Previous Article | Next Article 
Journal of Virology, July 2001, p. 6384-6391, Vol. 75, No. 14
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.14.6384-6391.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Target Cell Populations of Human Immunodeficiency Virus Type
1 in Peripheral Blood Lymphocytes with Different Chemokine
Receptors at Various Stages of Disease Progression
Prasert
Auewarakul,1,*
Kantima
Sangsiriwut,2
Surapol
Suwanagool,2 and
Chantapong
Wasi1
Department of
Microbiology1 and Department of
Preventive and Social Medicine,2 Faculty of
Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand
Received 15 August 2000/Accepted 13 April 2001
 |
ABSTRACT |
We studied the distribution of human immunodeficiency virus type 1 (HIV-1) DNA in CCR5-positive and -negative peripheral blood lymphocyte
populations in HIV-1-infected individuals. While HIV-1 DNA in the
CCR5-positive population showed no correlation with CD4 count, the
increase of total HIV-1 DNA with lower CD4 count was mainly contributed
by the increase of HIV-1 DNA in the CCR5-negative population. This
might indicate the change in coreceptor usage from CCR5 to CXCR4 in
later stages of disease progression. However, some of the samples with
a high viral DNA load in the CCR5-negative population did not have any
characteristic of the V3 loop sequence that is compatible with CXCR4
usage or the syncytium-inducing (SI) phenotype. We also did not find
any known characteristic change predictive of the SI phenotype in V1
and V2 sequences. Our findings showed that there might be a shift in
target cell populations during disease progression, and this shift was
not necessarily associated with the genetic changes characteristic of
CXCR4 usage.
 |
INTRODUCTION |
Human immunodeficiency virus type 1 (HIV-1) isolates from asymptomatic individuals at earlier stages of
infection are usually found to be macrophage-tropic and nonsyncytium
inducing (NSI) and to use only CCR5 as a coreceptor (R5 isolates). In
contrast, viral isolates from AIDS patients can be T-cell line-tropic
and syncytium inducing (SI) and to use either both CCR5 and CXCR4 (R5X4
isolates) or only CXCR4 (X4 isolates) (10, 11, 15, 17).
The major genetic determinant of cell tropism and chemokine receptor
usage lies in the V3 loop; minor determinants were also described in V1
and V2 (3, 7, 8, 18). The appearance of SI viruses is
associated with a more rapid CD4 count decline and disease progression
(10, 11). The chemokine receptors CCR5 and CXCR4 are
differentially expressed on different subsets of CD4+ T
cells. CCR5 is expressed on activated T cells and a subset of memory T
cells (2). CXCR4 is expressed mainly on naive cells, which
are the cells that have not yet encountered antigen and therefore are
resting cells (14). Resting cells were shown to be
refractive to HIV-1 infection, and naive cells have been shown to be
less susceptible to productive HIV infection even after activation of
the cells (5, 16). We have shown earlier that CXCR4-expressing cells become more activated in later stages of disease
progression and therefore might be more susceptible to HIV infection
(1). These data imply that there should be a shift in the
target cell population from CCR5+ cells to
CXCR4+ cells with the viral phenotypic switching and the
disease progression. The distribution of HIV infection in T-cell
subsets with different chemokine receptors in vivo, however, has not
been studied. Whether this distribution is influenced by the viral
chemokine receptor usage and disease progression has not been shown. A
recent study showed that naive cells were also infected with CCR5-using
viruses (13). This raised a question as to whether our
current understanding of the viral chemokine receptor usage and the
chemokine receptor expression in T-cell subsets is accurate in an in
vivo situation.
We analyzed cross-sectionally the viral DNA content in CCR5-positive
and -negative peripheral lymphocyte populations to study the viral DNA
distribution and to examine the influence of CD4 count and the viral
chemokine receptor usage as determined by V3 signature sequences and on
the viral DNA distribution.
 |
MATERIALS AND METHODS |
Blood specimens and cell separation.
Blood samples were
collected from 30 HIV-1-infected patients at the HIV Clinic of Siriraj
Hospital. Patients were arbitrarily selected to include both
asymptomatic and symptomatic infections. All patients were not treated
with any antiretroviral drug at the time of specimen collection. Ten
milliliters of venous blood was collected from each subject and
processed for cell separation within 3 h. CD4 count was performed
on whole blood specimens. Peripheral blood mononuclear cells (PBMC)
were separated from the blood specimens by centrifugation on Ficoll
cushion. The cells were washed and resuspended in RPMI 1640 medium with
10% fetal calf serum (FCS), and monocytes were depleted by plastic
adherence overnight. The nonadherent cells were further separated into
CCR5-positive and -negative populations by using MACS (Miltenyi
Biotech) immunomagnetic beads and a CCR5 monoclonal antibody (2D7). The
separation was done according to the manufacturer's instructions in
two repetitive cycles in order to get maximum purity. The unseparated
and separated cell populations were analyzed by using a flow cytometer
using CD4, CD14, and CCR5 monoclonal antibodies to determine CD4
percentage and assess the purity of each separated population.
To verify the purity of our separated cell preparation, we analyzed the
mRNA expression in each cell fraction by reverse transcription-PCR (RT-PCR). The RNA extracted by using TRIzol reagent (Gibco-BRL) was
heated at 68°C for 5 min, chilled on ice, and subjected to the RT
reaction in a 50-µl volume containing 5 µg of random hexamer, 1×
PCR buffer (10 mM Tris-Cl, 50 mM KCl, 0.1% Triton X-100), 1.5 mM
MgCl2, 200 µM concentrations of deoxynucleoside
triphosphates (dNTPs), 10 U of RNase inhibitor, and 9 U of avian
myeloblastosis virus-reverse transcriptase at 45°C for 1 h.
Then, 15 µl Fifteen microliter of the RT reaction was amplified in a
PCR reaction as previously described, using primers CCR5c
(CAAAAAGAAGGTCTTCATTACACC) and CCR5d
(CCTGTGCCTCTTCTTCTCATTTCG) (9). The PCR
reaction mixture contained 1× PCR buffer, 1.5 mM MgCl2,
200 µM concentrations of the dNTPs, 20 pmol of each primer, and 2.5 U
of Taq. The amplification consisted of 40 cycles, with 5 initial cycles of 94°C for 1 min, 55°C for 1 min, and 72°C for
1.5 min, followed by 35 cycles of 94°C for 30 s, 60°C for
30 s, and 72°C for 45 s. The PCR products were visualized
after electrophoresis in 2% agarose gel and ethidium bromide staining.
Quantitative PCR.
A gag competitive quantitative
nested PCR was done using a competitor with an internal 18-bp deletion.
The competitor was made in two steps. First, a shorter competitor of 97 bp with an 18-bp deletion was made in a PCR reaction using the primers
SK38, SK39, and SK38-delta, which carried the deletion, as described previously (12). This competitor can be used in one-step
competitive PCR. In order to increase the sensitivity, we designed
another competitor that can be used in nested PCR by extending the
competitor in overlapping extension reactions using the shorter
competitor and SK380 and SK390 (19) as primers.
To quantitate HIV DNA, unsorted and sorted cells were lysed and DNA was
purified using QIA-Amp Blood Kit (Qiagen). DNA equivalent
of 1.5 × 10
5 cells was amplified by nested PCR, together with a
serial dilution
of the competitor. SK380 and SK390 were used in the
first-round
PCR, and SK38 and SK39 were used in the second-round PCR.
The
PCR was done in a total volume of 50 µl containing 1× PCR
buffer,
1.5 mM MgCl
2, 200 µM concentrations of the dNTPs,
20 pmol of each
primer, and 2.5 U of
Taq. The amplification
cycles were 95°C for
1 min, 60°C for 1 min, and 72°C for 1 min,
with 35 cycles for
the first round and 95°C for 1 min, 55°C for 1 min, and 72°C for
1 min and 35 cycles for the second round. The PCR
products were
visualized after electrophoresis in 10% polyacrylamide
and ethidium
bromide staining. The PCR product bands were photographed
with
a digital camera, and the area under the curve for each band was
calculated using Gel-Pro software. The area of competitor bands
was
adjusted for its lower molecular weight. The ratios between
wild-type
and competitor PCR products were plotted against the
copy numbers of
competitor, and the copy number of wild-type DNA
was extrapolated from
the curve where the ratio = 1. The HIV DNA
content in each cell
fraction was then calculated, with adjustment
for contaminated cells
seen in flow cytometric analysis, by solving
these two equations: (i)
X +
Y = the measured HIV DNA load
in
the CCR5
+ fraction and (ii)
X +
Y = the measured HIV DNA load in the
CCR5

fraction, where
X is the adjusted HIV DNA
load in the CD4
+ CCR5
+ fraction,
Y
is the adjusted HIV DNA load in the CD4
+ CCR5

fraction,

is the number of CD4
+ CCR5
+ cells
in the CCR5
+ fraction,

is the number of
CD4
+ CCR5

cells in the CCR5
+
fraction,

is the number of CD4
+ CCR5
+ cells
in the CCR5

fraction, and

is the number of
CD4
+ CCR5

cells in the CCR5
fraction.
To quantitate HIV RNA, unsorted and sorted cells were lysed and RNA was
extracted using TRIzol reagent (Gibco-BRL). An RNA
equivalent of
1.5 × 10
5 cells was amplified by a competitive
RT-PCR. The above-mentioned
DNA competitor was cloned into pGEM-T Easy
(Promega), and RNA
competitor was made by an in vitro transcription
reaction by using
T-7 RNA polymerase. The RT reaction contained 1×
Tth RT-PCR buffer
(Boehringer Mannheim), 2.5 mM
MnCl
2, 200 µM concentrations of
dNTPs, 20 pmol of SK390
primer, 2.5 U of
Tth DNA polymerase (Boehringer
Mannheim),
and a serial dilution of RNA competitor. The reaction
was incubated at
60°C for 20 min and chilled on ice, and then
20 pmol of SK380 primer
was added together with MgCl
2 and 10×
chelating buffer
(Boehringer Mannheim) to obtain final concentrations
of 2 mM and 1×,
respectively. The reaction was then heated at
94°C for 5 min and to
60°C for 20 min. The cDNA product was then
further amplified by the
same nested PCR as that used for DNA
quantitation.
Sequence analysis.
C2-V3 fragments were amplified from
unsorted cells by a nested PCR using AI1 (ACTATGGGGTTCCTGTGTG)
and AI2 (CCTCCTCCAGGTCTGAA) as outer primers and CI1
(GGCAGTCTAGCAGAAGAAAAGATAATAATCAGA) and BI2
(ATCTCCTCCTGATGGTGGCTGAA) as inner primers. V1-V5 fragments were amplified for V1V2 sequencing in some samples using envB (AGAAAGAGAAGAAGACAGTGGAAATGA) and AO2 (AGGTGAGTATCCCTG)
as outer primers and AI1 and AI2 as inner primers. The V1V2 and
V3 regions of the PCR products were then sequenced directly by using V1
(CAGATGCAGGAGGATGTAATCAGT) and CI1
(GGCAGTCTAGCAGAAGAAAAGATAATAATCAGA), respectively, as sequencing primers. The sequencing reactions were dideoxy-termination cycle sequencing using a BigDye Terminator kit (PE/Applied Biosystems) according to the manufacturer's protocol and an ABI Prism 310 automated sequencer. Selected samples were cloned into pGEM-T Easy
(Promega) after PCR amplification, and then 10 clones from each sample
were sequenced.
 |
RESULTS |
Distribution of HIV-1 DNA in CCR5-positive and -negative lymphocyte
subsets.
To verify the accuracy of the quantitative PCR, we
measured the HIV DNA content in 8E5 cells, which harbor one copy of
HIV-1 proviral DNA per cell. When 10,000 cells representing 10,000 copies of HIV DNA were analyzed, the result of our quantitative PCR
measurement was 9,950 copies (Fig. 1).

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 1.
Verification of the quantitative HIV-DNA PCR. (A) A
total of 104 copies of HIV DNA in 8E5 cells were
coamplified with 300, 1,500, 3,000, 6,000, or 30,000 copies of the
competitor as shown in lanes 2 to 6, respectively. Lane 1 is the marker
containing both wild-type (115 bp) and competitor (97 bp) amplicons,
and lane 7 is blank. (B) Ratios of adjusted density of the competitor
and wild-type bands plotted against the copy number of the
competitor.
|
|
Lymphocyte subsets were separated from 30 individuals who presented at
various disease stages, as shown by their CD4 count
range of 4 to 728 cells/mm
3. The percentages of CCR5-positive cells in our
purified cell
preparations were 96.2% ± 1.7% (mean ± The
standard deviation)
and 12.8% ± 3.1% for CCR5-positive and
CCR5-negative fractions,
respectively. Minimal CD14
+
monocytes were found in the presorted nonadherent cells (1.4%
± 1%).
To ensure that the contaminated monocytes did not contain
significant
amount of HIV DNA that could interfere with our result,
we measured HIV
DNA in 15 adherent cell samples and found that
9 of 15 cases were
negative and the other 6 cases had fewer than
25 copies of HIV DNA in
10
4 adherent cells. Because there was a possibility that
CCR5 molecules
on the cell surface might have been lost during the cell
separation
process, we analyzed CCR5 mRNA expression of the cell
preparations
by RT-PCR in six sample sets. A set of representative
results
is shown in Fig.
2. RNA from
200,000 cells of a CCR5-negative
cell preparation was negative for CCR5
RNA, while RNA from a CCR5-positive
fraction was positive for CCR5 RNA.
When compared to the standard
curve using highly purified CCR5-positive
and -negative cells
by fluorescence-activated cell sorting (FACS), the
intensity of
the bands correlated with the number of CCR5-positive
cells in
the fractions. These data confirmed that we had correctly
separated
CCR5-positive and -negative cells.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 2.
Representative CCR5 RNA analysis by RT-PCR showing the
purity of the cell preparations. The size of the amplification products
is 189 bp. Lanes 1 and 2 show amplification from 200,000 cells of a
CCR5-negative cell preparation and 60,000 cells of a CCR5-positive
preparation, respectively. CCR5-positive (98% purity) and -negative
(96% purity) cells highly purified by FACS were mixed to make cell
preparations with various percentages of CCR5-positive cells in lanes 4 to 8. RNA from 100,000 cells was analyzed in each of these control
lanes. The numbers below the lane are intensities of the bands
calculated using Gel-Pro software.
|
|
The HIV DNA load ranged from 85 to 6,734, 24 to 5,089, and 201 to 3,921 copies/10
5 CD4
+ cells in unsorted nonadherent
cells, CCR5-negative lymphocytes,
and CCR5-positive lymphocytes,
respectively. The variances of
DNA load in unsorted and CCR5-negative
cells were significantly
higher than that of the CCR5-positive cells
(
F = 3.81 and 3.12,
respectively;
P < 0.01). The total HIV DNA load in unsorted cells
and in the
CCR5-negative population, but not the DNA load in the
CCR5-positive
population, showed a reverse correlation with the
CD4 count (Fig.
3). The ratio of viral DNA between
CCR5-positive
and -negative cells ranged from 0.09 to 46.25 and
correlated with
the CD4 count (Pearson's correlation coefficient of
0.79,
P <
0.01) (Fig.
4). At higher CD4 counts (>400
cells/mm
3), CCR5-positive cells had a mean of
33-fold-higher HIV-1 DNA
level than CCR5-negative cells. The ratio
decreased sharply when
the CD4 counts were <300 cells/mm
3.
The ratio was mostly still higher than 1 (3.3 ± 2.6) when the
CD4
counts were moderately low (50 to 300 cells/mm
3). At
extremely low CD4 counts (<50 cells/mm
3), the ratio was
mostly <1 (0.09 to 1.51), and the CCR5-negative
cells had a mean of
1.7-fold-higher HIV DNA level than the CCR5-positive
cells.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 3.
Scatter plots showing the correlation between CD4 count
and total HIV DNA load (in log scale) in presorted non adherent cells
(A), HIV DNA load in a CCR5-negative population (B), and HIV DNA load
in a CCR5-positive population (C). Nonadherent cells were separated
into CCR5-positive and -negative populations by immunomagnetic
separation, and the HIV DNA content was measured by a gag
quantitative competitive PCR.
|
|

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 4.
Scatter plot showing correlation between CD4 count and
the ratio of the HIV DNA in a CCR5-positive to the HIV DNA in a
CCR5-negative population in log scale (A) and in linear scale (B). The
HIV DNA content was measured by a gag competitive PCR in the
two subpopulations, which were separated by the immunomagnetic
technique.
|
|
Because HIV DNA in the cells could be either active replicating or
silent proviral DNA, the number of total HIV DNA in cells
did not
necessarily reflect the level of viral replication. To
test whether
there was any difference in the proportion of active
replicating
proviral DNA in CCR5-positive and -negative cells,
we analyzed HIV RNA
in separated cell fractions from six blood
samples. Although the HIV
RNA/HIV DNA ratio varied among blood
samples, we found no difference in
the ratio between CCR5-positive
and -negative cells (Table
1).
Sequences that are predictive of chemokine receptor usage.
The
decrease in the HIV DNA ratio in CCR5+ compared to
CCR5
cells in individuals with a low CD4 count suggested
that there was an expansion of the target cell population to
CCR5-negative cells that express CXCR4 or other chemokine receptors
during disease progression. This expansion of the target cell
population might be driven by the viral phenotypic switching from the
NSI R5 phenotype to the SI R5X4 or X4 phenotype. Earlier data showed
that only Ca. 50% of HIV isolates from AIDS patients had the SI
phenotype (17). In contrast, our data showed that there
was a shift in the target cell population in all of the samples with a
low CD4 count. This means that either all of our samples with a low CD4 count had SI viruses or there were other factors that induced the
shift. To examine whether there was viral phenotypic switching along
with the change in the HIV DNA ratio in the two cell populations, we
studied the V3 loop sequences of the viruses in these samples. Amino
acid sequences at certain positions in the V3 loop, as well as its net
charge, are major determinants of the SI or NSI phenotype and the
chemokine receptor usage and can predict the viral phenotype in the
majority of HIV isolates (7, 18). V3 fragments were successfully amplified from 28 of 30 samples. The amino acid sequence of V3, the net charge, the CD4 count, and the HIV DNA ratio of each
sample are shown in Fig. 5. All of the
sequences clustered with subtype E in a phylogenetic analysis (data not
shown). The characteristics that predict the SI phenotype for subtype E
viruses include the GPGR or GPGH motif instead of the GPGQ motif at the tip of the loop, a positively charged amino acid at positions 11 and
25, the loss of an N-linked glycosylation site with substitution by
positively charged amino acid, and a high net positive charge (20). Only one sample (K4) had two of these
characteristics, i.e., GPGR and a positively charged amino acid
(arginine) at position 11. Another three samples had the GPGR motif
(K10, K12, and K13), and one had GPGH (K22). Another amino acid
position that had been reported to be predictive of the SI phenotype
for subtype E is position 13 (20). Five more sequences
(K2, K15, K21, K25, and K27) had positively charged amino acids at this
position. These 10 samples, which had a GPGR/H tip or a positively
charged amino acid at position 11, 13, or 25 had relatively high net
positively charges of 4 to 6 and had low to moderately low CD4 counts
(15 to 273 cells/mm3) and HIV DNA in the CCR5+
cell/CCR5
cell ratio (0.27 to 4.32). Loss of the
conserved N-linked glycosylation site was found in six sequences, of
which three had other SI markers. However, these changes were not
caused by substitutions with positively charged amino acid since that
was shown to be a predictor of the SI phenotype. For the 18 sequences
that have the GPGQ tip and did not have positively charged amino acid
at position 11, 13, or 25, all had a net charge <5, 4 samples had a
high HIV DNA in the CCR5+/CCR5
cell ratio
(19.69 to 46.25); another 10 samples had a ratio of 1 to 6, and 4 samples had ratio of <1. Therefore, among 24 samples with a low ratio
(<6), only 10 samples had V3 sequences that are compatible with CXCR4
usage. Although V1V2 is considered to be only a minor determinant, it
is possible that the sample with a low ratio and NSI V3 loop might have
an SI genetic determinant in V1V2. To test this hypothesis, we studied
the V1V2 sequences of 12 samples (3 with high HIV DNA levels in the
CCR5+/CCR5
cell ratio, 3 with a low ratio and
SI V3, and 6 with a low ratio and NSI V3). As shown in Fig.
6, there was no significant difference in
the characteristics that were reported to be associated with the SI or
NSI phenotype, such as length of the hypervariable locus in the V2
loops and N-linked glycosylation sites, except for one sequence (K25)
that had longer sequence at the length-variable locus in V2. This
sample also had a SI-predictive V3 sequence.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 5.
V3 loop amino acid sequence alignment. The N-linked
glycosylation site and amino acid positions 11 and 25 are marked by
asterisks, and the tip of the V3 loop is underlined. The net charge,
the CD4 count, and the ratio of HIV DNA in a CCR5-positive population
to the HIV DNA in a CCR5-negative population are provided for each
sequence. A reference subtype E sequence of TH253 is shown on the
top.
|
|

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 6.
V1V2 loop amino acid sequence alignment. The length of
the hypervariable locus in V2 loop, the CD4 count, and the ratio of HIV
DNA in CCR5-positive versus HIV DNA in CCR5-negative populations are
provided for each sequence. A reference subtype E sequence of TH253 is
shown on the top.
|
|
Because we have performed direct sequencing without prior cloning,
there was a possibility that we might have overlooked minor
variants in
the quasispecies. We therefore sought to determine
whether the
samples that had a high viral DNA load in CCR5-negative
cells and
showed V3 NSI sequences contained any SI variants. To
examine this, we
selected the samples with HIV DNA in a
CCR5
+/CCR5

cell ratio of

1 and V3 NSI
sequences for cloning and sequencing
(K18, K19, K20, K23, and K29). For
each sample, 10 clones were
sequenced in the V3 region. Of these
five samples, two showed
NSI V3 sequences in all 10 clones (K18 and
K29), another two showed
three SI sequences (K19 and K20), and one
showed seven SI sequences
(K23). Therefore, even after cloning we could
not find SI sequences
in some of the samples with a high viral DNA load
in CCR5-negative
cells.
 |
DISCUSSION |
The CD4 count is a reliable marker for immune status and stages of
disease progression in HIV-1 infection. Our results showed that the HIV
DNA level in CCR5-positive lymphocytes did not correlate with disease
progression. This suggested that the efficiency of CCR5 usage remained
unchanged regardless of the viral phenotype or disease stages. This was
in agreement of earlier data showing that most primary SI viruses are
dual tropic in chemokine receptor usage and can still use CCR5
efficiently (15). Because the HIV-1 DNA in a CCR5-negative
population increased markedly during disease progression, it is
reasonable to conclude that the progression of infection might be
driven mainly by the expansion of cell tropism and increased
availability of target cells rather than by weakening of
immune defense that allows more efficient spreading in the same target
cell population. Our data showed that the major expansion in the target
cell population occurred at a CD4 count of ca. 300 cells/mm3. This point might mark an important step in
disease progression and the crashing of the immune system.
The HIV DNA pool in PBMC is known to contain significant portion of
replication-incompetent, archival DNA. However, we showed that the HIV
RNA/HIV DNA ratios in CCR5-positive and -negative cells were not
different. This suggested that a similar proportion of viral DNA in the
two cell populations was actively replicating. The observed shift of
HIV DNA level in these cell populations was, therefore, likely to
reflect the shift of The target cells for new infection and not the
result of the differential accumulation of archival DNA between the two
cell populations. The RNA data also argued against the possibility that
HIV-induced cell killing might be different between CCR5-positive and
-negative cells leading to the difference in HIV DNA level.
The decrease of the ratio between HIV-1 DNA in CCR5-positive and
-negative lymphocytes might be due to both viral and host factors. A
change in the viral chemokine receptor usage could result in the
expansion of the target cell population to CCR5-negative cells. On the
other hand, abnormal cellular activation might enhance the
susceptibility of CCR5-negative cells in advanced HIV disease.
The presence of HIV DNA with NSI sequences in CCR5-negative cells was
intriguing. This might suggest that our current phenotype prediction by
V1V2 and V3 sequences is not accurate. Alternatively, the lymphocytes
that appeared to be CCR5 negative by immunostaining might, in fact,
express low level of CCR5. Moreover, the infection of the apparently
CCR5-negatives cells might be due to the ability of some HIV strains to
utilize low concentrations of CCR5 efficiently, as has been shown for
an in vitro-selected variant of JRCSF (6). Another
possibility is that the infected CCR5-negative cells might be CCR5
positive before infection but become CCR5-negative because of CCR5
downmodulation by HIV infection, as has been previously shown
(4). This, however, did not explain the relative increase in HIV DNA in the CCR5-negative cells with the decline of CD4 count,
unless the CCR5 downmodulation ability was strain dependent and
increased with the disease progression.
Because only some of the viruses in late HIV disease are SI, whereas
all of the subjects in our study showed low HIV DNA levels in
CCR+/CCR5
cell ratios, this ratio may be
useful as a prognostic marker for disease progression. The validity of
this marker requires further studies in long-term cohorts.
 |
ACKNOWLEDGMENTS |
This work was supported by a research grant from the Fogarty
International Center AIDS International Training and Research Program (AITRP).
We thank Max Essex for helpful comments and discussion. Reagent 2D7
anti-CCR5 monoclonal antibody (LeukoSite, Inc.) was obtained through
the AIDS Research and Reference Reagent Program, Division of AIDS,
NIAID, NIH.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology, Faculty of Medicine Siriraj Hospital, Bangkok 10700, Thailand. Phone: 662-4197068-9. Fax: 662-4184148. E-mail:
sipaw{at}mahidol.ac.th.
 |
REFERENCES |
| 1.
|
Auewarakul, P.,
K. Sangsiriwut,
K. Pattanapanyasat,
S. Suwanagool, and C. Wasi.
1999.
Increase in activated CD4+ lymphocytes with CCR5 and CXCR4 in HIV type 1-infected persons.
AIDS Res. Hum. Retrovir.
15:1403-1404[CrossRef][Medline].
|
| 2.
|
Bleul, C. C.,
L. Wu,
J. A. Hoxie,
T. A. Springer, and C. R. Mackay.
1997.
The HIV coreceptors CXCR4 and CCR5 are differentially expressed and regulated on human T lymphocytes.
Proc. Natl. Acad. Sci. USA
94:1925-1930[Abstract/Free Full Text].
|
| 3.
|
Carrillo, A., and L. Ratner.
1996.
Cooperative effects of the human immunodeficiency virus type 1 envelope variable loops V1 and V3 in mediating infectivity for T cells.
J. Virol.
70:1310-1316[Abstract].
|
| 4.
|
Chenine, A. L.,
Q. Sattentau, and M. Moulard.
2000.
Selective HIV-1-induced downmodulation of CD4 and coreceptors.
Arch. Virol.
145:455-471[CrossRef][Medline].
|
| 5.
|
Chou, C.-S.,
O. Ramilo, and E. S. Vitetta.
1997.
Highly purified CD25 resting T cells cannot be infected de novo with HIV-1.
Proc. Natl. Acad. Sci. USA
94:1361-1365[Abstract/Free Full Text].
|
| 6.
|
Dejucq, N.,
G. Simmons, and P. R. Clapham.
1999.
Expanded tropism of primary human immunodeficiency virus type 1 R5 strains to CD4+ T-cell lines determined by the capacity to exploit low concentrations of CCR5.
J. Virol.
73:7842-7847[Abstract/Free Full Text].
|
| 7.
|
Fouchier, R. A. M.,
M. Groenink,
N. A. Kootstra,
M. Tersmette,
H. G. Huisman,
F. Miedema, and H. Schuitemaker.
1992.
Phenotype-associated sequence variation in the third variable domain of the human immunodeficiency virus type 1 gp120 molecule.
J. Virol.
66:3183-3187[Abstract/Free Full Text].
|
| 8.
|
Groenink, M.,
R. A. M. Fouchier,
S. Broersen,
C. H. Baker,
M. Koot,
A. B. van't Wout,
H. G. Huisman,
F. Miedema,
M. Tersmette, and H. Schuitemaker.
1993.
Relation of phenotype evolution of HIV-1 to envelope V2 configuration.
Science
260:1513-1516[Abstract/Free Full Text].
|
| 9.
|
Huang, Y.,
W. A. Paxton,
S. M. Wolinsky,
A. U. Neumann,
L. Zhang,
T. He,
S. Kang,
D. Ceradini,
Z. Jin,
K. Yazdanbakhsh,
K. Kunstman,
D. Eirckson,
E. Dragon,
N. R. Landau,
J. Phair,
D. D. Ho, and R. A. Koup.
1996.
The role of a mutant CCR5 allele in HIV-1 transmission and disease progression.
Nat. Med.
2:1240-1243[CrossRef][Medline].
|
| 10.
|
Koot, M.,
I. P. M. Keet,
A. H. V. Vos,
R. E. Y. de Goede,
M. T. L. Roos,
R. A. Coutinho,
F. Miedema,
P. T. A. Schellekens, and M. Tersmette.
1993.
Prognostic value of human immunodeficiency virus type 1 biological phenotype for rate of CD4+ cell depletion and progression to AIDS.
Ann. Intern. Med.
118:681-688[Abstract/Free Full Text].
|
| 11.
|
Koot, M.,
R. Van Leeuwen,
R. E. Y. de Goede,
I. P. Keet,
S. Danner,
J. K. Eeftinck Schattenkerk,
P. Reiss,
M. Tersmette,
J. M. Lange, and H. Schuitemaker.
1999.
Conversion rate towards a syncytium inducing (SI) phenotype during different stages of HIV infection and prognostic value of SI phenotype for survival after AIDS diagnosis.
J. Infect. Dis.
179:254-258[CrossRef][Medline].
|
| 12.
|
Menzo, S.,
P. Bagnarelli,
M. Giacca,
A. Manzin,
P. E. Varaldo, and M. Clementi.
1992.
Quantitation of viremia in human immunodeficiency virus infection by competitive reverse transcription and polymerase chain reaction.
J. Clin. Microbiol.
30:1752-1757[Abstract/Free Full Text].
|
| 13.
|
Ostrowski, M. A.,
T.-W. Chun,
S. J. Justement,
I. Motola,
M. A. Spinelli,
J. Adelsberger,
L. A. Ehler,
S. B. Mizell,
C. W. Hallahan, and A. S. Fauci.
1999.
Both memory and CD45RA+/CD62L+ naive CD4+ T cells are infected in human immunodeficiency virus type 1-infected individuals.
J. Virol.
73:6430-6435[Abstract/Free Full Text].
|
| 14.
|
Sanders, M.,
M. Makgoba, and D. Dhse.
1998.
Human naïve and memory T cells.
Immunol. Today
9:195-199.
|
| 15.
|
Simmon, G.,
D. Wilkinson,
J. D. Reeves,
M. T. Dittmar,
S. Beddows,
J. Weber,
G. Carnegie,
U. Desselberger,
P. W. Gray,
R. A. Weiss, and P. R. Clapham.
1996.
Primary, syncytium-inducing human immunodeficiency virus type 1 isolates are dual-tropic and most can use either Lestr or CCR5 as coreceptors for viral entry.
J. Virol.
70:8355-8360[Abstract].
|
| 16.
|
Tang, S.,
B. Patterson, and J. A. Levy.
1995.
Highly purified quiescent human peripheral blood CD4+ T cells are infectable by human immunodeficiency virus but do not release virus after activation.
J. Virol.
69:5659-5665[Abstract].
|
| 17.
|
Termette, M.,
R. E. Y. De Goede,
B. J. M. Al,
I. N. Winkel,
R. A. Gruters,
H. T. Cuypers,
H. G. Huisman, and F. Miedema.
1988.
Differential syncytium-inducing capacity of human immunodeficiency virus isolates: frequent detection of syncytium-inducing isolates in patients with acquired immunodeficiency syndrome (AIDS) and AIDS related complex.
J. Virol.
62:2026-2032[Abstract/Free Full Text].
|
| 18.
|
Xiao, L.,
S. M. Owen,
I. Goldman,
A. A. Lai,
J. J. deJong,
J. Goudsmit, and R. B. Lai.
1998.
CCR5 coreceptor usage of non-syncytium-inducing primary HIV-1 is independent of phylogenetically distinct global HIV-1 isolates: delineation of consensus motif in the V3 domain that predicts CCR-5 usage.
Virology
240:83-92[CrossRef][Medline].
|
| 19.
|
Yourno, J., and J. A. Conroy.
1992.
Novel polymerase chain reaction method for detection of human immunodeficiency virus in dried blood spots on filter paper.
J. Clin. Microbiol.
30:2887-2892[Abstract/Free Full Text].
|
| 20.
|
Yu, X. F.,
Z. Wang,
C. Beyrer,
D. D. Celentano,
C. Khamboonruang,
E. Allen, and K. Nelson.
1995.
Phenotypic and genotypic characteristics of human immunodeficiency virus type 1 from patients with AIDS in northern Thailand.
J. Virol.
69:4649-4655[Abstract].
|
Journal of Virology, July 2001, p. 6384-6391, Vol. 75, No. 14
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.14.6384-6391.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Hanna, Z., Priceputu, E., Chrobak, P., Hu, C., Dugas, V., Goupil, M., Marquis, M., de Repentigny, L., Jolicoeur, P.
(2009). Selective Expression of Human Immunodeficiency Virus Nef in Specific Immune Cell Populations of Transgenic Mice Is Associated with Distinct AIDS-Like Phenotypes. J. Virol.
83: 9743-9758
[Abstract]
[Full Text]
-
Karlsson, I., Antonsson, L., Shi, Y., Oberg, M., Karlsson, A., Albert, J., Olde, B., Owman, C., Jansson, M., Fenyo, E. M.
(2004). Coevolution of RANTES Sensitivity and Mode of CCR5 Receptor Use by Human Immunodeficiency Virus Type 1 of the R5 Phenotype. J. Virol.
78: 11807-11815
[Abstract]
[Full Text]