This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Patterson, S.
Right arrow Articles by Gotch, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Patterson, S.
Right arrow Articles by Gotch, F.

 Previous Article  |  Next Article 

Journal of Virology, July 2001, p. 6710-6713, Vol. 75, No. 14
0022-538X/01/$04.00+0   DOI: 10.1128/JVI.75.14.6710-6713.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.

Plasmacytoid Dendritic Cells Are Highly Susceptible to Human Immunodeficiency Virus Type 1 Infection and Release Infectious Virus

Steven Patterson,1,* Aaron Rae,2 Nicola Hockey,2 Jill Gilmour,1 and Frances Gotch1

Department of Immunology, Imperial College School of Medicine, Chelsea and Westminster Hospital, London SW10 9NH,1 and Flow Cytometry Department, Imperial Cancer Research Fund, Lincolns Inn Field, London WC2 3PX,2 United Kingdom

Received 21 December 2000/Accepted 8 April 2001


    ABSTRACT
Top
Abstract
Text
References

Plasmacytoid dendritic cells (pcDC) and myeloid dendritic cells (myDC) are shown to express CD4 and low levels of CCR5 and CXCR4, but only myDC express DC SIGN, a C-type lectin that binds human immunodeficiency virus but does not mediate virus entry. Both DC types were more susceptible to infection with a macrophage than a lymphotropic strain of human immunodeficiency virus type 1, but pcDC were more readily infected than myDC.


    TEXT
Top
Abstract
Text
References

Plasmacytoid dendritic cells (pcDC) have only recently been recognized as a distinct population of blood dendritic cells (DC) (6, 8, 9). pcDC, like myeloid DC (myDC), stimulate strong T-cell-proliferative responses but differ in other aspects of their biology. Blood myDC take up residence in the peripheral tissues, where they intercept invading pathogens, and then migrate to secondary lymphoid tissue, secrete interleukin-12, and present processed antigens to T cells (1). By contrast, pcDC migrate directly from blood to lymphoid tissue, where on stimulation via CD40, they produce large amounts of alpha  interferon and thus may play an important role in innate antiviral immunity (3, 10).

The question of the susceptibility of DC to infection by human immunodeficiency virus (HIV) has been controversial (2, 7). Some previous studies may have been unwittingly performed on mixed populations of myDC and pcDC, and this could explain conflicting findings. Here, we show that each DC population expresses the receptors and coreceptors necessary for HIV infection but that pcDC are more readily infected than myDC.

CD11c+ myDC and CD11c- pcDC were purified from buffy coats as previously described (9). Purified DC contained 2% or less contaminating T cells. Purified DC (105) were cultured in 96-well plates with recombinant granulocyte-macrophage colony-stimulating factor (100 ng/ml) for myDC or interleukin-3 (10 ng/ml) for pcDC (cytokines were from R&D Systems Europe Ltd). myDC and pcDC remained positive and negative, respectively, for CD11c expression throughout a 7- to 9-day culture period, and there was no evidence of expansion of a minor cell population.

CD4, CCR5, and CXCR4 expression by DC was analyzed in uncultured peripheral blood mononuclear cells (PBMC) by four-color fluorescence-activated cell sorter (FACS) analysis. DC were identified by the absence of labeling with phycoerythrin-conjugated antibodies against CD3, CD14, CD16, and CD19 and strong labeling with PerCp-conjugated anti HLA-DR (Becton Dickinson). myDC and pcDC were differentiated by staining them with fluorescein isothiocyanate-conjugated anti-CD11c (Dako). CD4, CXCR4, and CCR5 were detected by allophycocyanin-conjugated antibodies (Becton Dickinson). RNA message for CD4, CCR5, CXCR4, DC SIGN (a C-type lectin that binds HIV but does not mediate virus entry [5]), and GAPDH (glyceraldehyde-3-phosphate dehydrogenase) was detected in purified DC by reverse transcription (RT)-PCR on DNase-treated RNA. cDNA was amplified by PCR using the following primers: CD4 forward (ATAAAGATTCTGGGAAATCAGGGCTCC) and CD4 reverse (TGCAACTTTCCTGTTTTCGCTTCAAGG) (product, 751 bp); CXCR4 forward (TGACTCCATGAAGGAACCCTG) and CXCR4 reverse (CTTGGCCTCTGACTGTTGCTG) (product, 381 bp); CCR5 forward (CCAAAAGCACATTGCCAAACG) and CCR5 reverse (ACTTGAGTCCGTGTCACAAGCC) (product, 136 bp); DC SIGN forward (ACAGAGGAGAGCCCAACAACG) and DC SIGN reverse (AAGGGGGTGAAGTTCTGCTACG) (product, 202 bp); and GAPDH forward (ATGGAGAAGGCTGGGGCTC) and GAPDH reverse (AAGTTGTCATGGATGACCTTG) (product, 196 bp). Forty cycles of PCR were performed by denaturation for 30 s at 94°C, annealing for 1 min at 55°C, and then incubation for 2 min at 72°C.

Purified myDC and pcDC (105 cells) were infected with DNase-treated lymphotropic, CXCR4-utilizing IIIB or macrophage-tropic, CCR5-utilizing Ba-L (20 provirus-forming units assayed in PM1 cells) strains of HIV type 1 (HIV-1). After 18 h, they were washed three times and cultured for 7 to 9 days. DNA was extracted, and the HIV provirus load was estimated by limiting-dilution PCR using primers based on HIV-1 Pol, a technique shown to detect a single provirus copy (11). The first-round primers were forward, 5' CATGGGTACCAGCACAAAGG 3' and reverse, 5' TCTACTTGTCCATGCATGGCTTC 3'. The second-round primers were forward, 5' GGAGGAAATGAACAAGTAGATAAATTAGTCAG 3', and reverse, 5' TCACTAGCCATTGCTCTCCAATT 3'. To test for release of infectious virus, supernatants were cocultured with PM1 cells for 5 h, and newly synthesized proviral DNA was measured by limiting-dilution nested PCR.

myDC and pcDC were identified by FACS analysis (Fig. 1a and b). CD4 was detected on both populations but was more highly expressed on pcDC (Fig. 1c and d). After 48 h of culture, surface expression of CD4 was downregulated on myDC but not on pcDC (Fig. 1e and f). Data from one of five experiments to detect chemokine expression on DC are shown, and for comparison, we also show expression on T cells. Labeling for CXCR4 was very low on myDC but higher on pcDC (Fig. 2a). There were low levels of CCR5 on myDC and slightly higher levels on pcDC. CCR5 became undetectable on the surfaces of both types of DC cultured for 48 h whereas CXCR4 expression was little changed (Fig. 2b). Surprisingly, mRNA for all three receptors was detectable in cultured as well as fresh myDC and pcDC (Fig. 3). DC-SIGN mRNA was detected in cultured and freshly isolated myDC but not in pcDC (Fig. 3).


View larger version (32K):
[in this window]
[in a new window]
  		FIG. 1.   FACS analysis of DC for expression of CD4. (a) Identification of DC in peripheral blood (R1); (b) myDC and pcDC are differentiated by expression of CD11c; (c and d) expression of CD4 on myDC (c) and pcDC (d) in freshly isolated PBMC. (e and f) CD4 expression on purified myDC (e) and pcDC (f) cultured for 2 days. On all histograms, the left-hand curve represents staining with an isotype control antibody.


View larger version (16K):
[in this window]
[in a new window]
  		FIG. 2.   Expression of CXCR4 and CCR5. (a) FACS labeling for CXCR4 and CCR5 on myDC, pcDC, and T cells in freshly isolated PBMC. (b) Expression of CXCR4 and CCR5 on purified myDC and pcDC cultured for 48 h. The left-hand curve in each histogram represents staining with the isotype control antibody.


View larger version (83K):
[in this window]
[in a new window]
  		FIG. 3.   Detection of mRNA for CD4, CXCR4, CCR5, DC SIGN, and GAPDH on cultured myDC and pcDC. Gel analysis of an RT-PCR to detect mRNAs in purified DC cultured for 48 h. Lanes 1 to 5, myDC; lanes 6 to 10, pcDC; lanes 1 and 6, CD4; lanes 2 and 7, CCR5; lanes 3 and 8, CXCR4; lanes 4 and 9, DC SIGN; lanes 5 and 10, GAPDH.

HIV proviral DNA was detected in six of seven in vitro infection experiments (Table 1). Experiment 5 shows a higher proviral load in cultures infected with macrophage-tropic Ba-L and also shows that virus grows more efficiently in pcDC than in myDC (Fig. 4). This pattern was seen in all experiments, although the differences were not always as great as those observed in experiment 5. Nevertheless, in no experiment using DC derived from the same donor was IIIB found to replicate to higher levels than Ba-L nor were provirus loads ever observed to be higher in myDC than in pcDC. Infectious virus, demonstrated by the ability of DC supernatant to form provirus in PM1 cells, was detected in six of eight DC cultures tested (experiments 2, 3, and 5), but the largest amounts of virus were found in the pcDC cultures infected with Ba-L (Table 1).

                              
View this table:
[in this window]
[in a new window]
  		TABLE 1.   Summary of seven in vitro infection experiments



View larger version (102K):
[in this window]
[in a new window]
  		FIG. 4.   Estimation of HIV-1 proviral DNA copy number on myDC and pcDC infected in vitro with lymphotropic and macrophage-tropic strains of HIV-1. Limiting-dilution nested PCR to detect HIV-1 provirus in in vitro-infected myDC (a) and pcDC (b) (experiment 5; 9-day infection [Table 1]). PCR was performed on five fivefold dilutions of the DNA template. Lanes 1 to 5 and 6 to 10 on each gel represent assays on IIIB-and Ba-L-infected cultures, respectively.

We show by FACS, analysis and RT-PCR that pcDC express CD4, CCR5, and CXCR4, the receptors required for infection by macrophage and lymphotropic strains of HIV-1. These receptors were also detected on myDC, but FACS analysis showed lower levels of expression, particularly for CD4 and CXCR4. On culture, surface expression of CXCR4 was little changed, whereas there was a loss of membrane CCR5 on both cell types and downregulation of CD4 on myDC. However, a positive signal for all three receptors on both populations was detected by RT-PCR on fresh and cultured cells. Whether these findings reflect inefficient transport to the cell surface, a high rate of membrane receptor turnover, or other possible explanations is not yet clear.

In vitro infection experiments with HIV-1 Ba-L confirmed that both cell types could be infected by HIV-1; however, the virus replicated more efficiently in pcDC. This may reflect lower CD4 expression by myDC. Alternatively, cellular entry into myDC may be blocked by attachment to DC SIGN. Lower provirus loads were detected in DC infected with the IIIB lymphotropic strain than in those infected with the Ba-L strain of HIV-1. For the myDC, this may be explained by poor expression of CXCR4; however, in pcDC, CCR5 and CXCR4 were expressed at similar levels. A further inconsistency of the data was that for both DC populations, in vitro culture resulted in downregulation of CCR5 but not of CXCR4. The findings may partly reflect a defective vpr gene, thought to facilitate infection of nondividing cells, in the IIIB strain of virus (4).

DC infected with 20 infectious units of virus had a high provirus copy number after 7 to 9 days, suggesting productive virus infection. Release of infectious virus was confirmed by culturing DC supernatants with PM1 cells and analyzing them for provirus formation. Infectious virus was released by both pcDC and myDC cultures. Low levels of contaminating T cells, 2% or less CD3+ cells, were present in purified DC preparations. Although it cannot be ruled out that some of the provirus detected is derived from T cells, this is unlikely to significantly distort the in vitro infection data for the following reasons: (i) the number of provirus copies after 9 days greatly exceeded the maximum number of T cells, (ii) significant replication in T cells would mask the differences between myDC and pcDC cultures, and (iii) autologous T cells do not support productive infection unless activated by exogenous stimuli.

The finding that pcDC are more readily infected than myDC may explain previous inconsistencies and could reflect investigators working with different populations of cells. Infection and loss of pcDC in vivo may reduce levels of alpha  interferon and result in higher virus loads and disease progression.


    ACKNOWLEDGMENTS

This work was supported by the United Kingdom Medical Research Council.

HIV-1 virus stocks and the PM-1 cell line (originally donated by M. Reitz) were provided by the MRC Centralised Facility for AIDS Reagents at NIBSC, South Mimms, Herts., United Kingdom.


    FOOTNOTES

* Corresponding author. Mailing address: Department of Immunology, Imperial College School of Medicine, Chelsea and Westminster Hospital, 369 Fulham Rd., London SW10 9NH, United Kingdom. Phone: 44 20 8746 5934. Fax: 44 20 8746 5997. E-mail: s.patterson{at}ic.ac.uk.


    REFERENCES
Top
Abstract
Text
References

1. Banchereau, J., and R. M. Steinman. 1998. Dendritic cells and the control of immunity. Nature 392:245-251[CrossRef][Medline].
2. Cameron, P. U., P. S. Freudenthal, J. M. Barker, S. Gezelter, K. Inaba, and R. M. Steinman. 1992. Dendritic cells exposed to human immunodeficiency virus type-1 transmit a vigorous cytopathic infection to CD4+ T cells. Science 257:383-387.
3. Cella, M., D. Jarrossay, F. Facchetti, O. Alebardi, H. Nakajima, A. Lanzavecchia, and M. Colonna. 1999. Plasmacytoid monocytes migrate to inflamed lymph nodes and produce large amounts of type I interferon. Nat. Med. 5:919-923[CrossRef][Medline].
4. Connor, R. I., B. K. Chen, S. Choe, and N. R. Landau. 1995. Vpr is required for efficient replication of human immunodeficiency virus type-1 in mononuclear phagocytes. Virology 206:935-944[CrossRef][Medline].
5. Geijtenbeek, T. B., D. S. Kwon, R. Torensma, S. J. van-Vliet, G. C. van-Duijnhoven, J. Middel, I. L. Cornelissen, H. S. Nottet, V. N. Kewalramani, D. R. Littman, C. G. Figdor, and Y. van-Kooyk. 2000. DC-SIGN, a dendritic cell-specific HIV-1 binding protein that enhances trans-infection of T cells. Cell 100:587-597[CrossRef][Medline].
6. Grouard, G., M. C. Rissoan, L. Filgueira, I. Durand, J. Banchereau, and Y.-J. Liu. 1997. The enigmatic plasmacytoid T cells develop into dendritic cells with interleukin (IL)-3 and CD40-ligand. J. Exp. Med. 185:1101-1111[Abstract/Free Full Text].
7. Patterson, S., and S. C. Knight. 1987. Susceptibility of human peripheral blood dendritic cells to infection by human immunodeficiency virus. J. Gen. Virol. 68:1177-1181[Abstract/Free Full Text].
8. Rissoan, M. C., V. Soumelis, N. Kadowaki, G. Grouard, F. Briere, R. de-Waal-Malefyt, and Y. J. Liu. 1999. Reciprocal control of T helper cell and dendritic cell differentiation. Science 283:1183-1186[Abstract/Free Full Text].
9. Robinson, S. P., S. Patterson, N. E. English, D. Davies, S. C. Knight, and C. D. L. Reid. 1999. Human peripheral blood contains two distinct lineages of dendritic cells. Eur. J. Immunol. 29:2769-2778[CrossRef][Medline].
10. Siegal, F. P., N. Kadowaki, M. Shodell, B. P. Fitzgerald, K. Shah, S. Ho, S. Antonenko, and Y. J. Liu. 1999. The nature of the principal type 1 interferon-producing cells in human blood. Science 284:1835-1837[Abstract/Free Full Text].
11. Simmonds, P., P. Balfe, J. F. Peutherer, C. A. Ludlam, J. O. Bishop, and A. J. Brown. 1990. Human immunodeficiency virus-infected individuals contain provirus in small numbers of peripheral mononuclear cells and at low copy numbers. J. Virol. 64:864-872[Abstract/Free Full Text].

Journal of Virology, July 2001, p. 6710-6713, Vol. 75, No. 14
0022-538X/01/$04.00+0   DOI: 10.1128/JVI.75.14.6710-6713.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.


This article has been cited by other articles:

  • Perez, L. G., Costa, M. R., Todd, C. A., Haynes, B. F., Montefiori, D. C. (2009). Utilization of Immunoglobulin G Fc Receptors by Human Immunodeficiency Virus Type 1: a Specific Role for Antibodies against the Membrane-Proximal External Region of gp41. J. Virol. 83: 7397-7410 [Abstract] [Full Text]  
  • Liu, B., Woltman, A. M., Janssen, H. L. A., Boonstra, A. (2009). Modulation of dendritic cell function by persistent viruses. J. Leukoc. Biol. 85: 205-214 [Abstract] [Full Text]  
  • Haupt, S., Donhauser, N., Chaipan, C., Schuster, P., Puffer, B., Daniels, R. S., Greenough, T. C., Kirchhoff, F., Schmidt, B. (2008). CD4 Binding Affinity Determines Human Immunodeficiency Virus Type 1-Induced Alpha Interferon Production in Plasmacytoid Dendritic Cells. J. Virol. 82: 8900-8905 [Abstract] [Full Text]  
  • Sachdeva, N., Asthana, V., Brewer, T. H., Garcia, D., Asthana, D. (2008). Impaired Restoration of Plasmacytoid Dendritic Cells in HIV-1-Infected Patients with Poor CD4 T Cell Reconstitution Is Associated with Decrease in Capacity to Produce IFN-{alpha} but Not Proinflammatory Cytokines. J. Immunol. 181: 2887-2897 [Abstract] [Full Text]  
  • Wang, Q., Pang, S. (2008). An intercellular adhesion molecule-3 (ICAM-3) -grabbing nonintegrin (DC-SIGN) efficiently blocks HIV viral budding. FASEB J. 22: 1055-1064 [Abstract] [Full Text]  
  • Wang, F.-x., Huang, J., Zhang, H., Ma, X., Zhang, H. (2008). APOBEC3G upregulation by alpha interferon restricts human immunodeficiency virus type 1 infection in human peripheral plasmacytoid dendritic cells. J. Gen. Virol. 89: 722-730 [Abstract] [Full Text]  
  • Duvall, M. G., Lore, K., Blaak, H., Ambrozak, D. A., Adams, W. C., Santos, K., Geldmacher, C., Mascola, J. R., McMichael, A. J., Jaye, A., Whittle, H. C., Rowland-Jones, S. L., Koup, R. A. (2007). Dendritic Cells Are Less Susceptible to Human Immunodeficiency Virus Type 2 (HIV-2) Infection than to HIV-1 Infection. J. Virol. 81: 13486-13498 [Abstract] [Full Text]  
  • Milush, J. M., Reeves, J. D., Gordon, S. N., Zhou, D., Muthukumar, A., Kosub, D. A., Chacko, E., Giavedoni, L. D., Ibegbu, C. C., Cole, K. S., Miamidian, J. L., Paiardini, M., Barry, A. P., Staprans, S. I., Silvestri, G., Sodora, D. L. (2007). Virally Induced CD4+ T Cell Depletion Is Not Sufficient to Induce AIDS in a Natural Host. J. Immunol. 179: 3047-3056 [Abstract] [Full Text]  
  • Gilbert, C., Cantin, R., Barat, C., Tremblay, M. J. (2007). Human Immunodeficiency Virus Type 1 Replication in Dendritic Cell-T-Cell Cocultures Is Increased upon Incorporation of Host LFA-1 due to Higher Levels of Virus Production in Immature Dendritic Cells. J. Virol. 81: 7672-7682 [Abstract] [Full Text]  
  • Wang, J.-H., Janas, A. M., Olson, W. J., KewalRamani, V. N., Wu, L. (2007). CD4 Coexpression Regulates DC-SIGN-Mediated Transmission of Human Immunodeficiency Virus Type 1. J. Virol. 81: 2497-2507 [Abstract] [Full Text]  
  • Cameron, P. U., Handley, A. J., Baylis, D. C., Solomon, A. E., Bernard, N., Purcell, D. F. J., Lewin, S. R. (2007). Preferential Infection of Dendritic Cells during Human Immunodeficiency Virus Type 1 Infection of Blood Leukocytes. J. Virol. 81: 2297-2306 [Abstract] [Full Text]  
  • Martinelli, E., Cicala, C., Van Ryk, D., Goode, D. J., Macleod, K., Arthos, J., Fauci, A. S. (2007). HIV-1 gp120 inhibits TLR9-mediated activation and IFN-{alpha} secretion in plasmacytoid dendritic cells. Proc. Natl. Acad. Sci. USA 104: 3396-3401 [Abstract] [Full Text]  
  • Teleshova, N., Kenney, J., Van Nest, G., Marshall, J., Lifson, J. D., Sivin, I., Dufour, J., Bohm, R., Gettie, A., Robbiani, M. (2006). Local and Systemic Effects of Intranodally Injected CpG-C Immunostimulatory-Oligodeoxyribonucleotides in Macaques. J. Immunol. 177: 8531-8541 [Abstract] [Full Text]  
  • Hosmalin, A., Lebon, P. (2006). Type I interferon production in HIV-infected patients. J. Leukoc. Biol. 80: 984-993 [Abstract] [Full Text]  
  • Donaghy, H., Wilkinson, J., Cunningham, A. L. (2006). HIV interactions with dendritic cells: has our focus been too narrow?. J. Leukoc. Biol. 80: 1001-1012 [Abstract] [Full Text]  
  • Groot, F., van Capel, T. M. M., Kapsenberg, M. L., Berkhout, B., de Jong, E. C. (2006). Opposing roles of blood myeloid and plasmacytoid dendritic cells in HIV-1 infection of T cells: transmission facilitation versus replication inhibition. Blood 108: 1957-1964 [Abstract] [Full Text]  
  • Holl, V., Peressin, M., Schmidt, S., Decoville, T., Zolla-Pazner, S., Aubertin, A.-M., Moog, C. (2006). Efficient inhibition of HIV-1 replication in human immature monocyte-derived dendritic cells by purified anti-HIV-1 IgG without induction of maturation. Blood 107: 4466-4474 [Abstract] [Full Text]  
  • Zhang, Z., Fu, J., Zhao, Q., He, Y., Jin, L., Zhang, H., Yao, J., Zhang, L., Wang, F.-S. (2006). Differential Restoration of Myeloid and Plasmacytoid Dendritic Cells in HIV-1-Infected Children after Treatment with Highly Active Antiretroviral Therapy. J. Immunol. 176: 5644-5651 [Abstract] [Full Text]  
  • Teleshova, N., Kenney, J., Williams, V., Van Nest, G., Marshall, J., Lifson, J. D., Sivin, I., Dufour, J., Bohm, R., Gettie, A., Pope, M. (2006). CpG-C ISS-ODN activation of blood-derived B cells from healthy and chronic immunodeficiency virus-infected macaques. J. Leukoc. Biol. 79: 257-267 [Abstract] [Full Text]  
  • Granelli-Piperno, A., Shimeliovich, I., Pack, M., Trumpfheller, C., Steinman, R. M. (2006). HIV-1 Selectively Infects a Subset of Nonmaturing BDCA1-Positive Dendritic Cells in Human Blood. J. Immunol. 176: 991-998 [Abstract] [Full Text]  
  • Smed-Sorensen, A., Lore, K., Vasudevan, J., Louder, M. K., Andersson, J., Mascola, J. R., Spetz, A.-L., Koup, R. A. (2005). Differential Susceptibility to Human Immunodeficiency Virus Type 1 Infection of Myeloid and Plasmacytoid Dendritic Cells. J. Virol. 79: 8861-8869 [Abstract] [Full Text]  
  • Lore, K., Smed-Sorensen, A., Vasudevan, J., Mascola, J. R., Koup, R. A. (2005). Myeloid and plasmacytoid dendritic cells transfer HIV-1 preferentially to antigen-specific CD4+ T cells. JEM 201: 2023-2033 [Abstract] [Full Text]  
  • Zabel, B. A., Silverio, A. M., Butcher, E. C. (2005). Chemokine-Like Receptor 1 Expression and Chemerin-Directed Chemotaxis Distinguish Plasmacytoid from Myeloid Dendritic Cells in Human Blood. J. Immunol. 174: 244-251 [Abstract] [Full Text]  
  • Teleshova, N., Kenney, J., Jones, J., Marshall, J., Van Nest, G., Dufour, J., Bohm, R., Lifson, J. D., Gettie, A., Pope, M. (2004). CpG-C Immunostimulatory Oligodeoxyribonucleotide Activation of Plasmacytoid Dendritic Cells in Rhesus Macaques to Augment the Activation of IFN-{gamma}-Secreting Simian Immunodeficiency Virus-Specific T Cells. J. Immunol. 173: 1647-1657 [Abstract] [Full Text]  
  • Fonteneau, J.-F., Larsson, M., Beignon, A.-S., McKenna, K., Dasilva, I., Amara, A., Liu, Y.-J., Lifson, J. D., Littman, D. R., Bhardwaj, N. (2004). Human Immunodeficiency Virus Type 1 Activates Plasmacytoid Dendritic Cells and Concomitantly Induces the Bystander Maturation of Myeloid Dendritic Cells. J. Virol. 78: 5223-5232 [Abstract] [Full Text]  
  • Engering, A., van Vliet, S. J., Hebeda, K., Jackson, D. G., Prevo, R., Singh, S. K., Geijtenbeek, T. B. H., van Krieken, H., van Kooyk, Y. (2004). Dynamic Populations of Dendritic Cell-Specific ICAM-3 Grabbing Nonintegrin-Positive Immature Dendritic Cells and Liver/Lymph Node-Specific ICAM-3 Grabbing Nonintegrin-Positive Endothelial Cells in the Outer Zones of the Paracortex of Human Lymph Nodes. Am. J. Pathol. 164: 1587-1595 [Abstract] [Full Text]  
  • Stebbing, J., Gazzard, B., Douek, D. C. (2004). Where Does HIV Live?. NEJM 350: 1872-1880 [Full Text]  
  • Anthony, D. D., Yonkers, N. L., Post, A. B., Asaad, R., Heinzel, F. P., Lederman, M. M., Lehmann, P. V., Valdez, H. (2004). Selective Impairments in Dendritic Cell-Associated Function Distinguish Hepatitis C Virus and HIV Infection. J. Immunol. 172: 4907-4916 [Abstract] [Full Text]  
  • Soilleux, E J, Coleman, N (2004). Expression of DC-SIGN in human foreskin may facilitate sexual transmission of HIV. J. Clin. Pathol. 57: 77-78 [Abstract] [Full Text]  
  • Pereira, L., Maidji, E., McDonagh, S., Genbacev, O., Fisher, S. (2003). Human Cytomegalovirus Transmission from the Uterus to the Placenta Correlates with the Presence of Pathogenic Bacteria and Maternal Immunity. J. Virol. 77: 13301-13314 [Abstract] [Full Text]  
  • Teleshova, N., Frank, I., Pope, M. (2003). Immunodeficiency virus exploitation of dendritic cells in the early steps of infection. J. Leukoc. Biol. 74: 683-690 [Abstract] [Full Text]  
  • Stebbing, J., Gazzard, B., Portsmouth, S., Gotch, F., Kim, L., Bower, M., Mandalia, S., Binder, R., Srivastava, P., Patterson, S. (2003). Disease-associated dendritic cells respond to disease-specific antigens through the common heat shock protein receptor. Blood 102: 1806-1814 [Abstract] [Full Text]  
  • Donaghy, H., Gazzard, B., Gotch, F., Patterson, S. (2003). Dysfunction and infection of freshly isolated blood myeloid and plasmacytoid dendritic cells in patients infected with HIV-1. Blood 101: 4505-4511 [Abstract] [Full Text]  
  • Yonezawa, A., Morita, R., Takaori-Kondo, A., Kadowaki, N., Kitawaki, T., Hori, T., Uchiyama, T. (2003). Natural Alpha Interferon-Producing Cells Respond to Human Immunodeficiency Virus Type 1 with Alpha Interferon Production and Maturation into Dendritic Cells. J. Virol. 77: 3777-3784 [Abstract] [Full Text]  
  • Trumpfheller, C., Park, C. G., Finke, J., Steinman, R. M., Granelli-Piperno, A. (2003). Cell type-dependent retention and transmission of HIV-1 by DC-SIGN. Int Immunol 15: 289-298 [Abstract] [Full Text]  
  • Krug, A., Uppaluri, R., Facchetti, F., Dorner, B. G., Sheehan, K. C. F., Schreiber, R. D., Cella, M., Colonna, M. (2002). Cutting Edge: IFN-Producing Cells Respond to CXCR3 Ligands in the Presence of CXCL12 and Secrete Inflammatory Chemokines upon Activation. J. Immunol. 169: 6079-6083 [Abstract] [Full Text]  
  • O'Keeffe, M., Hochrein, H., Vremec, D., Caminschi, I., Miller, J. L., Anders, E. M., Wu, L., Lahoud, M. H., Henri, S., Scott, B., Hertzog, P., Tatarczuch, L., Shortman, K. (2002). Mouse Plasmacytoid Cells: Long-lived Cells, Heterogeneous in Surface Phenotype and Function, that Differentiate Into CD8+ Dendritic Cells Only after Microbial Stimulus. JEM 196: 1307-1319 [Abstract] [Full Text]  
  • Yu Kimata, M. T., Cella, M., Biggins, J. E., Rorex, C., White, R., Hicks, S., Wilson, J. M., Patel, P. G., Allan, J. S., Colonna, M., Kimata, J. T. (2002). Capture and Transfer of Simian Immunodeficiency Virus by Macaque Dendritic Cells Is Enhanced by DC-SIGN. J. Virol. 76: 11827-11836 [Abstract] [Full Text]  
  • Gummuluru, S., KewalRamani, V. N., Emerman, M. (2002). Dendritic Cell-Mediated Viral Transfer to T Cells Is Required for Human Immunodeficiency Virus Type 1 Persistence in the Face of Rapid Cell Turnover. J. Virol. 76: 10692-10701 [Abstract] [Full Text]  
  • Fong, L., Mengozzi, M., Abbey, N. W., Herndier, B. G., Engleman, E. G. (2002). Productive Infection of Plasmacytoid Dendritic Cells with Human Immunodeficiency Virus Type 1 Is Triggered by CD40 Ligation. J. Virol. 76: 11033-11041 [Abstract] [Full Text]  
  • Engering, A., van Vliet, S. J., Geijtenbeek, T. B. H., van Kooyk, Y. (2002). Subset of DC-SIGN+ dendritic cells in human blood transmits HIV-1 to T lymphocytes. Blood 100: 1780-1786 [Abstract] [Full Text]  
  • Clapham, P. R., McKnight, A. (2002). Cell surface receptors, virus entry and tropism of primate lentiviruses. J. Gen. Virol. 83: 1809-1829 [Abstract] [Full Text]  
  • Sanders, R. W., de Jong, E. C., Baldwin, C. E., Schuitemaker, J. H. N., Kapsenberg, M. L., Berkhout, B. (2002). Differential Transmission of Human Immunodeficiency Virus Type 1 by Distinct Subsets of Effector Dendritic Cells. J. Virol. 76: 7812-7821 [Abstract] [Full Text]  
  • Chehimi, J., Campbell, D. E., Azzoni, L., Bacheller, D., Papasavvas, E., Jerandi, G., Mounzer, K., Kostman, J., Trinchieri, G., Montaner, L. J. (2002). Persistent Decreases in Blood Plasmacytoid Dendritic Cell Number and Function Despite Effective Highly Active Antiretroviral Therapy and Increased Blood Myeloid Dendritic Cells in HIV-Infected Individuals. J. Immunol. 168: 4796-4801 [Abstract] [Full Text]  
  • Jameson, B., Baribaud, F., Pohlmann, S., Ghavimi, D., Mortari, F., Doms, R. W., Iwasaki, A. (2002). Expression of DC-SIGN by Dendritic Cells of Intestinal and Genital Mucosae in Humans and Rhesus Macaques. J. Virol. 76: 1866-1875 [Abstract] [Full Text]  
  • Wu, L., Bashirova, A. A., Martin, T. D., Villamide, L., Mehlhop, E., Chertov, A. O., Unutmaz, D., Pope, M., Carrington, M., KewalRamani, V. N. (2002). Rhesus macaque dendritic cells efficiently transmit primate lentiviruses independently of DC-SIGN. Proc. Natl. Acad. Sci. USA 99: 1568-1573 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Patterson, S.
Right arrow Articles by Gotch, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Patterson, S.
Right arrow Articles by Gotch, F.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»