primary lymphocytes.
Mol. Cell. Probes.
8:317-322[CrossRef][Medline]. (Erratum, 9:373, 1995.)
|
| 11.
|
Fukasawa, M.,
T. Miura,
A. Hasegawa,
S. Morikawa,
H. Tsujimoto,
K. Miki,
T. Kitamura, and M. Hayami.
1988.
Sequence of simian immunodeficiency virus from African green monkey, a new member of the HIV/SIV group.
Nature
333:457-461[CrossRef][Medline].
|
| 12.
|
Gao, F.,
D. L. Robertson,
S. G. Morrison,
H. Hui,
S. Craig,
J. Decker,
P. N. Fultz,
M. Girard,
G. M. Shaw,
B. H. Hahn, and P. M. Sharp.
1996.
The heterosexual human immunodeficiency virus type 1 epidemic in Thailand is caused by an intersubtype (A/E) recombinant of African origin.
J. Virol.
70:7013-7029[Abstract/Free Full Text].
|
| 13.
|
Gao, F.,
L. Yue,
D. L. Robertson,
S. C. Hill,
H. Hui,
R. J. Biggar,
A. E. Neequaye,
T. M. Whelan,
D. D. Ho,
G. M. Shaw, et al.
1994.
Genetic diversity of human immunodeficiency virus type 2: evidence for distinct sequence subtypes with differences in virus biology.
J. Virol.
68:7433-7447[Abstract/Free Full Text].
|
| 14.
|
Georges-Courbot, M. C.,
C. Y. Lu,
M. Makuwa,
P. Telfer,
R. Onanga,
G. Dubreuil,
Z. Chen,
S. M. Smith,
A. Georges,
F. Gao,
B. H. Hahn, and P. A. Marx.
1998.
Natural infection of a household pet red-capped mangabey (Cercocebus torquatus torquatus) with a new simian immunodeficiency virus.
J. Virol.
72:600-608[Abstract/Free Full Text].
|
| 15.
|
Grubb, P.
1973.
Distribution, divergence and speciation of the drill and mandrill.
Fol. Primatol.
20:161-177.
|
| 16.
|
Hahn, B. H.,
G. M. Shaw,
K. M. De Cock, and P. M. Sharp.
2000.
AIDS as a zoonosis: scientific and public health implications.
Science
287:607-614[Abstract/Free Full Text].
|
| 17.
|
Harris, E. E., and T. R. Disotell.
1998.
Nuclear gene trees and the phylogenetic relationships of the mangabeys (Primates: Papionini).
Mol. Biol. Evol.
15:892-900[Abstract].
|
| 18.
|
Hasegawa, M.,
H. Kishino, and T. Yano.
1985.
Dating of the human-ape splitting by a molecular clock of mitochondrial DNA.
J. Mol. Evol.
22:160-174[CrossRef][Medline].
|
| 19.
|
Hirsch, V. M.,
B. J. Campbell,
E. Bailes,
R. Goeken,
C. Brown,
W. R. Elkins,
M. Axthelm,
M. Murphey-Corb, and P. M. Sharp.
1999.
Characterization of a novel simian immunodeficiency virus (SIV) from L'Hoest monkeys (Cercopithecus l'hoesti): implications for the origins of SIVmnd and other primate lentiviruses.
J. Virol.
73:1036-1045[Abstract/Free Full Text].
|
| 20.
|
Hirsch, V. M.,
G. A. Dapolito,
S. Goldstein,
H. McClure,
P. Emau,
P. N. Fultz,
M. Isahakia,
R. Lenroot,
G. Myers, and P. R. Johnson.
1993.
A distinct African lentivirus from Sykes' monkeys.
J. Virol.
67:1517-1528[Abstract/Free Full Text].
|
| 21.
|
Hirsch, V. M.,
C. McGann,
G. Dapolito,
S. Goldstein,
A. Ogen-Odoi,
B. Biryawaho,
T. Lakwo, and P. R. Johnson.
1993.
Identification of a new subgroup of SIVagm in tantalus monkeys.
Virology
197:426-430[CrossRef][Medline].
|
| 22.
|
Hirsch, V. M.,
R. A. Olmsted,
M. Murphey-Corb,
R. H. Purcell, and P. R. Johnson.
1989.
An African primate lentivirus (SIVsm) closely related to HIV-2.
Nature
339:389-392[CrossRef][Medline].
|
| 23.
|
Jin, J. M.,
H. Hui,
D. L. Robertson,
M. C. Müller,
F. Barré-Sinoussi,
V. M. Hirsch,
J. F. Allan,
G. M. Shaw,
P. M. Sharp, and B. H. Hahn.
1994.
Mosaic genome structure of simian immunodeficiency viruses from West African green monkeys.
EMBO J.
13:2935-2947[Medline].
|
| 24.
|
Jones, D. T.,
W. R. Taylor, and J. M. Thomton.
1992.
The rapid generation of mutation data matrices from protein sequences.
Comput. Appl. Biosci.
8:275-282[Abstract/Free Full Text].
|
| 25.
|
Liitsola, K.,
I. Tashkinova,
T. Laukkanen,
G. Korovina,
T. Smolskaja,
O. Momot,
N. Mashkilleyson,
S. Chaplinskas,
H. Brummer-Korvenkontio,
J. Vanhatalo,
P. Leinikki, and M. O. Salminen.
1998.
HIV-1 genetic subtype A/B recombinant strain causing an explosive epidemic in injecting drug users in Kaliningrad.
AIDS
12:1907-1919[Medline].
|
| 26.
|
Mahieux, R.,
C. Chappey,
M. C. Georges-Courbot,
G. Dubreuil,
P. Mauclere,
A. Georges, and A. Gessain.
1998.
Simian T-cell lymphotropic virus type 1 from Mandrillus sphinx as a simian counterpart of human T-cell lymphotropic virus type 1 subtype D.
J. Virol.
72:10316-10322[Abstract/Free Full Text].
|
| 27.
|
Marx, P. A.,
Y. Li,
N. W. Lerche,
S. Sutjipto,
A. Gettie,
J. A. Yee,
B. H. Brotman,
A. M. Prince,
A. Hanson,
R. G. Webster, et al.
1991.
Isolation of a simian immunodeficiency virus related to human immunodeficiency virus type 2 from a West African pet sooty mangabey.
J. Virol.
65:4480-4485[Abstract/Free Full Text].
|
| 28.
|
Mauclere, P.,
I. Loussert-Ajaka,
F. Damond,
P. Fagot,
S. Souquiere,
M. Monny Lobe,
F. X. Mbopi Keou,
F. Barre-Sinoussi,
S. Saragosti,
F. Brun-Vezinet, and F. Simon.
1997.
Serological and virological characterization of HIV-1 group O infection in Cameroon.
AIDS
11:445-453[Medline].
|
| 29.
|
McCutchan, F. E.,
J. K. Carr,
M. Bajani,
E. Sanders-Buell,
T. O. Harry,
T. C. Stoeckli,
K. E. Robbins,
W. Gashau,
A. Nasidi,
W. Janssens, and M. L. Kalish.
1999.
Subtype G and multiple forms of A/G intersubtype recombinant human immunodeficiency virus type 1 in Nigeria.
Virology
254:226-234[CrossRef][Medline].
|
| 30.
|
Müller, M. C.,
N. K. Saksena,
E. Nerrienet,
C. Chappey,
V. M. Herve,
J. P. Durand,
P. Legal-Campodonico,
M. C. Lang,
J. P. Digoutte,
A. J. Georges,
P. Sonigo, and F. Barré-Sinoussi.
1993.
Simian immunodeficiency viruses from central and western Africa: evidence for a new species-specific lentivirus in tantalus monkeys.
J. Virol.
67:1227-1235[Abstract/Free Full Text].
|
| 31.
|
Nerrienet, E.,
X. Amouretti,
M. C. Müller-Trutwin,
V. Poaty-Mavoungou,
I. Bedjebaga,
H. T. Nguyen,
G. Dubreuil,
S. Corbet,
E. J. Wickings,
F. Barre-Sinoussi,
A. J. Georges, and M. C. Georges-Courbot.
1998.
Phylogenetic analysis of SIV and STLV type 1 in mandrills (Mandrillus sphinx): indications that intracolony transmissions are predominantly the result of male-to-male aggressive contacts.
AIDS Res. Hum. Retrovir.
14:785-796[Medline].
|
| 32.
|
Peeters, M.,
F. Liegeois,
N. Torimiro,
A. Bourgeois,
E. Mpoudi,
L. Vergne,
E. Saman,
E. Delaporte, and S. Saragosti.
1999.
Characterization of a highly replicative intergroup M/O human immunodeficiency virus type 1 recombinant isolated from a Cameroonian patient.
J. Virol.
73:7368-7375[Abstract/Free Full Text].
|
| 33.
|
Saitou, N., and M. Nei.
1987.
The neighbor-joining method: a new method for reconstructing phylogenetic trees.
Mol. Biol. Evol.
4:406-425[Abstract].
|
| 34.
|
Simon, F.,
S. Souquière,
F. Damond,
A. Kfutwah,
M. Makuwa,
E. Leroy,
P. Rouquet,
J. L. Berthier,
J. Rigoulet,
A. Lecu,
P. T. Telfer,
I. Pandrea,
J. C. Plantier,
P. A. Marx,
F. Barré-Sinoussi,
M. C. Müller-Trutwin, and C. Apetrei.
2001.
A synthetic peptide strategy for the detection of and discrimination between highly divergent primate lentiviruses.
AIDS Res. Hum. Retrovir.
17:937-952[CrossRef][Medline].
|
| 35.
|
Simon, F.,
P. Mauclere,
P. Roques,
I. Loussert-Ajaka,
M. C. Müller-Trutwin,
S. Saragosti,
M. C. Georges-Courbot,
F. Barré-Sinoussi, and F. Brun-Vézinet.
1998.
Identification of a new human immunodeficiency virus type 1 distinct from group M and group O.
Nat Med.
4:1032-1037[CrossRef][Medline].
|
| 36.
|
Strimmer, K., and A. von Haeseler.
1996.
Quartet puzzling: a quartet maximum likelihood method for reconstructing tree topologies.
Mol. Biol. Evol.
13:964-969.
|
| 37.
|
Thompson, J. D.,
D. G. Higgins, and T. J. Gibson.
1994.
CLUSTAL W improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.
Nucleic Acids Res.
22:4673-4680[Abstract/Free Full Text].
|
| 38.
|
Tsujimoto, H.,
A. Hasegawa,
N. Maki,
M. Fukasawa,
T. Miura,
S. Speidel,
R. W. Cooper,
E. N. Moriyama,
T. Gojobori, and M. Hayami.
1989.
Sequence of a novel simian immunodeficiency virus from a wild-caught African mandrill.
Nature
341:539-541[CrossRef][Medline].
|
| 39.
|
van Rensburg, E. J.,
S. Engelbrecht,
J. Mwenda,
J. D. Laten,
B. A. Robson,
T. Stander, and G. K. Chege.
1998.
Simian immunodeficiency viruses (SIVs) from eastern and southern Africa: detection of a SIVagm variant from a chacma baboon.
J. Gen. Virol.
79:1809-1814[Abstract].
|
Journal of Virology, August 2001, p. 7086-7096, Vol. 75, No. 15
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.15.7086-7096.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Souquiere, S., Onanga, R., Makuwa, M., Pandrea, I., Ngari, P., Rouquet, P., Bourry, O., Kazanji, M., Apetrei, C., Simon, F., Roques, P.
(2009). Simian immunodeficiency virus types 1 and 2 (SIV mnd 1 and 2) have different pathogenic potentials in rhesus macaques upon experimental cross-species transmission. J. Gen. Virol.
90: 488-499
[Abstract]
[Full Text]
-
Liegeois, F., Lafay, B., Formenty, P., Locatelli, S., Courgnaud, V., Delaporte, E., Peeters, M.
(2009). Full-Length Genome Characterization of a Novel Simian Immunodeficiency Virus Lineage (SIVolc) from Olive Colobus (Procolobus verus) and New SIVwrcPbb Strains from Western Red Colobus (Piliocolobus badius badius) from the Tai Forest in Ivory Coast. J. Virol.
83: 428-439
[Abstract]
[Full Text]
-
Pandrea, I., Onanga, R., Souquiere, S., Mouinga-Ondeme, A., Bourry, O., Makuwa, M., Rouquet, P., Silvestri, G., Simon, F., Roques, P., Apetrei, C.
(2008). Paucity of CD4+ CCR5+ T Cells May Prevent Transmission of Simian Immunodeficiency Virus in Natural Nonhuman Primate Hosts by Breast-Feeding. J. Virol.
82: 5501-5509
[Abstract]
[Full Text]
-
Brennan, G., Podell, M. D., Wack, R., Kraft, S., Troyer, J. L., Bielefeldt-Ohmann, H., VandeWoude, S.
(2006). Neurologic Disease in Captive Lions (Panthera leo) with Low-Titer Lion Lentivirus Infection. J. Clin. Microbiol.
44: 4345-4352
[Abstract]
[Full Text]
-
VandeWoude, S., Apetrei, C.
(2006). Going Wild: Lessons from Naturally Occurring T-Lymphotropic Lentiviruses. Clin. Microbiol. Rev.
19: 728-762
[Abstract]
[Full Text]
-
Chen, J., Powell, D., Hu, W.-S.
(2006). High Frequency of Genetic Recombination Is a Common Feature of Primate Lentivirus Replication. J. Virol.
80: 9651-9658
[Abstract]
[Full Text]
-
Onanga, R., Souquiere, S., Makuwa, M., Mouinga-Ondeme, A., Simon, F., Apetrei, C., Roques, P.
(2006). Primary Simian Immunodeficiency Virus SIVmnd-2 Infection in Mandrills (Mandrillus sphinx).. J. Virol.
80: 3301-3309
[Abstract]
[Full Text]
-
Beer, B. E., Brown, C. R., Whitted, S., Goldstein, S., Goeken, R., Plishka, R., Buckler-White, A., Hirsch, V. M.
(2005). Immunodeficiency in the Absence of High Viral Load in Pig-Tailed Macaques Infected with Simian Immunodeficiency Virus SIVsun or SIVlhoest. J. Virol.
79: 14044-14056
[Abstract]
[Full Text]
-
Santiago, M. L., Range, F., Keele, B. F., Li, Y., Bailes, E., Bibollet-Ruche, F., Fruteau, C., Noe, R., Peeters, M., Brookfield, J. F. Y., Shaw, G. M., Sharp, P. M., Hahn, B. H.
(2005). Simian Immunodeficiency Virus Infection in Free-Ranging Sooty Mangabeys (Cercocebus atys atys) from the Tai Forest, Cote d'Ivoire: Implications for the Origin of Epidemic Human Immunodeficiency Virus Type 2. J. Virol.
79: 12515-12527
[Abstract]
[Full Text]
-
Apetrei, C., Kaur, A., Lerche, N. W., Metzger, M., Pandrea, I., Hardcastle, J., Falkenstein, S., Bohm, R., Koehler, J., Traina-Dorge, V., Williams, T., Staprans, S., Plauche, G., Veazey, R. S., McClure, H., Lackner, A. A., Gormus, B., Robertson, D. L., Marx, P. A.
(2005). Molecular Epidemiology of Simian Immunodeficiency Virus SIVsm in U.S. Primate Centers Unravels the Origin of SIVmac and SIVstm. J. Virol.
79: 8991-9005
[Abstract]
[Full Text]
-
Troyer, J. L., Pecon-Slattery, J., Roelke, M. E., Johnson, W., VandeWoude, S., Vazquez-Salat, N., Brown, M., Frank, L., Woodroffe, R., Winterbach, C., Winterbach, H., Hemson, G., Bush, M., Alexander, K. A., Revilla, E., O'Brien, S. J.
(2005). Seroprevalence and Genomic Divergence of Circulating Strains of Feline Immunodeficiency Virus among Felidae and Hyaenidae Species. J. Virol.
79: 8282-8294
[Abstract]
[Full Text]
-
Dazza, M.-C., Ekwalanga, M., Nende, M., Shamamba, K. B., Bitshi, P., Paraskevis, D., Saragosti, S.
(2005). Characterization of a Novel vpu-Harboring Simian Immunodeficiency Virus from a Dent's Mona Monkey (Cercopithecus mona denti). J. Virol.
79: 8560-8571
[Abstract]
[Full Text]
-
Goldstein, S., Ourmanov, I., Brown, C. R., Plishka, R., Buckler-White, A., Byrum, R., Hirsch, V. M.
(2005). Plateau Levels of Viremia Correlate with the Degree of CD4+-T-Cell Loss in Simian Immunodeficiency Virus SIVagm-Infected Pigtailed Macaques: Variable Pathogenicity of Natural SIVagm Isolates. J. Virol.
79: 5153-5162
[Abstract]
[Full Text]
-
Sharp, P. M., Shaw, G. M., Hahn, B. H.
(2005). Simian Immunodeficiency Virus Infection of Chimpanzees. J. Virol.
79: 3891-3902
[Full Text]
-
Apetrei, C., Metzger, M. J., Richardson, D., Ling, B., Telfer, P. T., Reed, P., Robertson, D. L., Marx, P. A.
(2005). Detection and Partial Characterization of Simian Immunodeficiency Virus SIVsm Strains from Bush Meat Samples from Rural Sierra Leone. J. Virol.
79: 2631-2636
[Abstract]
[Full Text]
-
Apetrei, C., Gormus, B., Pandrea, I., Metzger, M., ten Haaft, P., Martin, L. N., Bohm, R., Alvarez, X., Koopman, G., Murphey-Corb, M., Veazey, R. S., Lackner, A. A., Baskin, G., Heeney, J., Marx, P. A.
(2004). Direct Inoculation of Simian Immunodeficiency Virus from Sooty Mangabeys in Black Mangabeys (Lophocebus aterrimus): First Evidence of AIDS in a Heterologous African Species and Different Pathologic Outcomes of Experimental Infection. J. Virol.
78: 11506-11518
[Abstract]
[Full Text]
-
Ling, B., Apetrei, C., Pandrea, I., Veazey, R. S., Lackner, A. A., Gormus, B., Marx, P. A.
(2004). Classic AIDS in a Sooty Mangabey after an 18-Year Natural Infection. J. Virol.
78: 8902-8908
[Abstract]
[Full Text]
-
Bibollet-Ruche, F., Bailes, E., Gao, F., Pourrut, X., Barlow, K. L., Clewley, J. P., Mwenda, J. M., Langat, D. K., Chege, G. K., McClure, H. M., Mpoudi-Ngole, E., Delaporte, E., Peeters, M., Shaw, G. M., Sharp, P. M., Hahn, B. H.
(2004). New Simian Immunodeficiency Virus Infecting De Brazza's Monkeys (Cercopithecus neglectus): Evidence for a Cercopithecus Monkey Virus Clade. J. Virol.
78: 7748-7762
[Abstract]
[Full Text]
-
Troyer, J. L., Pecon-Slattery, J., Roelke, M. E., Black, L., Packer, C., O'Brien, S. J.
(2004). Patterns of Feline Immunodeficiency Virus Multiple Infection and Genome Divergence in a Free-Ranging Population of African Lions. J. Virol.
78: 3777-3791
[Abstract]
[Full Text]
-
Verschoor, E. J., Fagrouch, Z., Bontjer, I., Niphuis, H., Heeney, J. L.
(2004). A novel simian immunodeficiency virus isolated from a Schmidt's guenon (Cercopithecus ascanius schmidti). J. Gen. Virol.
85: 21-24
[Abstract]
[Full Text]
-
Courgnaud, V., Abela, B., Pourrut, X., Mpoudi-Ngole, E., Loul, S., Delaporte, E., Peeters, M.
(2003). Identification of a New Simian Immunodeficiency Virus Lineage with a vpu Gene Present among Different Cercopithecus Monkeys (C. mona, C. cephus, and C. nictitans) from Cameroon. J. Virol.
77: 12523-12534
[Abstract]
[Full Text]
-
Barlow, K. L., Ajao, A. O., Clewley, J. P.
(2003). Characterization of a Novel Simian Immunodeficiency Virus (SIVmonNG1) Genome Sequence from a Mona Monkey (Cercopithecus mona). J. Virol.
77: 6879-6888
[Abstract]
[Full Text]
-
Hu, J., Switzer, W. M., Foley, B. T., Robertson, D. L., Goeken, R. M., Korber, B. T., Hirsch, V. M., Beer, B. E.
(2003). Characterization and Comparison of Recombinant Simian Immunodeficiency Virus from Drill (Mandrillus leucophaeus) and Mandrill (Mandrillus sphinx) Isolates. J. Virol.
77: 4867-4880
[Abstract]
[Full Text]
-
Ling, B., Santiago, M. L., Meleth, S., Gormus, B., McClure, H. M., Apetrei, C., Hahn, B. H., Marx, P. A.
(2003). Noninvasive Detection of New Simian Immunodeficiency Virus Lineages in Captive Sooty Mangabeys: Ability To Amplify Virion RNA from Fecal Samples Correlates with Viral Load in Plasma. J. Virol.
77: 2214-2226
[Abstract]
[Full Text]
-
Santiago, M. L., Bibollet-Ruche, F., Bailes, E., Kamenya, S., Muller, M. N., Lukasik, M., Pusey, A. E., Collins, D. A., Wrangham, R. W., Goodall, J., Shaw, G. M., Sharp, P. M., Hahn, B. H.
(2003). Amplification of a Complete Simian Immunodeficiency Virus Genome from Fecal RNA of a Wild Chimpanzee. J. Virol.
77: 2233-2242
[Abstract]
[Full Text]
-
Courgnaud, V., Formenty, P., Akoua-Koffi, C., Noe, R., Boesch, C., Delaporte, E., Peeters, M.
(2002). Partial Molecular Characterization of Two Simian Immunodeficiency Viruses (SIV) from African Colobids: SIVwrc from Western Red Colobus (Piliocolobus badius) and SIVolc from Olive Colobus (Procolobus verus). J. Virol.
77: 744-748
[Abstract]
[Full Text]
-
Onanga, R., Kornfeld, C., Pandrea, I., Estaquier, J., Souquiere, S., Rouquet, P., Mavoungou, V. P., Bourry, O., M'Boup, S., Barre-Sinoussi, F., Simon, F., Apetrei, C., Roques, P., Muller-Trutwin, M. C.
(2002). High Levels of Viral Replication Contrast with Only Transient Changes in CD4+ and CD8+ Cell Numbers during the Early Phase of Experimental Infection with Simian Immunodeficiency Virus SIVmnd-1 in Mandrillus sphinx. J. Virol.
76: 10256-10263
[Abstract]
[Full Text]
-
Courgnaud, V., Salemi, M., Pourrut, X., Mpoudi-Ngole, E., Abela, B., Auzel, P., Bibollet-Ruche, F., Hahn, B., Vandamme, A.-M., Delaporte, E., Peeters, M.
(2002). Characterization of a Novel Simian Immunodeficiency Virus with a vpu Gene from Greater Spot-Nosed Monkeys (Cercopithecus nictitans) Provides New Insights into Simian/Human Immunodeficiency Virus Phylogeny. J. Virol.
76: 8298-8309
[Abstract]
[Full Text]
Top
Abstract
Introduction
