Previous Article | Next Article ![]()
Journal of Virology, July 2001, p. 6321-6328, Vol. 75, No. 14
HIV Drug Resistance
Program1 and SAIC
Frederick,2 National Cancer
Institute-Frederick Cancer Research and Development Center, Frederick,
Maryland 21702-1201, and Center for Advanced Biotechnology and
Medicine and Rutgers University Chemistry Department, Piscataway, New
Jersey 08854-56383
Received 5 January 2001/Accepted 12 April 2001
When human immunodeficiency virus type 1 (HIV-1) is selected for
resistance to 3TC, the methionine normally present at position 184 is
replaced by valine or isoleucine. Position 184 is the X of the
conserved YXDD motif; positions 185 and 186 form part of the triad of
aspartic acids at the polymerase active site. Structural and
biochemical analysis of 3TC-resistant HIV-1 reverse transcriptase (RT)
led to a model in which a Considerable progress has been made
in the development of anti-human immunodeficiency virus type 1 (HIV-1)
drugs and drug therapies. However, the emergence of drug-resistant
viral strains presents a major problem; understanding the mechanisms
that underlie drug resistance should be an important part of the effort
to develop more effective drugs. Most of the available drugs target one
of two viral enzymes, reverse transcriptase (RT) and protease (PR). There are two classes of RT inhibitors, nucleoside analogs and nonnucleosides. The nucleoside analogs used to treat HIV-1 infections lack the normal 3' OH of the ribose ring. The compounds are usually given to patients in an unphosphorylated state. The compounds are taken
up by cells and converted to triphosphates by cellular enzymes. In this
form, the analogs can be incorporated into viral DNA by HIV-1 RT; once
incorporated, nucleoside analogs act as chain terminators, blocking
viral DNA synthesis. One of the nucleoside analogs commonly used to
treat HIV-1 infections is 3TC. 3TC treatment selects for drug-resistant
viruses that have the methionine normally present at position 184 replaced either by isoleucine or valine. Viruses that have either the
M184I or M184V mutation are quite resistant to 3TC; purified
recombinant HIV-1 RTs that carry these mutations are resistant to 3TCTP
in simple in vitro polymerization assays (9, 11, 18).
Nucleoside analogs inhibit reverse transcription (and viral
replication) because they are incorporated into viral DNA by HIV-1 RT.
Resistance to nucleoside analogs implies that the mutant RT has an
increased discrimination between the analogs and their normal
counterparts. In order for the virus to replicate, the mutant RT must
be able to incorporate normal deoxynucleoside triphosphates (dNTPs) and
synthesize viral DNA reasonably efficiently. Either the increased
discrimination can occur at the time when the triphosphate form of the
nucleoside analog is incorporated, or there can be enhanced excision of
the analog after it has been incorporated. Resistance to AZT involves
enhanced excision to AZTMP after it has been incorporated (2, 7,
21). In contrast, resistance to 3TC involves a block at the
incorporation step (9, 11, 18).
Structural analysis (16, 24) led to the proposal that
mechanism of resistance to 3TC of the M184V and M184I mutations is
steric hindrance. In wild-type HIV-1 RT, there is a methionine at
position 184, which is the X of the conserved YXDD motif; the two
aspartates at positions 185 and 186 are part of the polymerase active
site. 3TC has, instead of a ribose, an oxathiolane ring. The form of
3TC used as a drug is the opposite enantiomer relative to normal
nucleosides. The introduction of the bulkier sulfur into the
pseudoribose ring of 3TC and the use of the opposite enantiomer provide
an opportunity for steric hindrance. The substitution of a HIV-1 RT.
The open reading frames encoding wild-type HIV-1
RT and each of the M184 mutants were cloned into a plasmid similar to
p66HRT-PROT (3, 4, 19). The plasmid is based on the
expression vector pT5m and was introduced into Escherichia
coli strain BL21 (DE3)pLysE (4, 19, 23, 26). After
induction with isopropyl- MLV RT.
The expression clone for the MLV RT has been
previously described (15). Briefly, codons for two extra
amino acids (methionine and glycine) were added to the 5' end of the
MLV RT coding region to generate an initiating ATG codon and an
NcoI site. A termination codon and HindIII
site were added to the 3' end of the coding region. The resulting
construct was cloned into the expression vector pUC12N, which causes
constitutive expression of the recombinant protein in E. coli. The protocol for purifying wild-type and mutant MLV RTs is
given in reference 6.
MLV RT mutants.
The mutations were generated using
BspMI cassettes, similar to those used to generate mutations
in HIV-1 RT (5). PCR amplification was used to generate
two fragments from the MLV coding region. The first PCR amplification
spans the 5' end of the MLV RT coding region. The 5' primer anneals to
the pUC12N sequence 5' of the NcoI site and the initiation
codon of MLV RT (5' GCGGGCAGTGAGCGCAACGC 3'). The 3' primer
(5'GCGG CGGAATTCGCGACCTGCGGCCTGGGTGCTGGATCCGGAAGTCTGC 3')
is complementary to the region of MLV RT near amino acid (aa) 213 and
also includes BspMI and EcoRI recognition
sequences (underlined). The PCR fragment was digested with
NcoI and EcoRI and then purified. The second PCR
amplification spans the 3' end of the MLV RT coding region. The 5'
primer is complementary to the MLV RT coding region near aa 230 and
also includes EcoRI and BspMI recognition
sequences (5'GCGGCGGAATTCGCGACCTGCGGCCCCACTTCTGAGCTAGACTGCCAAC
3'). The 3' primer anneals to the pUC12N vector sequence 3' of
the TAG termination codon and the HindIII recognition
sequence (5' GTAAAACGACGGCCAGTGCCAAG 3'). The PCR fragment
was digested with EcoRI and HindIII and purified. This fragment and the NcoI/EcoRI
PCR fragment described above were coligated into
NcoI/HindIII-digested pUC12N. The
resulting clone, designated MLV RT 1-2, has a deletion in the coding
region of MLV RT between aa 213 and 230 which is replaced by an
EcoRI recognition sequence flanked by two BspMI
recognition sequences oriented in opposite directions.
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.14.6321-6328.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
YADD Mutants of Human Immunodeficiency Virus Type 1 and Moloney
Murine Leukemia Virus Reverse Transcriptase Are Resistant to
Lamivudine Triphosphate (3TCTP) In Vitro

![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-branched amino acid at position 184 would
act as a steric gate. Normal deoxynucleoside triphosphates (dNTPs)
could still be incorporated; the oxathiolane ring of 3TCTP would clash
with the
branch of the amino acid at position 184. This model can
also explain 3TC resistance in feline immunodeficiency virus and human
hepatitis B virus. However, it has been reported (14) that
murine leukemia viruses (MLVs) with valine (the amino acid present in
the wild type), isoleucine, alanine, serine, or methionine at the X
position of the YXDD motif are all resistant to 3TC. We prepared
purified wild-type MLV RT and mutant MLV RTs with methionine,
isoleucine, and alanine at the X position. The behavior of these RTs
was compared to those of wild-type HIV-1 RT and of HIV-1 RT with
alanine at the X position. If alanine is present at the X position,
both MLV RT and HIV-1 RT are relatively resistant to 3TCTP in vitro.
However, the mutant enzymes were impaired relative to their wild-type
counterparts; there appears to be steric hindrance for both 3TCTP and
normal dNTPs.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-branched
amino acid (either isoleucine or valine) for the methionine normally
present at position 184 leads to steric hindrance; the
branch of
the amino acid at position 184 clashes with the oxathiolane ring of
3TC. There is still enough room for normal dNTPs to be incorporated;
the
-branched amino acids create a steric gate that allows the
incorporation of a normal dNTP but not 3TCTP (11, 16, 24).
This exact mechanism also appears to account for the resistance of
hepatitis B virus (HBV) RT and feline immunodeficiency virus (FIV) RT
to 3TC (8, 24). In HBV RT, the
-branched amino acid
introduced into the YXDD motif is valine or isoleucine. In FIV RT, the
amino acid selected at the X position is threonine (25).
In contrast to HIV-1, in which the YXDD motif is YMDD, the RT of
Moloney murine leukemia virus (MLV) has, in the wild-type enzyme, YVDD.
In the case of MLV RT, the valine of the YVDD motif is at position 223. As might be expected from the results obtained with HIV-1, wild-type
MLV is relatively resistant to 3TC in cell culture (14).
However, MLV mutants with YMDD or YADD at the polymerase active site
are also relatively resistant to 3TC. This prompted us to purify
recombinant wild-type MLV RT and the YIDD, YMDD, and YADD mutants of
MLV RT and to compare these MLV RTs to wild-type HIV-1 RT and the YADD
mutant of HIV-1 RT. All of the MLV RTs were more resistant to 3TCTP
than wild-type HIV-1 RT. The YMDD mutant of MLV RT had a moderate
sensitivity to 3TCTP; the other MLV RTs were more resistant. Both the
YADD enzymes (MLV and HIV-1) had obvious defects in simple polymerase assays. To explain these results, we have developed a model that incorporates the steric hindrance model for the resistance of the HIV-1
RT mutants M184V and M184I to 3TCTP (11, 16, 24).
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-D-thiogalactopyranoside, the
plasmid expresses both the p66 form of HIV-1 RT (either wild type or a
mutant) and HIV-1 PR. Approximately 50% of the overexpressed p66 RT is
converted to the p51 form by HIV-1 PR, and p66-p51 heterodimers accumulate in E. coli. The p66-p51 heterodimers were
purified by metal chelate chromatography (4, 19, 20).
Construction of plasmid used to synthesize RNA in vitro. A 35-base fragment from the HIV-1 provirus clone pNL 4-3 (1), including the polypurine tract from the HIV-1 genome (positions 9049 to 9083), was linked to 30 adenines and inserted into the EcoRI and HindIII restriction sites of plasmid pGEM-3Zf (Promega, Madison, Wis.). The sequence and structure of the resulting plasmid, pGPA35, were verified both by restriction enzyme mapping and by double-stranded DNA sequencing (10).
RNA template preparation.
The RNA template used in the RNase
H cleavage assays was prepared from linearized plasmid DNA (pGPA35) by
in vitro runoff transcription with T7 RNA polymerase, using a
MEGAscripts RNA synthesis kit (Ambion, Inc., Austin, Tex.) in the
presence of 120 µCi of [
-32P]UTP. The transcription
reaction was heat inactivated at 70°C for 20 min. The resulting RNA
was purified using the PolyA Tract mRNA isolation system, composed of
biotinylated oligo(dT) and streptavidin-coated magnetic particles
(Promega, Madison, Wis.). The amount of radioactive UTP incorporation
into RNA was determined by scintillation counting (10).
DNA oligonucleotide preparation.
DNA oligonucleotides were
synthesized by BioServe Biotechnologies (Laurel, Md.). The lyophilized
oligonucleotides were dissolved in diethyl pyrocarbonate-treated water
and stored at
20°C.
RNase H cleavage assays. 32P-labeled RNA template (50,000 cpm) that was synthesized from linearized pGPA35 (~100 ng) was hybridized to approximately 20 ng of the individual oligonucleotide as described above in the presence of 50 mM Tris-Cl (pH 8.0), 50 mM NaCl, 5 mM MgCl2, 2.0 mM dithiothrectol (DTT), 100 µg of acetylated bovine serum albumin (BSA), and 10 mM CHAPS {3- [(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate}. The mixtures of RNA and oligonucleotides were heated to 70°C for 10 min and then slowly cooled to room temperature. The reactions were initiated by adding 45 ng of purified wild-type or mutant HIV-1 RT and MgCl2 to a final concentration of 5 mM in a final volume of 12 µl and were then incubated at 37°C. Samples were removed at 0.25, 1, 4, and 16 min, and the reactions were terminated by adding 2× RNA loading buffer. The products were heat denatured and separated on a denaturing 15% polyacrylamide-7 M urea gel in Tris-borate-EDTA buffer at 1,600 V for approximately 90 min (10). The gel was dried and autoradiographed for several hours or overnight.
RNase H cleavage inhibition assay. The RNase H inhibition assay was based on a standard RNase H assay (10). Purified wild-type or mutant HIV-1 RT (120 ng) was first mixed with dCTP or 3TCTP at different concentrations, as indicated in the figure legends, and incubated at room temperature for 2 min. The low-salt reactions were initiated by adding annealed 32P-labeled RNA template and DNA oligonucleotide in the presence of 50 mM Tris-Cl (pH 8.0), 50 mM NaCl, 2.0 mM DTT, 75 µg of acetylated BSA per ml, 10 mM CHAPS, and 5 mM MgCl2. Aliquots of the reactions were removed at 0.25, 1, 4, and 16 min, and the reactions were terminated by adding these aliquots to equal amounts of 2× RNA loading buffer. The products were heat denatured and separated as described above (see also reference 10). The high-salt RNase H cleavage inhibition assay was done in 50 mM Tris-Cl-100 mM KCl-20 mM MgCl2-2.5 mM DTT-75 µg of acetylated BSA per ml-10 mM CHAPS-2.5% glycerol (11).
Polymerization assays. (i) 3TCTP inhibition.
For each
sample, 0.25 µg of single-stranded M13mp18 DNA (New England Biolabs,
Beverly, Mass.) was hybridized to 0.5 µl of the
47 sequencing
primer (1.0 optical density unit [OD]/ml; New England Biolabs) by
heating to 96°C and slow cooling to room temperature. The
template-primer was extended by adding 1.0 µg of wild-type or mutant
HIV-1 RT in a mixture containing 25 mM Tris (pH 8.0), 75 mM KCl,
8.0 mM MgCl2, 100 µg of BSA per ml, 10 mM CHAPS, 2.0 mM DTT, 10 µM each dATP, dGTP, and dTTP, 5.0 µM
[
-32P]dCTP, and the indicated concentrations of 3TCTP
(Moravek Biochemicals, Brea, Calif.) in a 100-µl reaction volume. The
mixture was incubated at 37°C for 30 min. The reaction was halted by
the addition of 3 ml of ice-cold trichloroacetic acid (TCA), and the
precipitated DNA was collected by suction filtration through Whatman
GF/C glass filters. The amount of incorporated radioactivity was
determined by liquid scintillation counting. Reactions involving MLV RT
were done using similar conditions; however, for MLV RT, the
concentration of KCl was 30 mM.
(ii) Low-dNTP extension assay.
For each sample, 0.5 µl of
the
47 primer (1.0 OD/ml; New England Biolabs) was 5' end labeled
with [
-32P]ATP and T4 polynucleotide kinase. After
incubation at 37°C for 30 min, the primer was separated from the
unincorporated nucleotide by passage through Sephacryl S-200 HR (Sigma,
St. Louis, Mo.); then 0.25 µg of single-stranded M13mp18 DNA (New
England Biolabs) was annealed to the labeled primer as described above.
(iii) MLV RT polymerase incorporation assays.
The MLV RT
polymerase assays using either poly(rC) · oligo(dG) or M13mp18
and the
47 primer DNA as the template-primer are similar to the HIV-1
RT assays. For each sample to be assayed, either 0.25 µg of
single-stranded M13mp18 DNA was hybridized to 0.5 µl of
47
sequencing primer (1.0 OD/ml) or 0.1 U of poly(rC) · oligo(dG)
(Pharmacia) was used. For each sample, 1.0 µg of wild-type MLV RT or
mutant MLV RT was added to the template-primer in 25 mM Tris-Cl (pH
8.0)-30 mM KCl-8.0 mM MgCl2-2.0 mM DTT-100 µg of BSA
per ml-and 10.0 mM CHAPS. For poly(rC) · oligo(dG), the
reaction was supplemented with 10.0 µM dGTP and 0.025 µM
[
32P]dGTP. For
47 plus M13mp18 DNA, the reaction was
supplemented with 10.0 µM each dATP, dGTP, and dTTP, 5.0 µM dCTP,
and 0.02 µM [
32P]dCTP. The final reaction volume was
100 µl. The reactions were allowed to proceed at 37°C for 30 min
and then halted by the addition of 3 ml of ice-cold 10% TCA, and the
precipitated DNA was collected by suction filtration through Whatman
GF/C glass filters. The amount of incorporated DNA was determined by
liquid scintillation counting.
(iv) Extension assay.
The extension assay is similar to the
low-dNTP assay described above. Briefly,
47 sequencing primer (New
England Biolabs) was 5' end labeled with [
-32P]ATP and
T4 polynucleotide kinase. After purification, the labeled primer was
annealed to single-stranded M13mp18 DNA (New England Biolabs) by
heating and slow cooling. For each sample, 1.0 µg of wild-type MLV RT
or MLV RT variant was added to the labeled template-primer in 25 mM
Tris-Cl (pH 8.0)-30 mM KCl-8.0 mM MgCl2-2.0 mM DTT-100
µg of BSA per ml-10.0 mM CHAPS. The reaction mix was allowed to sit
at room temperature for several minutes to allow the RT to bind to the
template-primer. The reaction was initiated by the addition of dATP,
dCTP, dGTP, and dTTP to a final concentration of 10.0 µM. The final
reaction volume was 100 µl. The reactions were allowed to proceed at
37°C for 10 min and then halted by phenol-chloroform extraction. The
samples were precipitated by the addition of 1 volume of isopropanol,
fractionated by electrophoresis on a 6.0% polyacrylamide gel, and autoradiographed.
| |
RESULTS |
|---|
|
|
|---|
Halvas et al. (14) used an MLV-based vector to test the 3TC sensitivity or resistance of wild-type MLV and MLV mutants with alterations in the YXDD motif of RT. Not only was wild-type MLV resistant to 3TC, but so were the V223I, V223M, V223A, and V223S variants (position 223 of MLV RT is equivalent to position 184 of HIV-1 RT). This was a surprising finding; the simple form of the current model for the resistance of HIV-1 to 3TC predicts that wild-type MLV RT and the V223I mutant would be 3TC resistant but that the other MLV RTs would be sensitive. We prepared recombinant wild-type MLV RT and the V223M, V223I, and V223A mutants (Materials and Methods).
Judging from the relative titers of the MLV vectors carrying the
various mutants (14), we expected the V223M and V223I
mutants to have polymerase activities approximately equivalent to the wild-type level and the V223A to be slightly impaired. The various enzymes were compared for the ability to copy single-stranded DNA (M13)
from the
47 primer and to use poly(rC) · oligo(dG) as a
template-primer. All of the enzymes had similar activities with
poly(rC) · oligo(dG); with the M13/
47 template-primer, V223M was similar to wild-type MLV RT, the V223I enzyme was significantly more active than the wild-type MLV RT, and the V223A mutant was considerably less active than wild-type MLV RT (Table
1). We also did extension assays using
M13 as a template; the results were similar to what was found with the
M13 incorporation assay. V223M was similar to and V223I was better than
wild-type MLV RT in the extension assay; V223A was less efficient (Fig.
1). The differences between wild-type MLV
RT and the mutants are more apparent in the assay shown in Table 1
(reaction time, 30 min) than in the extension assays in Fig. 1
(reaction time, 10 min). We believe that the longer incubation time
enhanced the differences. These recombinant enzymes were tested for
their sensitivity or resistance to 3TCTP in an in vitro polymerization
assay; wild-type HIV-1 RT was included as a control. As expected,
wild-type HIV-1 RT was quite sensitive to 3TCTP; wild-type MLV RT was
fully resistant (Fig. 2). The other MLV
RTs showed intermediate levels of resistance. The V223A and V223I
enzymes showed some sensitivity to 3TCTP but were clearly more
resistant than the V223M variant.
|
|
|
The substantial resistance of the V223A mutant suggested a parallel
experiment with the M184A mutant of HIV-1 RT. This enzyme was also
quite resistant to 3TCTP in an in vitro polymerase assay; in an in
vitro assay, it appeared to be as resistant to 3TCTP as the M184I
and M184V mutants (Fig. 3).
Although M184A was quite resistant to 3TCTP in a simple in vitro assay,
it is not selected by 3TC treatment in patients or in cell culture. We
tested the ability of the M184A mutant to extend a primer at low dNTP
concentrations. The enzyme is moderately deficient compared to
wild-type HIV-1 RT and to the M184I and M184V mutants that can be
selected in vivo (Fig. 4). A simple
interpretation of these data is that the enzyme cannot interact with an
incoming dNTP to form the catalytically relevant closed complex as well
as wild-type RT (see Discussion).
|
|
If the nucleotide at the 3' end of the primer strand lacks a 3' OH
(here a dideoxynucleotide), and the appropriate incoming dNTP is
provided, HIV-1 RT will form a stable closed ternary complex. In the
ternary complex, the fingers of the p66 subunit close down on the
incoming dNTP, forming the top of the dNTP binding pocket (16). This complex can be detected in a gel shift assay
(11, 27), and the pattern of RNase H cleavage is
changed relative to a binary complex composed of HIV-1 RT and the
nucleic acid substrate (11). The most obvious change in
the RNase H cleavage pattern is that the ternary complex fails to
make the secondary cleavages that center around a position
approximately 8 bases from the 3' end of the primer strand. We used
this assay to monitor the ability of dCTP and 3TCTP to induce the
closed ternary complex with wild-type HIV-1 RT and the M184V and the
M184I mutants. In low salt, all of the enzymes can form complexes with
either 3TCTP or dCTP; however, the complexes formed with the
3TC-resistant enzymes and 3TCTP are salt sensitive, suggesting that
these complexes are strained due to steric hindrance between the
-branched amino acid (I or V) at position 184 and the oxathiolane
ring of 3TCTP (11).
Similar experiments were done with the M184A mutant of HIV-1 RT. The
pattern of RNase H cleavage by the binary complex is the same for
wild-type HIV-1 RT and the M184A mutant (Fig.
5A). As expected, the
M184A mutant can bind dCTP and form the ternary complex in low salt
(Fig. 5B). However, in low salt, a significantly higher concentration
of 3TCTP is required for the M184A mutant to form the closed complex
than for wild-type HIV-1 RT (11). The M184A enzyme can
also form a ternary complex with 3TCTP in low salt (Fig. 5C). However,
in high salt the M184A mutant does not form a stable complex with
either dCTP or 3TCTP (Fig. 6). This
suggests that in the case of M184A, there is some sort of steric
hindrance for both 3TCTP and dCTP that prevents the formation of a
stable closed complex (see Discussion).
|
|
| |
DISCUSSION |
|---|
|
|
|---|
HIV-1, HBV, and FIV are all sensitive to 3TC. In each case,
3TC-resistant viruses can be selected. All of the 3TC-resistant viruses
have mutations in the YXDD motif of RT; in all cases, the amino acid
normally present at the second position of the motif is replaced by a
-branched amino acid (8, 24). Models based on the
structures of a ternary complex of wild-type HIV-1 RT, DNA, and a dNTP
(16) or of a binary complex of M184I and DNA
(24) suggested that resistance is caused by steric
hindrance between the
-branched amino acid and the oxathiolane ring
of 3TCTP. We have obtained biochemical data to support the model (11). However, Halvas et al. (14) showed, for
MLV, that a
-branched amino acid in the second position of the YXDD
motif of RT was not required for 3TC resistance. We tested several MLV RTs, including the wild-type enzyme and the V223I, V223M, and V223A
mutants, for their resistance to 3TCTP. The wild-type enzyme is
completely resistant; V223M is modestly resistant. V223I and V223A show
intermediate resistance, greater than that of V223M and less than that
of wild-type MLV RT. These results prompted an examination of the M184A
mutant of HIV-1 RT; the M184A mutant of HIV-1 RT is quite resistant to
3TCTP in vitro.
This raises two questions. First, for HIV-1, why isn't the M184A
mutant selected in response to 3TC in vivo? Second, since alanine is
not a
-branched amino acid, what is the mechanism of resistance? In
terms of the possible selection of M184A by 3TC treatment, there are
two potential problems. First, it would take two mutations to convert
the methionine codon to an alanine codon; only one change is needed to
obtain either a valine or isoleucine codon. Second, and probably more
important, the M184A mutant appears to be less efficient than wild-type
HIV-1 RT or either the M184I or M184V mutant. Both data in the
literature (22, 29) and our data suggest that the M184A
mutant is less able to form the closed complex and incorporate normal
dNTPs than the wild-type enzyme. The magnitude of the problem appears
to be a function of both the template-primer (22, 29) and
the salt concentration (Fig. 6). However, the M184A enzyme is not only
less able to form the closed complex and incorporate normal dNTPs less
well than wild-type HIV-1 RT; it is also less able than either M184V or
M184I. It seems reasonable to assume that this difference accounts for
the selection of M184V (or M184I) instead of M184A when the virus is
challenged with 3TC either in culture or in a patient. It is difficult
to know to what degree low dNTP levels actually limit HIV-1 replication
in vivo, in part because HIV-1 can replicate in a variety of cell
types. In quiescent peripheral blood lymphocytes (PBLs), the level of
dNTPs range from a low of 0.32 µM for dATP up to 5.6 µM for dTTP.
Viral DNA synthesis is completed by the wild-type enzyme, but slowly
and inefficiently (12). It has been suggested that HIV-1
RT may act in a partially distributive manner at these low levels of dNTPs (12). In activated PBLs, the level of dNTPs is
higher, ranging from 3.24 µM for dATP up to 26.13 µM dTTP. Measured
Km values in this system were approximately 2.6 to 4.0 µM for the various dNTPs (12). Our data suggest
that the M184A enzyme is less efficient than either the M184I or the
M184V enzyme over a considerable range of dNTP concentrations (0.1 to 2 µM), which would put it at a disadvantage in quiescent PBLs. It may
be very inefficient at viral DNA synthesis in quiescent PBLs. In
support of this idea, HIV-1 carrying the M184A mutation replicates
quite poorly in vitro (28). Relatively poor replication,
in at least some cell types, also appears to limit the selection of
another 3TC-resistant mutation, M184T (17).
What then is the mechanism of resistance of the M184A mutant? We
believe that it is still steric hindrance, even though alanine is not a
-branched amino acid. The M184I structure is a binary complex
(24). In this complex, the position of the DNA (both primer and template) is clearly different from the position occupied by
the template-primer in the structure of wild-type HIV-1 RT. The
significance of this observation for the structure of the ternary
complex is unclear; whether there is a repositioning of the nucleic
acid in the ternary complex is not known.
If we assume that there is repositioning of the template-primer in the ternary complex, and that repositioning also occurs in the M184A mutant, then there is a simple explanation for the data. The repositioning of the template-primer creates an opportunity for steric hindrance between the alanine at position 184 (or some other nearby amino acid) and the oxathiolane ring of 3TCTP. Although the simplest model would have the oxathiolane ring of 3TCTP interacting directly with 184A, it is possible that changes in the positions of the amino acid side chains could alter the polymerase active site in a fashion such that some other amino acid in the active site of the enzyme could have a direct role in creating the steric clash. A better understanding of the precise mechanism will probably require an X-ray crystallography structure complex of the M184A mutant, nucleic acid, and bound dNTP.
There are data in the literature which show that, for the M184A mutant, the nature of the nucleic acid substrate can profoundly affect the behavior of the enzyme. Wakefield et al. (28) reported that the M184A mutant can copy a poly(rA) template from an oligo(dT) primer almost as well as wild-type HIV-1 RT; however, it is much less active than wild-type RT with a poly(rA) template and an oligo(U) primer. Wilson et al. (29) showed, with homopolymeric RNA templates, that the M184A mutant has a substantially higher Km for dCTP and dTTP. This shows that wild-type HIV-1 RT and the M184A mutant interact differently with different nucleic acid substrates. These data, taken together with the low-dNTP extension data (Fig. 4) and the salt sensitivity of the ternary complex (Fig. 6), suggest that changes in the structure of the polymerase active site of the YADD mutant or changes in the positioning of the nucleic acid (or both) produce a more confined dNTP binding site that leads to steric hindrance even with normal dNTPs. The differences seen with the different template-primers also suggest that the structure and/or position of the nucleic acid can play an important role in defining the dNTP binding site.
The model can be extended to explain the MLV RT data. The polymerase
active site of MLV RT is quite similar to the polymerase active site of
HIV-1 RT (13). For MLV RT, like HIV-1 RT, the YMDD version
of the enzyme is considerably more sensitive to 3TCTP than the YVDD
version. However, the YMDD version or MLV RT is more resistant to 3TCTP
than the YMDD version of HIV-1 RT. If the ribose (or oxathiolane) ring
is a little closer to the active site in the vicinity of the YXDD motif
in MLV RT than in HIV-1 RT, the data can be explained. The oxathiolane
ring is larger than the ribose ring, and since it is the opposite
enantiomer there will be a steric clash with 3TCTP for wild-type MLV RT
and the YMDD mutant; as expected, the extent of the clash (and the level of 3TC resistance) is greater for the
-branched amino acid valine than for methionine. Although the polymerase active site of MLV
RT is similar to the polymerase active site of HIV-1 RT, it is not
identical. Differences in the exact positioning of the template-primer
or in the relative positions of the amino acid side chains (or both)
could account for the subtle differences seen with the individual amino
acid substitutions in the YXDD motif of HIV-1 RT and MLV RT. The
phenotypes of the individual YXDD mutants of MLV RT, and their relative
sensitivity to 3TCTP, can be accounted for in terms of the effects of
the individual amino acid substitutions on the precise structure at the
polymerase active site, the exact position of the template-primer, or both.
| |
ACKNOWLEDGMENTS |
|---|
We thank Peter Frank for help in preparing the purified proteins, Vinay Pathak for helpful discussions, and Hilda Marusiodis for help in preparing the manuscript.
This research was supported by NIGMS and the NCI. S.G.S. and E.A. gratefully acknowledge support from NIH grant AI27690 (merit award to E.A.).
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: HIV Drug Resistance Program, National Cancer Institute-FCRDC, P.O. Box B, Building 539, Room 130A, Frederick, MD 21702-1201. Phone: (301) 846-1619. Fax: (301) 846-6966. E-mail: hughes{at}ncifcrf.gov.
Present address: E-Centive, Bethesda, MD 20817.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Adachi, A.,
H. E. Gendelman,
S. Koenig,
T. Folks,
R. Willey,
A. Rabson, and M. A. Martin.
1986.
Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone.
J. Virol.
59:284-291 |
| 2. | Arion, D., N. Kaushik, S. McCormick, G. Borkow, and M. A. Parniak. 1998. Phenotypic mechanism of HIV-1 resistance to 3'-azido-3'-deoxythymidine (AZT): increased polymerization processivity and enhanced sensitivity to pyrophosphate of the mutant viral reverse transcriptase. Biochemistry 37:15908-15917[CrossRef][Medline]. |
| 3. |
Boyer, P. L.,
A. L. Ferris, and S. H. Hughes.
1992.
Cassette mutagenesis of the reverse transcriptase of human immunodeficiency virus type 1.
J. Virol.
66:1031-1039 |
| 4. |
Boyer, P. L.,
J. Ding,
E. Arnold, and S. H. Hughes.
1994.
Subunit specificity of mutations that confer resistance to nonnucleoside inhibitors in human immunodeficiency virus type 1 reverse transcriptase.
Antimicrob. Agents Chemother.
38:1909-1914 |
| 5. | Boyer, P. L., and S. H. Hughes. 1996. Site-directed mutagenic analysis of viral polymerases and related proteins. Methods Enzymol. 275:538-555[Medline]. |
| 6. | Boyer, P. L., H.-Q. Gao, P. Frank, P. K. Clark, and S. H. Hughes. 2001. The basic loop of the RNase H domain of MLV RT is important both for RNase H and polymerase activity. Virology 282:206-213[CrossRef][Medline]. |
| 7. |
Boyer, P. L.,
S. G. Sarafianos,
E. Arnold, and S. H. Hughes.
2001.
Selective excision of AZTMP by drug-resistant human immunodeficiency virus reverse transcriptase.
J. Virol.
75:4832-4842 |
| 8. |
Das, K.,
X. Xiong,
H. Yang,
C. E. Westland,
C. S. Gibbs,
S. G. Sarafianos, and E. Arnold.
2001.
Molecular modeling and biochemical characterization reveal the mechanism of hepatitis B virus polymerase resistance to lamivudine (3TC) and emtricitabine (FTC).
J. Virol.
75:4771-4779 |
| 9. | Feng, J. Y., and K. S. Anderson. 1999. Mechanistic studies examining the efficiency and fidelity of DNA synthesis by the 3TC-resistant mutant (184V) of HIV-1 reverse transcriptase. Biochemistry 38:9440-9448[CrossRef][Medline]. |
| 10. | Gao, H.-Q., P. L. Boyer, E. Arnold, and S. H. Hughes. 1998. Effects of mutations in the polymerase domain on the polymerase, RNase H and strand transfer activities of human immunodeficiency virus type 1 reverse transcriptase. J. Mol. Biol. 277:559-572[CrossRef][Medline]. |
| 11. | Gao, H.-Q., P. L. Boyer, S. G. Sarafianos, E. Arnold, and S. H. Hughes. 2000. The role of steric hindrance in 3TC resistance of human immunodeficiency virus type-1 reverse transcriptase. J. Mol. Biol. 300:403-418[CrossRef][Medline]. |
| 12. |
Gao, W.-Y.,
A. Cara,
R. C. Gallo, and F. Lori.
1993.
Low levels of deoxynucleotides in peripheral blood lymphocytes: a strategy to inhibit human immunodeficiency virus type 1 replication.
Proc. Natl. Acad. Sci. USA
90:8925-8928 |
| 13. | Georgiadis, M. M., S. M. Jessen, C. M. Ogata, A. Telesnitsky, S. P. Goff, and W. A. Hendrickson. 1995. Mechanistic implications from the structure of a catalytic fragment of Moloney murine leukemia virus reverse transcriptase. Structure 3:879-892. |
| 14. |
Halvas, E. K.,
E. S. Svarovskaia,
E. O. Freed, and V. K. Pathak.
2000.
Wild-type YMDD mutant murine leukemia virus reverse transcriptases are resistant to 2', 3'-dideoxy-3'-thiacytidine.
J. Virol.
74:6669-6674 |
| 15. | Hizi, A., and S. H. Hughes. 1988. Expression in Escherichia coli of a Moloney murine leukemia virus reverse transcriptase whose structure closely resembles the viral enzyme. Gene 66:319-323[CrossRef][Medline]. |
| 16. |
Huang, H.,
R. Chopra,
G. L. Verdine, and S. C. Harrison.
1998.
Structure of a covalently trapped catalytic complex of HIV-1 reverse transcriptase: implications for drug resistance.
Science
282:1669-1675 |
| 17. | Keulen, W., N. K. T. Back, A. Van Wijk, C. A. B. Boucher, and B. Berkhout. 1997. Initial appearance of the 184Ile variant in lamivudine-treated patients is caused by the mutational bias of human immunodeficiency virus type 1 reverse transcriptase. J. Virol. 71:3346-3350[Abstract]. |
| 18. | Krebs, R., U. Immendörfer, S. H. Thrall, B. M. Wöhrl, and R. S. Goody. 1997. Single-step kinetics of HIV-1 reverse transcriptase mutants responsible for virus resistance to nucleoside inhibitors zidovudine and 3TC. Biochemistry 36:10292-10300[CrossRef][Medline]. |
| 19. | Le Grice, S. F., and F. Grüninger-Leitch. 1990. Rapid purification of homodimer and heterodimer HIV-1 reverse transcriptase by metal chelate affinity chromatography. Eur. J. Biochem. 187:307-314[Medline]. |
| 20. | Le Grice, S. F., T. Naas, B. Wohlgensinger, and O. Schatz. 1991. Subunit-selective mutagenesis indicates minimal polymerase activity in heterodimer-associated p51 HIV-1 reverse transcriptase. EMBO J. 10:3905-3911[Medline]. |
| 21. | Meyer, P. R., S. E. Matsuura, A. M. Mian, A. G. So, and W. A. Scott. 1999. A mechanism of AZT resistance: an increase in nucleotide-dependent primer unblocking by mutant HIV-1 reverse transcriptase. Mol. Cell 4:35-43[CrossRef][Medline]. |
| 22. | Pandey, V. N., N. Kaushik, N. Rege, S. G. Sarafianos, P. N. Yadav, and M. J. Modak. 1996. Role of methionine 184 of human immunodeficiency virus type-1 reverse transcriptase in the polymerase function and fidelity of DNA synthesis. Biochemistry 35:2168-2179[CrossRef][Medline]. |
| 23. | Rosenberg, A. H., B. N. Lade, D. S. Chui, S. W. Lin, J. J. Dunn, and F. W. Studier. 1987. Vectors for selective expression of cloned DNAs by T7 RNA polymerase. Gene 56:125-135[CrossRef][Medline]. |
| 24. |
Sarafianos, S. G.,
K. Das,
A. D. Clark, Jr.,
J. Ding,
P. L. Boyer,
S. H. Hughes, and E. Arnold.
1999.
3TC (lamivudine) resistance in HIV-1 reverse transcriptase involves steric hindrance with -branched amino acids.
Proc. Natl. Acad. Sci. USA
96:10027-10032 |
| 25. | Smith, R. A., K. M. Remington, R. M. Lloyd, Jr., R. F. Schinazi, and T. W. North. 1997. A novel Met-to-Thr mutation in the YMDD motif of reverse transcriptase from feline immunodeficiency virus confers resistance to oxathiolane nucleosides. J. Virol. 71:2357-2362[Abstract]. |
| 26. | Studier, F. W., and B. A. Moffatt. 1986. Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J. Mol. Biol. 189:113-130[CrossRef][Medline]. |
| 27. | Tong, W., C.-D. Lu, S. K. Sharma, S. Matsuura, A. G. So, and W. A. Scott. 1997. Nucleotide-induced stable complex formation by HIV-1 reverse transcriptase. Biochemistry 36:5749-5757[CrossRef][Medline]. |
| 28. |
Wakefield, J. K.,
S. A. Jablonski, and C. D. Morrow.
1992.
In vitro enzymatic activity of human immunodeficiency virus type 1 reverse transcriptase mutants in the highly conserved YMDD amino acid motif correlates with the infectious potential of the proviral genome.
J. Virol.
66:6806-6812 |
| 29. |
Wilson, J. E.,
A. Aulabaugh,
B. Caligan,
S. McPherson,
J. K. Wakefield,
S. Jablonski,
C. D. Morrow,
J. E. Reardon, and P. A. Furman.
1996.
Human immunodeficiency virus type-1 reverse transcriptase: contribution of Met-184 to binding of nucleoside 5'-triphosphate.
J. Biol. Chem.
271:13656-13662 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»