INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Zucchini yellow mosaic potyvirus (ZYMV) is a member of the Potyviridae family, the largest group of plant-infecting viruses (31). As in all potyviruses, the ZYMV genome consists of a single messenger-polarity RNA molecule of about 10 kb, encapsidated by ~2,000 subunits of coat protein (CP), forming a helical, flexuous filament particle about 750 nm long and 11 nm wide (8, 19).

Though there are no high-resolution X-ray diffraction data available on the structure of potyvirus CP, there is a considerable amount of information about its topology. Structure predictions, together with immunological studies (7, 29) of potyvirus CPs, have demonstrated structural features similar to those of the CP of tobacco mosaic virus (21) and potato virus X (26). Like those proteins, potyviral CP is a three-domain protein with variable N- and C-terminal regions exposed on the virion surface and a conserved core domain that probably interacts with viral RNA (1, 29). ZYMV CP (279 amino acids [aa]) is composed of a 214-aa core domain flanked by 43- to 45- and 20-aa N- and C-terminal domains, respectively, as predicted by Shukla et al. (30). The putative trypsin protease motif of potyvirus CP, representing the end of the surface-exposed N-terminal domain (NT), is presumed to be positioned between amino acids Lys and Asp, located in the KDKD motif (29).

Different domains have been associated with distinct functions of CP during the viral life cycle. It has been shown that the conserved core but not the N or C terminus is required for virus assembly (10, 16, 35), plasmodesmatal gating (25), and cell-to-cell movement (10). The NT has been shown to assist aphid transmission via its DAG motif (5, 13) through interaction with the virus-encoded helper component-proteinase (HC-Pro) (22, 23). A number of studies have shown that the NT of the CP (CP-NT) is involved in viral long-distance movement and systemic spread. Tobacco etch virus (TEV) mutants with deletions in the CP N- or C-terminal domains have produced virions in vivo, but the virus was defective in long-distance movement in planta (9, 10). Also, mutational analysis demonstrated that changes of Ser₄₇ to Pro of the pea seed-borne mosaic virus CP (2) and Asp₅ to Lys in the DAG motif of the tobacco vein mottling virus CP-NT (20) can modulate the ability of the virus to move systemically in Chenopodium quinoa and tobacco plants, respectively. Additionally, substitution of potato virus A Ser₇ for Gly within its CP-NT reduced virus accumulation 10-fold but did not affect the rate of systemic movement (3). Nevertheless, viral accumulation and long-distance movement of plum pox virus were not affected by insertions of 15- and 30-aa nonviral sequences between CP Ala₁₂ and Leu₁₃, suggesting that this region does not have a role in viral systemic spread (12).

In the present study we have investigated whether an intact ZYMV CP-NT is essential for virus systemic infection or whether it can be replaced by a nonviral sequence. To this end, we created chimeric viruses replacing the NT part of the CP with a foreign peptide. Our results indicate for the first time that ZYMV systemic infection can be maintained when a foreign peptide replaces the CP N-terminal region.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Construction of virus mutants. Constructs containing various CP fusions were created by PCR, with an attenuated zucchini yellow mosaic potyvirus, AGII, as a template (4, 15). Sense primers contained a PstI site at their 5' end, followed by the indicated sequence tag and a homologous CP sequence, with or without deletion. The CP homologous antisense primer included an MluI site. The amplified fragments were double digested by PstI and MluI and cloned into the partial clone pKSSacI-PstI-poly comprising about a quarter of the AGII sequence from its 3' end at positions 7515 to 9591 (4). pKSSacI-PstI-poly clones were double digested by SacI and MluI, and the resulting fragments containing tags were cloned into the AGII genome to create AGII-tagged mutants. The tags used were as follows: His tag, 5'-TCACACCATCACCATCACCAT-3'; Myc tag, 5'-TCAGCATCAGAGCAGAAGC TCAT T TCAGAGGAGGATC TCGGATCC-3' (11); foot-and-mouth disease virus (FMDV) epitope tag, 5'- AGTGTGAGAGGAGATC T TCAAGTGC T TGCACGAAAAGCAGCAAGACCAC T T-3' (33). CP-NT deletions without a sequence tag fusion (AGII8, 13, and 33) were constructed by the same strategy, but with sense primers flanked by a PstI site at their 5' end followed by a homologous CP-deleted sequence. The AGII-Myc-FMDV13 construct was generated by the same strategy, but with a sense primer flanked by a BamHI site at its 5' end followed by an FMDV sequence tag and a homologous CP-deleted (13) sequence. The amplified PCR fragments were double digested by BamHI and MluI and cloned into a partial clone (pKSSacI-PstI-poly) that already contained a Myc-tagged CP digested by BamHI (underlined) located in the 3' end of the Myc tag and MluI.

Plant growth, inoculation, and symptom evaluation. Squash (Cucurbita pepo L. cv. Ma'ayan), cucumber (Cucumis sativus L. cv. Shimshon), and melon (Cucumis melo L. cv. Arava) plants were grown in a growth chamber under continuous light at 23°C. Seedlings were selected for experimental use when their cotyledons were fully expanded. Particle bombardment inoculation was performed with a hand-held device, the handgun (14). Mild virus symptoms are observable only in squash, as the AGII virus does not elicit symptoms on other cucurbits (15); therefore, squash was chosen to test the systemic infectivity of various viral constructs. After bombardment or mechanical inoculation of cotyledons, squash seedlings were grown and examined daily for symptom development, and the first appearance of symptoms on noninoculated leaves was recorded.

RT-PCR analysis of recombinant virus progeny. Reverse transcription (RT)-PCR of viral progeny was conducted in a one-tube single-step method modified from that of Sellner et al. (28). A 50-µl volume was used containing the CP-NT flanking primers 5'-AGCTCCATACATAGCTGAGACA-3' and 5'-TGGTTGAACCAAGAGGCGAA-3' in the following mixture: 1.5 mM MgCl₂, 125 µM deoxynucleoside triphosphates, 1× Sellner buffer (28), 0.03% Triton X-100, 8% phosphate-buffered saline-Tween (8 mg of NaCl per ml, 0.2 mg of KH₂PO₄ per ml, 1.15 mg of Na₂HPO₄ per ml, 0.2 mg of KCl per ml, Tween 20 [0.05%]), 100 ng of each specific primer, 2 U of Taq polymerase, 5 U of avian myeloblastosis virus reverse transcriptase (Chimerex), and 2 to 5 µg of total RNA. RT-PCR cycles were as follows: 46°C for 30 min; 94°C for 2 min, followed by 33 cycles at 94°C, 60°C, and 72°C, each for 30 s; and one final cycle of 5 min at 72°C. Resulting amplified fragments were directly sequenced with a homologous nested primer, 5'-CATTTCCTTTCACGCGTGGC-3'.

Total protein extraction of systemically infected squash leaves. Three independent squash seedlings were inoculated by particle bombardment with each of the various cDNA constructs. Samples (70 mg; six leaf disks, comprising two of each plant) from symptom-expressing leaves were collected in microcentrifuge tubes 14 or 21 days postinoculation (dpi). The sample was ground in 150 µl of USB buffer (75 mM Tris-HCl [pH 6.8], 9 M urea, 4.5% [vol/vol] sodium dodecyl sulfate [SDS], 7.5% [vol/vol]-mercaptoethanol), boiled for 5 min, and cooled on ice. Cooled homogenates were centrifuged for 10 min at 10,000 × g, and 100 µl of the supernatant containing total leaf proteins was collected and mixed with 100 µl of 2× protein sample buffer. A 10- to 15-µl sample of the mixture was subjected to SDS-polyacrylamide gel electrophoresis (PAGE) and immunoblotting.

DAS-ELISAs. Infected plant material (100 mg, nine leaf disks, comprising three from each plant) was ground in enzyme-linked immunosorbent assay (ELISA) sample buffer (15) and centrifuged for 10 min at 10,000 × g. Supernatant (100-µl samples) was loaded on ELISA plates coated with antiserum against ZYMV-CP (1:2,000). Double-sandwich (DAS)-ELISA was performed according to the method of Gal-On (15), with either anti-CP alkaline phosphatase conjugate (1:2,000), anti-FMDV polyclonal antibody (1:2,000) followed by anti-rabbit alkaline phosphatase conjugate (1:4,000), or anti-Myc (1:2,500) monoclonal antibody followed by anti-mouse alkaline phosphatase conjugate (1:4,000).

Affinity purification of His-tagged AGII virions with Ni²⁺-charged resin and electron microscopy observation. Squash seedlings were inoculated with AGII, AGII-His, and AGII-His8 cDNAs. Leaf samples (2 g) were taken 11 d.p.i. and homogenized by mortar and pestle with 6 ml of chilled 0.1 M borate, pH 8.0, and 20 mM imidazole (designated HB). The homogenate was filtered through one layer of Miracloth (Calbiochem-Behring, La Jolla, Calif.), and the resulting filtrate was centrifuged at 2,000 × g for 10 min at 4°C. The supernatant (designated Total) was collected and mixed with 600 µl of a 50% slurry of Ni²⁺- charged resin (Cytosignal) that had been equilibrated with HB. The mixture was stirred for 3 h at 4°C and loaded on an empty column (Bio-Rad Laboratories, Richmond, Calif.). Gravity flowthrough (designated Ft) was collected. The column was then washed with 20 column volumes of HB and 10 column volumes of wash buffer (0.1 M borate, pH 8.0, and 50 mM imidazole) to eliminate nonspecifically Ni²⁺-bound proteins. Bound virions were eluted by additions of one-half column volume of elution buffer (0.1 M borate, pH 8.0, and 300 mM imidazole). Samples from total and fourth-eluted fractions were mounted on carbon-coated Formvar grids, which were negatively stained with 2% uranyl acetate for 2 min. Micrographs were obtained with a JEOL JEM-100CXII electron microscope.

Partial purification and immunogold labeling of virus. Infected leaf material was collected 21 d.p.i. and ground with borate buffer (0.5 M borate [pH. 8.0], 1 mM EDTA), chloroform, and CCl₄ at a ratio of 2:0.5:0.5 (wt/vol). The extract was centrifuged at 10,000 × g for 15 min at 4°C. The supernatant was collected and filtered through three layers of Miracloth (Calbiochem-Behring), and the resulting filtrate was loaded on a 20% sucrose cushion in borate buffer. Partially purified virions were pelleted by ultracentrifugation at 140,000 × g for 2.5 h at 4°C. The pellet was dissolved by shaking overnight with 1/10 diluted borate buffer at 4°C. Ten-microliter samples of partially purified AGII, AGII-Myc, AGII-Myc 13, and AGII-Myc 23 were adsorbed onto Formvar grids for 2 min. After a 10-min washing step with TBG buffer (20 mM Tris-HCl, pH 8.2; 225 mM NaCl; 1% calf skin gelatin [Sigma Chemical Co., St. Louis, Mo.]; 0.1% bovine serum albumin), the samples were incubated with an anti-Myc monoclonal antibody (Sigma) for 15 min. After six washing steps with TBG buffer, the samples were incubated for a further 15 min with 10-nm gold-labeled anti-mouse immunoglobulin G (Pelco). The grids were finally washed six times with TBG buffer and three times with filtered double-distilled water before staining with 2% uranyl acetate for 2 min. Micrographs were obtained with a JEOL JEM-100CXII electron microscope.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Fusion of His and Myc peptides to the CP-NT permits AGII accumulation and systemic infection. The ability of AGII, an attenuated zucchini yellow mosaic virus (15), to serve as an epitope presentation system was studied. A 21-nucleotide sequence encoding a seven-residue peptide, comprising six histidines with a serine residue at its N' end, added to enable processing by the NIa protease (24), was cloned into the AGII genome (Fig. 1A). This created a translational fusion of the cloned sequence with either a full-length CP, AGII-His (Fig. 1A) or a truncated CP lacking eight amino acid residues from its NT, AGII-His8 (Fig. 1A). A cDNA containing AGII with a similar CP truncation but without an added peptide tag, AGII8, was constructed as a control for viral infectivity and systemic infection (data not shown).

View larger version (33K): [in this window] [in a new window]   FIG. 1.   Characterization of AGII-His and AGII-His8 in systemically infected squash leaves. (A) Schematic presentation of AGII-His and AGII-His8 CP-NT regions. The insertion site of the His peptide (TAG) in the genomic map of AGII virus and the amino acid sequences at this site are shown. Partial open reading frames (ORFs) of NIb and CP are graphically indicated by a rectangle separated by a solid vertical line. A dotted vertical line separates the His tag (His), CP-NT, and CP core (CORE) ORFs from each other. Residues encoding the NIa protease motif are shown in italics. The amino acid residues recognized by AB6 monoclonal antibody are underlined. (B) Immunoblot analysis of AGII-His and AGII-His8. Total extracts (15 µl) of systemically infected squash leaves were analyzed on SDS-12.5% PAGE, blotted, and probed with indicated antibody. Extracts from virus-free plants (Virus-free) were used as a negative control. All samples, including virus-free samples, were collected from developmentally equivalent leaves at 21 d.p.i. Relative loading of protein in each lane is shown by Ponceau staining. The positions of molecular-mass standards (in kDa) are indicated on the left. (C) DAS-ELISA analysis with anti-CP of samples shown in panel B. Each result is the average of three independent samples taken from three different plants. O.D. 405, optical density at 405 nm.

View larger version (59K): [in this window] [in a new window]   FIG. 2.   The His tag is exposed on the surfaces of AGII-His and AGII-His8 virions. (A) One-step affinity purification of His-tagged virions on Ni2+-charged resin. Extracts from squash leaves systemically infected with AGII, AGII-His, and AGII-His8 were mixed with Ni2+-charged resin and subjected to Ni2+ affinity chromatography. Equal volumes of pre-Ni2+ mixing fraction (Total), column effluent fraction (Ft), final 75 mM imidazole wash fraction (Wash), and the first to fifth 300 mM imidazole eluted fractions (E1 to E5, respectively) were analyzed by immunoblotting with indicated antibodies. The positions of molecular-mass standards (in kDa) are indicated on the left. (B) Transmission electron micrographs of AGII, AGII-His, and AGII-His8 virions from either the Total or E4 fractions shown in panel A. N.D., not detected. Bar (top right micrograph), 430 nm.

View larger version (22K): [in this window] [in a new window]   FIG. 3.   Characterization of AGII-Myc in systemically infected squash leaves. (A) Schematic presentation of AGII-Myc CP-NT region. Partial ORFs of NIb and CP are graphically indicated by a rectangle separated by a solid vertical line. A dotted vertical line separates the Myc tag (Myc), CP-NT, and CP core (CORE) domains from each other. Residues encoding the NIa protease motif and Myc are shown in italics and bold, respectively. (B) Immunoblot analysis of AGII-Myc. Total extracts (15 µl) of systemically infected squash leaves were analyzed on SDS-12.5% PAGE, blotted, and probed with indicated antibodies. Extracts from virus-free squash plants (Virus-free) were used as a negative control. All samples, including virus-free samples, were collected from developmentally equivalent leaves at 21 d.p.i. Relative loading of protein in each lane is shown by Ponceau staining. The positions of molecular-mass standards (in kDa) are indicated on the left. (C) DAS-ELISA analysis with anti-CP of samples shown in panel B. Each result is the average of three independent samples taken from three different plants. O.D. 405, optical density at 405 nm.

A Myc peptide fused to a truncated CP-NT permits viral systemic infection. To ascertain the necessity of the CP-NT domain for systemic infection of AGII, we performed a systematic deletion analysis of CP-NT and tested the infectivity of mutant cDNAs. Initially, AGII cDNAs containing a truncated CP-NT, lacking either 13 (AGII13) or 33 (AGII33) aa residues from its N-terminal domain, were constructed. Both cDNAs were found to be infectious, as was AGII8 cDNA (Table 1). To further study whether the addition of a fused foreign peptide could maintain systemic infection of CP-NT-truncated AGII, we generated serial deletions of CP-NT every five aa from position Ala₈ up to position Ala₄₈ (Fig. 4A). The last deletion (AGII-Myc48) completely removed the 43-aa CP-NT and part of the core (32). These deletions were then introduced into the AGII-Myc genome to create a Myc translational fusion with truncated CPs (as described in Materials and Methods) (Fig. 4A). Mutated AGII cDNAs were tested for their ability to support systemic infection in planta. Squash seedlings were inoculated by particle bombardment with various constructs, and symptom appearance on noninoculated leaves, indicative of systemic spread, was recorded. As shown in Table 1, symptoms appeared 7 to 9 d.p.i., as in the parental AGII on plants inoculated with clones containing a deletion of up to 33 aa residues from the NT. Infectivity efficiency and symptom expression were also unchanged. However, deletion of five more residues (AGII-Myc38) delayed symptom appearance by 6 days, and deletion of an additional five (AGII-Myc43) (Table 1) delayed it by 9 days. Leaves systemically infected by these two impeded viruses exhibited milder symptoms than those infected by AGII and other mutant constructs, including His-tagged AGII. In addition, AGII-Myc43 exhibited an infectivity efficiency about three times lower than those of other infectious mutants (Table 1). It is noteworthy that a deletion of up to 43 aa from CP-NT did not affect viral assembly, and the virus particles observed were indistinguishable from AGII particles under the electron microscope (Fig. 5 shows data for AGII-Myc13 and AGII-Myc23). No viral particles or symptoms were apparent in leaves after inoculation with AGII-Myc48.

View larger version (44K): [in this window] [in a new window]   FIG. 4.   Characterization of Myc-tagged AGII deletion mutants in systemically infected squash leaves. (A) Schematic presentation of the CP-NT region of Myc-tagged AGII deletion mutants. Partial open reading frames (ORFs) of NIb and CP are graphically indicated by a rectangle separated by a solid vertical line. A dotted vertical line separates the Myc tag (Myc), CP-NT, and CP core (CORE) domains from each other. Residues encoding the NIa protease motif and Myc are shown in italics and bold, respectively. (B) Immunoblot analysis of Myc-tagged AGII deletion mutants. Total extracts (10 µl) of systemically infected squash leaves were analyzed on SDS-12.5% PAGE, blotted, and probed with indicated antibodies. All samples were collected from developmentally equivalent leaves at 21 d.p.i. Relative loading of protein in each lane is shown by Ponceau staining. The positions of molecular-mass standards (in kDa) are indicated on the left. Relative amounts of Myc-CP fusion protein were determined by a densitometric scan of the anti-Myc signal and are shown at the bottom. (C) Immunoblot analysis of AGII, AGII-Myc33, and ZYMV-Myc33. Total extracts (15 µl) of systemically infected squash leaves were analyzed on SDS-12.5% PAGE, blotted, and probed with indicated antibodies. All samples were collected from developmentally equivalent leaves at 21 d.p.i. The positions of molecular-mass standards (in kDa) are indicated on the left.

The Myc peptide fused to the CP-NT is presented on the viral surface. To establish that the Myc tag was exposed on the viral surface, quantitative DAS-ELISA of samples with anti-Myc antibody was performed, with samples taken from the same leaves as were used for Western analysis. An anti-Myc ELISA signal was detected with all mutant virus samples and not with the AGII sample, suggesting that the Myc epitope was indeed exposed on the chimeric viral surface (Fig. 5A, anti-Myc). Nevertheless, stronger signals were apparent with AGII-Myc38 and 43, although their CP accumulation did not seem to be greater according to Western blot analysis (Fig. 5A, anti-Myc versus Fig. 4B, relative Myc-CP). This might indicate that the Myc peptide displayed on a short NT is more accessible to anti-Myc antibody than that in other mutants containing longer NTs. Additionally, a lower anti-CP ELISA signal was measured for all mutants when compared to that elicited by AGII. This probably results from the deletion of anti-CP epitopes and their masking by the fused Myc peptide (Fig. 5A, anti-CP).

View larger version (57K): [in this window] [in a new window]   FIG. 5.   The Myc tag is exposed on the surfaces of chimeric virions. (A) Comparative detection of CP and Myc epitopes on AGII and Myc-tagged deletion mutant viruses. The level of each virion was determined by DAS-ELISA with the indicated antibody and is the average of three independent samples taken from three different plants 21 d.p.i. (B) Immunogold labeling of AGII, AGII-Myc, AGII-Myc13, and AGII-Myc23. Partially purified AGII, AGII-Myc, AGII-Myc13, and AGII-Myc23 virions were incubated with anti-Myc monoclonal antibody. The micrographs are each a composite from several fields of view. Bar (top right micrograph), 150 nm. O.D. 405, optical density at 405 nm.

The systemic infectivity of AGII with FMDV peptide fused to its CP-NT can be restored by fusion of a Myc tag. To assess the ability of other foreign sequences to allow systemic infectivity of AGII containing CP with truncated NT, the 16-aa FMDV CP immunogenic epitope (33) was fused to AGII13 (AGII-FMDV13) (Fig. 6A). As a positive control, the FMDV was fused to AGII CP to create AGII-FMDV (Fig. 6A). Neither cDNA clone was infectious, suggesting that FMDV disrupts viral infectivity. The possibility of restoring viral infectivity by fusion of Myc upstream of the FMDV was tested. The sequence encoding the FMDV peptide was inserted into the AGII-Myc13 to create a translational fusion with Myc on its NT. This created a 31-aa foreign peptide fused to CP13 NT which was designated AGII-Myc-FMDV13 (Fig. 6A). The new clone was infectious on various cucurbits, and typical symptoms appeared 4 days later than those elicited by AGII (Table 1). The chimeric virus was genetically stable in plants and kept Myc and FMDV sequences intact for at least 30 days or three subsequent passages in squash plants, as determined by RT-PCR of viral progeny and direct sequencing of the amplified product. Immunoblotting of squash leaf extracts with either anti-Myc monoclonal antibody or anti-FMDV and anti-CP polyclonal antibodies detected a protein band with a similar mobility, suggesting that both tags were fused to the same coat protein (Fig. 6B, lane AGII-Myc-FMDV13). In contrast, anti-FMDV antibody did not detect any band in extracts from AGII or AGII-Myc13 (Fig. 6B). DAS-ELISA of the above extracts using anti-Myc or anti-FMDV antibodies detected both tags (Fig. 6C). These results suggest that both Myc and FMDV epitopes are exposed on the surfaces of AGII-Myc-FMDV13 virions.

View larger version (26K): [in this window] [in a new window]   FIG. 6.   Characterization of FMDV-tagged AGII mutants in systemically infected squash leaves. (A) Amino acid sequences of FMDV-tagged AGII mutants at the NIb/CP insertion point. Residues encoding FMDV and Myc tags are shown in bold and underlined, respectively. Residues encoding NIa protease motif are shown in italics. (B) Immunoblot analysis of AGII, AGII-Myc13, and AGII-Myc-FMDV13. Total extracts of systemically infected squash leaves were analyzed on SDS-12.5% PAGE, blotted, and probed with indicated antibodies. All samples were collected from developmentally equivalent leaves at 21 d.p.i. The positions of molecular-mass standards (in kDa) are indicated on the left. (C) DAS-ELISA analysis of AGII-Myc13 and AGII-Myc-FMDV13 samples shown in panel B. Analysis was performed with either anti-Myc or anti-FMDV antibody in two different ELISA plates. Each result is the average of three independent samples taken from three different plants. O.D. 405, optical density at 405 nm.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

The CP-NT is exposed on the virion surface (29) and is highly variable in length and sequence among different potyviruses (31) and their strains (7). It has been shown, by deletion analysis, that the CP-NT of TEV potyvirus is involved in long-distance movement (9). Furthermore, studies have shown that single changes of the CP-NT affect potyviral accumulation and systemic movement (2, 3, 20). Nevertheless, to date, the exact function of the variable CP-NT in viral systemic movement remains unclear. In the present study, we demonstrated for the first time that the entire CP-NT sequence of ZYMV-AGII could be deleted or replaced by a nonviral sequence while maintaining viral systemic infection.

The HC-Pro of the attenuated ZYMV virus AGII differs from that of the wild type by a single amino acid change (15). As the HC-Pro is known to associate with the CP-NT (6, 22) we wished to confirm that our results are not restricted to AGII but apply to the wild-type ZYMV as well. The wild-type-based mutant ZYMV-Myc33 showed a systemic infectivity similar to that of the attenuated mutant AGII-Myc33. We therefore concluded that the difference in HC-Pro between these two mutants is irrelevant for systemic infection.

We have shown that the fusion of two totally unrelated foreign sequences, encoding His or Myc peptide, to the intact or truncated AGII CP-NT domain did not interrupt virion assembly and permitted systemic infection, without alteration of symptom expression in ZYMV-susceptible cucurbits. It is noteworthy that Fernandez-Fernandez et al. (12) were able to demonstrate that the insertion of various sizes of foreign sequences inside the plum pox virus CP-NT did not prevent viral systemic spread. Together, these findings suggest that the length and sequence of the authentic AGII CP-NT are not critical factors in establishing viral systemic infectivity. This conclusion is reinforced by the systemic infectivity of AGII-Myc43 lacking the entire surface-exposed CP-NT (Table 1). This is in contrast to what has been shown in TEV in tobacco where deletion of most of the CP-NT abolished viral long- distance movement, suggesting the possible involvement of a phloem-specific host factor that recognizes TEV CP-NT to facilitate viral long-distance movement (9). Our data suggest that a different mechanism exists for ZYMV systemic spread and may imply that interactions between CP-NT and a host factor are not involved in the establishment of viral systemic infection. It has been shown that squash, unlike tobacco, is characterized by the presence of unusually large numbers of plasmodesmata at the interface between minor vein companion cell-sieve element complex and the surrounding cells (34). Since viruses utilize these plasmodesma connections for loading into the plant vascular system, structural differences in this system might suggest different requirements for the establishment of systemic movement between tobacco and squash.

The decrease in CP accumulation, deduced from the combined Western blot analysis with anti-Myc and AB6, observed for mutants that contained NT deletions of more than 13 amino acids, and the reduced infectivity rate and delayed symptom appearance seen in AGII-Myc38 and AGII-Myc43 may imply that as the CP-NT becomes shorter, it probably lacks certain amino acid residues that are required for optimal virus accumulation and spread. A similar conclusion can be drawn from a number of studies demonstrating that altered amino acids in the CP-NT region could modulate virus movement (20) and accumulation (3).

Although Myc peptide fusion supported viral systemic infection with truncations of up to 43 aa from the CP-NT, its fusion to a deletion mutant lacking 5 aa from the CP core region (AGII-Myc48) did not allow systemic infection. This is consistent with the behavior of various potyvirus core mutants that have been produced previously (10, 35). As the core region is essential for virion formation (17), replication (10), and cell-to-cell movement (9), we could assume that our core deletion mutant also disrupts viral encapsidation and causes dysfunctional viral movement.

In contrast to the Myc peptide (15 aa), fusion of similarly sized FMDV peptide (17 aa) to a wild-type (AGII-FMDV) or truncated CP-NT (AGII-FMDV13) did not support systemic infectivity, suggesting that fused FMDV interrupts the assembly of CP subunits into a stable virion which is necessary for systemic spread. Nevertheless, the fusion of a Myc peptide at the NT of FMDV-CP (AGII-Myc-FMDV13), to generate a 13-truncated CP-NT fused to both Myc and FMDV, restored viral systemic infectivity and enabled the presentation of both foreign peptides on the viral surface. This demonstrates that a terminally placed peptide can facilitate the presentation of another foreign peptide that by itself could not be presented.

We have proved by Ni²⁺ affinity purification and immunogold labeling that the N-terminally fused His and Myc peptides are exposed on the viral surface and can cause a complete masking of the CP-NT immunodominant epitopes. This is in accordance with the prediction that the potyviral CP-NT domain is exposed on the viral surface and can serve as an anchor for a fused foreign peptide (12, 18).

Taken together, our findings suggest that a foreign peptide can substitute for part or all of the wild-type ZYMV CP-NT and still permit viral systemic infection. This conclusion might be extended to other potyviruses as well. Furthermore, we have shown that a foreign epitope of at least 31 aa can be presented on the ZYMV virion surface, paving the way for the use of ZYMV as an epitope presentation system.