JVI Figure table search 04
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by LaPierre, L. A.
Right arrow Articles by Biegalke, B. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by LaPierre, L. A.
Right arrow Articles by Biegalke, B. J.

 Previous Article  |  Next Article 

Journal of Virology, July 2001, p. 6062-6069, Vol. 75, No. 13
0022-538X/01/$04.00+0   DOI: 10.1128/JVI.75.13.6062-6069.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.

Identification of a Novel Transcriptional Repressor Encoded by Human Cytomegalovirus

Lorie A. LaPierre1,dagger and Bonita J. Biegalke1,2,*

Department of Biomedical Sciences, College of Osteopathic Medicine,1 and Molecular and Cellular Biology Program,2 Ohio University, Athens, Ohio 45701

Received 30 January 2001/Accepted 30 March 2001


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The expression of human cytomegalovirus (HCMV) genes during viral replication is precisely regulated, with the interactions of both transcriptional activators and repressors determining the level of gene expression. One gene of HCMV, the US3 gene, is transcriptionally repressed early in infection. Repression of US3 expression requires viral infection and protein synthesis and is mediated through a DNA sequence, the transcriptional repressive element. In this report, we identify the protein that represses US3 transcription as the product of the HCMV UL34 open reading frame. The protein encoded by UL34 (pUL34) binds to the US3 transcriptional repressive element in yeast and in vitro. pUL34 localizes to the nucleus and alone is sufficient for repression of US3 expression. The data presented here, along with earlier data (B. J. Biegalke, J. Virol. 72:5457-5463, 1998), suggests that pUL34 binding of the transcriptional repressive element prevents transcription initiation complex formation.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Human cytomegalovirus (HCMV) is an important opportunistic pathogen and causes disease in transplant recipients, people with AIDS, and neonates (8). Primary infection results in viral replication and is followed by the establishment of a latent infection. Viral replication is a result of the ordered expression of the HCMV genome; both transcriptional activators and repressors are involved in the precise regulation of viral gene expression during the 5-day replication cycle of the virus (46).

Several HCMV proteins are involved in regulating the expression of other viral genes. The two HCMV major immediate-early (mIE) proteins, IE1 and IE2, have important roles as activators of viral gene expression, while IE2 also acts as a autorepressor, repressing the expression of IE1 and IE2 (13, 28, 38, 57; see reference 47 for a review). Other proteins encoded by the virus (UL82, UL37, UL84, and TRS1/IRS1 among others) are also involved in regulating viral gene expression (14-16, 21, 39, 52). The US3 gene is one example of an HCMV gene whose expression is precisely regulated, with its expression influenced positively and negatively by the proteins listed above (6). Analyses of US3 transcription suggest that additional as-yet-unidentified cellular or viral proteins also contribute to regulated expression.

The US3 gene is transcribed at immediate-early times of infection, yielding three alternatively spliced transcripts that are predicted to encode related but distinct proteins (58, 62). Expression of the US3 gene causes major histocompatibility complex (MHC) class I heavy chains to be retained in the endoplasmic reticulum (1, 30). Retention of MHC class I heavy chains prevents the presentation of viral antigens on the surface of infected cells and is one of the many immune evasion mechanisms utilized by HCMV (27).

In the course of viral infection, US3 expression is initially activated with US3 transcripts accumulating to abundant levels during the first 3 h of infection (3). Following the burst of transcriptional activity, the level of US3 transcripts begins to decline, and by 5 h postinfection there is very little detectable US3 expression. DNA elements that control the pattern of US3 expression include silencer, enhancer, promoter, and transcriptional repressive elements (5, 11, 35, 59, 62).

The decrease in the level of US3 expression is a result of transcriptional repression mediated through the transcriptional repressive element (tre [3, 35]). The tre is located between the transcription start site and the TATA box (sequences from -18 to +1) and mediates repression of US3 transcription in transient-transfection assays and during viral infection (5, 35). tre-dependent transcriptional repression requires viral infection and associated protein synthesis (5). Interestingly, the tre shares sequence similarity with another DNA element (the cis-repressive sequence, crs [4]) that is involved in IE2 autorepression (13, 38, 48). The similarity in sequence between the tre and the crs suggested that IE2 might mediate transcription repression of the US3 gene (4). However, in permissive human diploid fibroblasts, IE2 activates rather than represses US3 gene expression, resulting in a ca. 5- to 10-fold increase in expression. In contrast, in cells nonpermissive for viral replication, Lashmit et al. observed an ~2-fold inhibition of US3 expression by IE2 (35). The significance of IE2 repression of US3 expression in nonpermissive cells is unclear. The following studies were performed to identify protein(s) that interact with the US3 tre and repress US3 transcription. Our data, presented below, identify the HCMV UL34 gene product as a novel sequence-specific DNA-binding protein that acts to repress expression from the US3 promoter.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Virus, cells, and transfections. HCMV (strain Towne) was obtained from Adam Geballe (Fred Hutchinson Cancer Research Center, Seattle, Wash.) and was propagated in primary human diploid fibroblast (HDF) cultures established from skin tissue samples obtained from O'Bleness Memorial Hospital, Athens, Ohio. Cells were propagated in Dulbecco minimal essential medium supplemented with penicillin, streptomycin, glutamine, and 10% NuSerum (Collaborative Research Products, Bedford, Mass.). For transient-transfection assays, primary human diploid fibroblasts (HDFs) were transfected using DEAE-dextran as previously described (3). For protein localization studies, HDFs were transfected using Effectene (Qiagen); fluorescent proteins were visualized using a fluorescein isothiocyanate (FITC) filter.

Nuclear extracts. Nuclear extracts were prepared by a modification of the method described by Dignam et al. (17), with all manipulations carried out on ice. Briefly, HDFs were plated in 150-mm dishes and either mock infected or infected with HCMV strain Towne at a multiplicity of infection of 5 PFU/cell. Nuclear extracts were prepared from infected cells at 3 h postinfection (h.p.i.). Cells were rinsed twice with phosphate-buffered saline (PBS) and harvested by scraping cells from each plate into a 1.5-ml microfuge tube. Cells were pelleted by centrifugation for 5 min at 3,000 rpm at 4°C (Eppendorf model 5415C microcentrifuge). Pellets were resuspended in 100 µl of PBS, combined with three to five pellets per tube, and centrifuged as described above. The combined cell pellet was quickly rinsed in hypotonic buffer (10 mM HEPES [pH 7.9 at 4°C], 1.5 mM MgCl2, 10 mM KCl, 0.2 mM phenylmethylsulfonyl fluoride [PMSF], 0.5 mM dithiothreitol [DTT], 1.5× Complete EDTA-free protease inhibitors [Boehringer Mannheim]) at five times the packed cell volume (PCV). The pellet was immediately centrifuged as described above, resuspended in hypotonic buffer at three times the PCV, and incubated for 5 min. The cells were Dounce homogenized gently 10 times in a microtissue grinder (Fisher Scientific) to release nuclei. Nuclei were then pelleted by centrifugation at 4,000 rpm for 8 min. Nuclear proteins were extracted by resuspending the nuclei in extraction buffer (20 mM HEPES [pH 7.9 at 4°C], 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 25% glycerol, 0.2 mM PMSF, 0.5 mM DTT, 1.5× protease inhibitors [as described above]) at two times the packed nuclear volume followed by incubation on ice for 1 h. The extraction mixture was centrifuged for 30 min at 13,000 rpm at 4°C. The crude nuclear extract was aliquoted and stored at -80°C. Approximately 300 µl of nuclear extract (1 to 2 mg/ml) were obtained from 10 150-mm plates.

Electrophoretic mobility shift assays (EMSAs). DNA fragments containing US3 sequences from -22 to +1 or -25 to +10 and containing either the tre or a mutant tre were prepared by annealing purified complementary oligonucleotides (oligos) (-22 to +1 wild-type sequences, oligo 115 [5'-TCAAAAACACCGTTCAGTCCACA-3'] and oligo 116 [5'-TGTGGACTGAACGGTGTTTTTGA-3']; -22 to +1 mutant sequences, oligo 117 [5'-TCAAAAACACTGCCCAGTCCACA-3'] and oligo 118 [5'-TGTGGACTGGGCAGTGTTTTTGA-3']; -25 to +10 wild-type sequences, oligo 123 [5'-GATTCAAAAACACCGTTCAGTCCACACGCTACTTC-3'] and oligo 124 [5'-GAAGTAGCGTGTGGACTGAACGGTGTTTTTGAATC-3']; -25 to +10 mutant sequences, oligo 125 [5'-GATTCAAAAACACTGCCCAGTCCACACGCTACTCC-3'] and oligo 126 [5'-GAAGTAGCGTGTGGACTGGGCAGTGTTTTTGAATC-3']). DNA fragments consisting of US3 sequences from -58 to +32 and with a tre or a mutant version were generated by digesting plasmids pBJ171 and pBJ214 (4), respectively, with SnaBI and PstI, followed by gel purification of the DNA fragments. DNA probes were radiolabeled using T4 polynucleotide kinase (New England Biolabs) and [gamma -32P]ATP (3,000 Ci/mmol; New England Nuclear).

Binding reactions were carried out as described by Macias et al. (42). Briefly, 15-µl binding reaction mixtures contained the radiolabeled probe, nuclear extracts, or in vitro translation reaction products and 2 µg of salmon sheared salmon sperm DNA (Gibco-BRL) in binding buffer (25 mM Tris-HCl [pH 8.0], 0.5 mM EDTA, 6.25 mM MgCl2, 0.5 DTT, 9% [vol/vol] glycerol, and 0.01% Nonidet P-40). For the cold competition assays, an excess of nonradioactive DNA fragments was added to the binding reaction mixtures. The protein-DNA complexes were separated from unbound DNA by electrophoresis through 5% polyacrylamide gels (36:1, acrylamide/bisacrylamide ratio) in 0.5× TBE (45 mM Tris-borate [pH 8.3], 1.0 mM EDTA) for 2 h at 200 V at 4°C.

Yeast one-hybrid analysis. Total cellular RNA was prepared from HCMV-infected HDFs at 3 h.p.i.; poly(A)+ RNA was isolated from the total RNA (5 Prime-3 Prime, Inc.) and used as the template for construction of a cDNA library, using the HybriZap 2.1 XR Library Construction kit (Stratagene). The cDNA library contained 2 × 106 independent clones. Mass excision was used to convert the HybriZap library to a pAD-GAL4 library. Saccharomyces cerevisiae YM4271 reporter strains were made that contained an integrated beta -galactosidase reporter gene with either three copies of the tre or three copies of the mutated tre inserted 5' of the reporter gene. To generate the stable yeast cell lines, oligos consisting of three copies of the wild-type tre (oligo 167 [5'-AATT CCAAAAACACCGTTCAGTCCACACGTCAAAAACACCGTTCAGTCCA CACGTCAAAAACACCGTTCAGTCCACACGTCGACGAT-3'] and oligo 168 [5'-CTAGATCGTCGACGTGTGGACTGAACGGTGTTTTTGACG TGTGGACTGAACGGTGTTTTTGACGTGTGGACTGAACGGTGTTT TTG-3') or three copies of the mutant tre (oligo 165 [5'-AATTCAAAAACAC TGCCCAGTCCACACGTCAAAAACACTGCCCAGTCCACACGTCAAAA ACACTGCCCAGTCCACACGTCGACGAT-3'] and oligo 166 [5'-CTAGATC GTCGTCGACGTGTGGACTGGGCAGTGTTTTTGACGTGTGGACTGG GCAGTGTTTTTGACTGTTGGACTGGGCAGTGTTTTTG-3']) were annealed and inserted into the EcoRI and SalI sites of the vector, pLacZi (Matchmaker One Hybrid System; Clontech). The resulting plasmids, pLacZi-TREwt (pBJ339) and pLacZi-TREmut (pBJ338), were linearized and integrated into the genome of S. cerevisiae YM4271 by homologous recombination to obtain the yeast reporter strains YM-TREwt and YM-TREmut. The cDNA library was transformed into YM-TREwt; transformants were screened using beta -galactosidase filter assays to identify positive colonies. Plasmids were isolated from potential positive clones by using the Y-DER Yeast DNA Extraction Reagent Kit (Pierce) and further analyzed for activation of beta -galactosidase activity in the YM-TREmut reporter strain. cDNA inserts from positive colonies were partially sequenced to determine their identity.

Plasmids. UL34 was amplified from genomic HCMV Towne DNA using Pfu polymerase (Stratagene) and primers 218 (5'-CGTCTAGAGAATTCATCATGAACTTCATCATCACC-3') and 219 (5'-CTCGTCGACTTAAATACACAACGGGGTTATGG-3'). The amplimer was inserted into the Zero-Blunt cloning vector (Invitrogen) to generate pBJ374. The eukaryotic UL34 expression construct, pBJ386, was constructed by inserting the XbaI/SalI UL34-containing fragment from pBJ374 into pBJ201 (4). The plasmid pBJ384 was constructed by inserting the EcoRI/SalI UL34-containing fragment from pBJ374 into pBS+ (Stratagene). A plasmid (pBJ507) expressing UL34 as an in-frame fusion with eukaryotic green fluorescent protein (EGFP) was constructed by inserting the EcoRI/SalI fragment from pBJ374 into pEGFP-C2 (Clontech). The mIE protein expression plasmids have been described previously (7), as have pEQ3 (the promoter-less lacZ plasmid), pBJ201 (3), pBJ171 (the US3 promoter-tre reporter gene plasmid), and pBJ214 (4).

In vitro transcription and translation reactions. In vitro transcription and translation reactions were performed using pBJ384 and the TnT7 kit as directed (Promega). Proteins were visualized by autoradiography following electrophoresis on 10% sodium dodecyl sulfate (SDS)-polyacrylamide gels.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Formation of tre-dependent DNA-protein complexes. The requirements for US3 transcriptional repression include a specific DNA element (tre) and protein synthesis following viral infection. These requirements suggested that nuclear proteins present in infected cells interact with the tre to repress US3 transcription. The interaction of nuclear proteins with the tre was examined using EMSAs. Nuclear extracts were prepared from mock-infected HDFs or from HCMV-infected HDFs at 3 h.p.i. US3 transcriptional repression occurs between 3 and 4 h.p.i., suggesting that a repressor protein is present in cells during this time period (3). Radiolabeled double-stranded DNA fragments containing either the repressive element (tre) or a mutated version of the tre (Fig. 1C) were used as probes to assay for binding of the DNA fragments by proteins in the nuclear extracts. Radiolabeled DNA fragments were incubated with the nuclear extracts; the resulting DNA-protein complexes were analyzed on native polyacrylamide gels.

DNA fragments containing the tre and consisting of US3 sequences from -25 to +10, from -22 to +1, or from -58 to +32 were all able to form a unique DNA-protein complex in the presence of nuclear extracts prepared from infected cells (Fig. 1A, lanes 3, 5, and 7 respectively). Radiolabeled DNA probes (-25 to +10 or -22 to +1) that contained a mutant tre (Fig. 1C) (5) were unable to form similar DNA-protein complexes (Fig. 1A, lanes 4 and 6). The largest DNA fragment (consisting of sequences from -58 to +32) formed a tre-dependent DNA-protein complex and an additional DNA-protein complex that was independent of the presence of a functional tre (Fig. 1A, lanes 7 and 8). This additional DNA-protein complex is presumed to result from the interaction of the DNA probe with other DNA-binding proteins such as CREB, c-rel, or TBP, binding sites for which are predicted in this region by TFSEARCH (26). Extracts prepared from mock-infected cells were unable to form a DNA-protein complex with DNA fragments containing either the tre or the mutant version of the tre (Fig. 1A, lanes 1 and 2, sequences from -25 to +10). The DNA-protein complexes formed with the two smaller DNA probes (-22 to +1 and -25 to +10) had similar rates of migration despite the difference in size between the DNA probes. The similarity in migration rates of the complexes suggests that protein binding to the tre is causing the DNA fragments to bend, or alternatively, that the electrophoretic charge of the bound protein(s) is the major determinant of the mobility of the complex, a result similar to the results seen in mobility shifts of GCN4-DNA complexes (20).


View larger version (55K):
[in this window]
[in a new window]
  		FIG. 1.   Electrophoretic mobility shift assays. (A) Double-stranded radiolabeled DNA fragments containing either a tre (w) or a mutant version of the tre (m) were used to assay for specific DNA-binding proteins in nuclear extracts prepared from mock-infected (mock) or HCMV-infected (infected) HDFs. Lanes 1 to 4, US3 sequences from -25 to +10; lanes 5 to 6, sequences from -22 to +1; lanes 7 and 8, sequences from -58 to +32. (B) Specificity of DNA-protein interactions. Competition experiments were performed, using nuclear extracts from infected HDFs and adding either no competitor (lane 9) or a 100-fold molar excess of unlabeled DNA fragments containing the US3 tre (wt tre, lane 10), the mIE crs (crs, lane 11), or the mutant version of the tre (m tre, lane 12) to the DNA-protein binding reactions prior to addition of the radiolabeled tre-containing fragment. Arrows, specific DNA-protein interactions; *, unbound probe; dash, tre-independent DNA-protein interaction. (C) Sequence of the US3 regulatory region; the tre is underlined, the TATA box is indicated by a rectangle, nucleotide substitutions that create a nonfunctional tre (5) are indicated by asterisks. The locations of the -22 to +1, -25 to +10, and -58 to +32 probes are indicated; the bent arrow indicates the transcription start site.

The specificity of the DNA-protein interactions was analyzed in competition assays by adding an excess of DNA fragments that contained the tre, consisted of a mutant tre, or contained the mIE crs. A 100-fold molar excess of unlabeled competitor DNA fragments was added to the nuclear extracts from infected cells prior to incubation with the radiolabeled DNA probe composed of the US3 tre (-22 to +1). As depicted in Fig. 1A, in the absence of competitor the tre-containing probe was able to form a specific DNA-protein complex (Fig. 1B, lane 9). Excess unlabeled DNA fragments containing the tre were able to compete with the radiolabeled probe for protein binding (Fig. 1B, compare lanes 9 and 10). However, DNA fragments containing the mIE crs or the mutant version of the tre were unable to compete for protein binding (Fig. 1B, lanes 11 and 12). Competition by the unlabeled tre-containing DNA fragment for protein binding coupled with the inability of the mutant tre or the mIE crs fragments to compete for protein binding demonstrated the specific nature of the DNA-protein interaction. Although the tre-containing DNA fragments competed with the radiolabeled tre probe for protein binding (Fig. 1B, lane 10), the competition was not 100% at the ratio of DNA to protein used. The lack of complete competition suggests that the protein(s) present in the DNA-protein complex has a relatively weak binding affinity for the DNA fragment in vitro, a feature associated with rapid modulation of protein binding (32). The inability of the mIE crs to compete with the tre for protein binding suggests that the two DNA elements interact with different proteins and correlates with the inability of IE2 to repress US3 expression (5).

These experiments demonstrated that a specific DNA-protein complex forms on the tre. Mutations that functionally inactivated the tre (5) prevented formation of tre-specific DNA-protein complexes (Fig. 1A). The protein(s) needed for DNA-protein complex formation were only present in nuclear extracts prepared from infected cells, suggesting that the DNA-binding protein(s) was either a viral protein or, alternatively, a cellular protein whose synthesis or activity was altered as a result of viral infection.

Identification of a tre-binding protein. To identify proteins binding to the tre, the yeast one-hybrid system was utilized (18). For these experiments, a cDNA expression library was constructed from poly(A)+ RNA isolated from infected human diploid fibroblasts at 3 h.p.i., such that cDNAs were expressed as GAL4 activation domain (GAL4 AD) fusion proteins in recipient yeast cells. The GAL4 AD-cDNA library was transformed into a S. cerevisiae yeast strain (YM-TRE-wt) that contained three copies of the tre inserted 5' of the promoter for the lacZ gene. Approximately 7 × 106 yeast transformants were screened for elevated levels of beta -galactosidase using filter lift assays. From the library screen, two yeast colonies were identified that expressed elevated levels of beta -galactosidase activity within 1 h of incubation with the substrate, X-Gal (5-bromo-4-chloro-3-indolyl-beta -D-galactopyranoside). The GAL4 AD-cDNA plasmids were isolated from the positive yeast colonies and introduced into a yeast strain that contained three copies of the mutant tre (YM-TREmut). The GAL4 AD-cDNA plasmids failed to induce lacZ expression in the YM-TREmut yeast strain, demonstrating that the proteins encoded by the cDNAs were able to specifically bind to the tre.

The cDNAs present in the GAL4 AD-cDNA plasmids were partially sequenced. The first plasmid isolate contained HCMV sequences from nucleotides 44797 to 46039; the second plasmid isolate contained HCMV sequences from 44815 to 46044 (nucleotide numbers correspond to the sequence of HCMV AD169 [12]). This region of the HCMV genome is contained within the predicted UL34 open reading frame. In both plasmid isolates, the predicted UL34 open reading frame was inserted into the expression plasmid in frame with the activation domain of GAL4. The ATG at positions 44791 to 44793 is predicted to serve as the translation initiation codon for the UL34 mRNA (61); isolation of UL34 cDNAs with 5' ends close to the proposed translation initiation codon supports this prediction. Northern blot analysis confirmed that UL34 transcripts are present early in infection (data not shown). Thus, the HCMV UL34 gene is transcribed early in infection and encodes a protein capable of binding to the US3 tre in yeast. These data suggested that the protein encoded by UL34 (pUL34) is potentially capable of acting as a transcriptional repressor.

DNA-binding activity of UL34. The protein encoded by the HCMV UL34 gene, pUL34, functioned as a sequence-specific DNA-binding protein in the yeast one-hybrid system. To confirm and extend the results seen with the yeast one-hybrid system, EMSAs were performed using a radiolabeled tre-containing DNA fragment (sequences from -22 to +1, Fig. 1C) and in vitro-synthesized UL34 protein. The UL34 protein was synthesized by transcribing and translating the UL34 open reading frame in vitro in the presence of [35S]methionine. The translation products were analyzed by SDS-polyacrylamide gel electrophoresis, demonstrating the synthesis of an ~49-kDa UL34 protein (Fig. 2A, lane 1). A control plasmid that contained the luciferase open reading frame was also transcribed and translated (Fig. 2A, lane 2). The in vitro-synthesized proteins were assayed for the ability to bind to tre by using EMSAs as described in Fig. 1. The addition of in vitro-synthesized pUL34 to a radiolabeled DNA fragment containing the tre (sequences from -22 to +1) resulted in the formation of a DNA-protein complex (Fig. 2B, lanes 6 and 7). Increasing the amount of translation product increased the amount of DNA-protein complexes formed (Fig. 2B, compare lanes 6 and 7) and resulted in the formation of an additional minor DNA-protein complex. This minor complex may be a result of incomplete pUL34 translation products or pUL34 degradation products interacting with the DNA probe. In vitro-synthesized luciferase protein was unable to form a DNA-protein complex, demonstrating that the complex formed in the presence of pUL34 was specific (Fig. 2B, compare lanes 5 and 6).


View larger version (36K):
[in this window]
[in a new window]
  		FIG. 2.   (A) SDS-polyacrylamide gel electrophoresis of the in vitro-synthesized pUL34 and luciferase proteins. Lane 1, 5 µl of the in vitro translation reaction utilizing the UL34-encoding plasmid; lane 2, 5 µl of the translation reaction utilizing the luciferase-encoding (luc) plasmid; lane 3, control reaction containing no template plasmid. The positions of the molecular weight markers are indicated. (B) EMSA analysis of in vitro-synthesized pUL34. The radiolabeled double-stranded DNA probe used in lanes 1 to 8 consisted of a tre-containing fragment (-22 to +1, see Fig. 1C), while the probe in lanes 9 to 10 contained a mutant version of the tre. The proteins incubated with the DNA probes are as follows: lane 1, infected cell extracts (Inf.); lane 2, extracts from mock-infected cells supplemented with 1 µl of the in vitro-translated pUL34 (M+UL34); lane 3, 1 µl of the in vitro-translated pUL34 preincubated with a 200× molar excess of unlabeled tre-containing US3 sequences from +1 to -22 (competitor, c); lane 4, no protein; lane 5, 1 µl of the in vitro-translated luciferase protein (luc); lane 6, 1 µl of the in vitro-translated pUL34; lane 7, 5 µl of the in vitro-translated pUL34; lane 8, extracts from mock-infected cells (Mock); lane 9, no protein; and lane 10, 1 µl of the in vitro-translated pUL34. Arrow, specific DNA-protein interaction.

A competition experiment was performed as described above, analyzing the ability of unlabeled tre fragments to compete for pUL34 binding. Addition of a 200-fold molar excess of unlabeled tre-containing DNA prevented the formation of a detectable DNA-protein complex, demonstrating that the DNA-protein interactions are specific for the tre (Fig. 2B, lane 3). Extracts prepared from infected cells formed a DNA-protein complex similar to that seen with pUL34 alone (Fig. 2B, lane 1), while extracts from mock-infected cells were unable to form a complex with the tre-containing DNA fragment (Fig. 2B, lane 8). Supplementation of extracts prepared from mock-infected cells with the in vitro-translated pUL34 resulted in the formation of a DNA-protein complex similar to that seen in the presence of infected cell extracts (Fig. 2B, lane 2). In vitro-synthesized pUL34 was unable to bind to a mutant version of the tre (Fig. 2B, lane 10). These experiments confirmed the results obtained with the yeast-one hybrid system, and establish pUL34 as a site-specific DNA-binding protein.

Localization of pUL34. As a DNA-binding protein, pUL34 was predicted to localize to the nucleus of cells. Amino acid analysis identified three potential nuclear localization signals within the UL34 open reading frame (analysis by PSORT [47]). Classical nuclear localization signals were detected at amino acid positions 300 and 306 (see reference 29 for a review), and a potential bipartite nuclear localization signal was predicted beginning at amino acid 60 (51). To determine if pUL34 localizes to the nucleus, a plasmid expressing an EFGP-UL34 fusion protein was transfected into HDFs. The parental plasmid (pEGFP-C2) was also transfected into HDFs as a control. Nuclei were stained with DAPI (4',6'-diamidino-2-phenylindole); cells were observed for green (EGFP or EGFP-UL34) and blue (nuclei) fluorescence. As illustrated in Fig. 3A and B, expression of EGFP alone resulted in an intracellular pattern of widely distributed bright green fluorescence with the nuclei fluorescing blue. The expression of the EGFP-UL34 protein resulted in the localization of the green fluorescence to the nuclei of transfected cells (Fig. 3D and F) with the green fluorescence colocalizing with DAPI-stained nuclei (Fig. 3C and E). These data demonstrated that pUL34 localizes to the nucleus, consistent with its ability to bind DNA and its predicted function as a transcriptional repressor.


View larger version (53K):
[in this window]
[in a new window]
  		FIG. 3.   Micrographs of HDFs transfected with pEGFP-C2 (A and B) or pBJ507 (which expresses an EGFP-UL34 fusion protein) (C, D, E, and F). Cells were stained with DAPI and visualized with UV and FITC filters (×400 magnification). Panels A, C, and E, DAPI staining; panels B, D, and F, GFP fluorescence. Arrows indicate the positions of the transfected cells.

UL34 repression of US3 transcription. The interaction of pUL34 with the tre in the yeast one-hybrid system and in EMSAs suggested that pUL34 was involved in transcriptional repression of the US3 gene. To examine the effect of pUL34 on US3 gene expression, a transient-expression system was utilized. Reporter gene plasmids expressing the lacZ gene under the control of the US3 promoter and tre (pBJ171 [3]) or the US3 promoter and a mutant version of the tre (pBJ214 [4]) were transfected into HDFs either alone or in combination with plasmids expressing IE1, IE2, IE1 and IE2, and pUL34. The transcriptional activators IE1 and IE2 were used in these assays to increase US3-regulated beta -galactosidase expression to easily detectable levels. The levels of beta -galactosidase activity were assayed by adding media containing the beta -galactosidase substrate, methylumbelliferyl-beta -D-galactoside (MUG), to the transfected cells and then measuring the fluorescence of the MUG cleavage product. Expression of UL34 alone repressed transcription from the US3 promoter in a tre-dependent fashion (Fig. 4A). Expression of pUL34 repressed IE1, IE2, or IE1-IE2 activation of the US3 promoter in the presence of the wild-type tre (Fig. 4A). In contrast, mutational inactivation of the tre prevented pUL34 repression of US3 expression. pUL34-mediated transcriptional repression of the tre+ reporter gene plasmid was similar to that seen following viral infection (Fig. 4B) (4). Both tre+ and tre mutant reporter gene constructs were expressed to similar levels following cotransfection with the IE1 and IE2 expression plasmids, demonstrating that the repressive effect was specific for pUL34 (data is not shown) (4). Cotransfection of an expression plasmid containing an inverted UL34 open reading frame resulted in similar levels of reporter gene activity for the tre+ and tre mutant reporter gene constructs (data not shown), demonstrating a requirement for the UL34 open reading frame for transcriptional repression. Furthermore, transcriptional repression by UL34 was independent of IE2, confirming earlier observations about the lack of IE2 involvement in US3 repression (4).


View larger version (26K):
[in this window]
[in a new window]
  		FIG. 4.   Analysis of the effect of pUL34 on US3 transcription. Reporter gene plasmids that express the lacZ gene under the control of the US3 enhancer and promoter and contain either the tre (pBJ171, open columns) or a mutant version of the tre (pBJ214, crosshatched columns) were transfected into HDFs alone or with plasmids that express IE1 (pEQ273), IE2 (pEQ326), or IE1 and IE2 proteins (pEQ276) or pUL34 (pBJ386) as indicated. Reporter gene activity was assayed ~36 h after transfection, by measuring the fluorescence of the cleavage product of the beta -galactosidase substrate, MUG. The amount of plasmid DNA was kept constant in the transfections by adding the appropriate amount of a control plasmid, pBJ201, which contains the mIE promoter but expresses no protein (4). Background levels of beta -galactosidase obtained with a promoterless lacZ-containing plasmid, pEQ3, were subtracted from the values obtained with pBJ171 and pBJ214. (A) pUL34 repression of US3 expression. The data presented are the averages of duplicate transfections plus one standard deviation. (B) Comparison of the repressive effect of infection with the repressive effect of pUL34 on IE1 and IE2 activation of the US3 promoter and tre.

Although the overall effects of pUL34 repression were similar for all combinations of transcriptional factors tested (Fig. 4), the level of gene expression was influenced by the presence of the transcriptional activators, IE1 and IE2. This suggests that there is a balance between activation and repression that ultimately determines the level of gene expression.


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

These studies have identified a novel transcriptional repressor and correspondingly have defined a function for the predicted UL34 open reading frame of the HCMV genome. The protein encoded by the UL34 open reading frame, pUL34, bound specifically to the tre of the US3 gene. Three nucleotide substitutions within the tre that result in a loss of transcriptional repression (5) prevented pUL34 DNA binding. Furthermore, pUL34 alone was sufficient for repression of US3 expression. pUL34 DNA-binding correlates directly with repression of US3 expression. The mechanism by which pUL34 represses US3 transcription is unknown, however, in vivo footprinting of the US3 promoter suggests that transcriptional repression results from a block in formation of the preinitiation complex (5). Thus, pUL34 binding to the tre may prevent formation of the preinitiation complex, possibly through interactions with general transcription factors such as TFIID or TFIIB.

Other than the studies reported here, very little is known about the UL34 gene. The UL34 gene is conserved among the cytomegaloviruses and a homolog has been identified in mouse, rat, and guinea pig cytomegaloviruses (49, 60; Y. Liu and B. J. Biegalke, unpublished data). Other than the cytomegalovirus homologs, pUL34 shares no clear similarity with proteins encoded by sequences in GenBank (BLAST analysis). The predicted UL34 protein contains a basic NH2-terminal end and an acidic COOH-terminal end, which is suggestive of functional structural domains similar to those of other transcription factors such as GAL4.

The repression of gene expression by protein binding to a DNA element located between the TATA box and the transcription start site is a relatively common scheme for regulating herpesvirus gene expression. In addition to repression mediated by pUL34, ICP4 of herpes simplex virus and the IE2 protein of HCMV act as autoregulatory transcriptional repressors, binding to sequences located between the TATA box and the transcription start site and downregulating their own expression (9, 13, 34, 37, 38, 38, 43, 45, 48, 50). Although the mechanisms by which ICP4 and IE2 repress their own expression are not completely understood, IE2 blocks the recruitment of RNA polymerase II to the preinitiation complex, and ICP4 interferes with the formation of transcription initiation complexes (23, 36, 63). In addition to their repressive effects, ICP4 and IE2 play essential roles in activating the expression of viral genes. Both ICP4 and IE2 interact with a number of cellular proteins that are involved in transcriptional regulation; these interactions may also contribute to their repressive effects (9, 10, 19, 22, 24, 31, 33, 40, 41, 53-56).

Although the DNA-binding and transcriptional repressive activities of pUL34 were identified through analysis of the US3 gene, there are several additional potential pUL34 binding sites located throughout the HCMV genome. The frequency of potential binding sites suggests that pUL34 may have other roles in the virus life cycle, along with its role in repressing US3 transcription. Potential pUL34 binding sites are located both 5' and 3' of predicted promoter regions, suggesting that pUL34 may function to activate as well as repress transcription, depending on the position of the protein binding site. Intriguingly, potential pUL34 binding sites are also located in regions adjacent to the origin for lytic replication of the HCMV genome (2, 25, 44). This raises the possibility that pUL34 functions indirectly in DNA replication, perhaps by altering transcription in the region of the lytic origin of replication.

Identification of pUL34 as a transcriptional regulatory protein extends the growing list of transcription factors encoded by the herpesviruses. These studies provide the first identification of an HCMV-encoded sequence-specific DNA-binding protein that mediates transcriptional repression of another HCMV gene (the US3 gene) through a defined protein-binding site. The mechanism of pUL34-mediated transcriptional repression has yet to be resolved. The potential involvement of pUL34 in the virus life cycle, particularly during latency, is an exciting possibility that remains to be investigated.


    ACKNOWLEDGMENTS

We thank John Price for technical assistance, Mark Berryman for assistance with microscopy, Adam Geballe for pEQ plasmids, and Frank Horodyski for critical reading of the manuscript.

This work was supported in part by Council of Tobacco Research grant 4740 to B.J.B. and a College of Osteopathic Medicine postdoctoral fellowship to L.A.L.


    FOOTNOTES

* Corresponding author. Mailing address: Department of Biomedical Sciences, 228 Irvine Hall, Ohio University, Athens, OH 45701. Phone: (740) 593-2377. Fax: (740) 597-2778. E-mail: biegalke{at}ohiou.edu.

dagger Present address: Department of Biological Sciences, Ohio University, Athens, OH 45701.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Ahn, K., A. Angulo, P. Ghazal, P. A. Peterson, Y. Yang, and K. Fruh. 1996. Human cytomegalovirus inhibits antigen presentation by a sequential multistep process. Proc. Natl. Acad. Sci. USA 93:10990-10995[Abstract/Free Full Text].
2. Anders, D. G., M. A. Kacica, G. S. Pari, and S. M. Punturieri. 1992. Boundaries and structure of human cytomegalovirus oriLyt, a complex origin for lytic-phase DNA replication. J. Virol. 66:3373-3384[Abstract/Free Full Text].
3. Biegalke, B. J. 1995. Regulation of human cytomegalovirus US3 gene transcription by a cis-repressive sequence. J. Virol. 69:5362-5367[Abstract].
4. Biegalke, B. J. 1997. IE2 protein is insufficient for transcriptional repression of the human cytomegalovirus US3 promoter. J. Virol. 71:8056-8060[Abstract].
5. Biegalke, B. J. 1998. Characterization of the transcriptional repressive element of the human cytomegalovirus immediate-early US3 gene. J. Virol. 72:5457-5463[Abstract/Free Full Text].
6. Biegalke, B. J. 1999. Human cytomegalovirus US3 gene expression is regulated by a complex network of positive and negative regulators. Virology 261:155-164[CrossRef][Medline].
7. Biegalke, B. J., and A. P. Geballe. 1991. Sequence requirements for activation of the HIV-1 LTR by human cytomegalovirus. Virology 183:381-385[CrossRef][Medline].
8. Britt, W. J., and C. A. Alford. 1996. Cytomegalovirus, p. 2493-2524. In B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology, 3rd ed. Lippincott-Raven Publishers, Philadelphia, Pa.
9. Carrozza, M. J., and N. A. Deluca. 1996. Interaction of the viral activator protein ICP4 with TFIID through TAF250. Mol. Cell. Biol. 16:3085-3093[Abstract].
10. Caswell, R., L. Bryant, and J. Sinclair. 1996. Human cytomegalovirus immediate-early 2 (IE2) protein can transactivate the human hsp70 promoter by alleviation of Dr1-mediated repression. J. Virol. 70:4028-4037[Abstract].
11. Chan, Y. J., W. P. Tseng, and G. S. Hayward. 1996. Two distinct upstream regulatory domains containing multicopy cellular transcription factor binding sites provide basal repression and inducible enhancer characteristics to the immediate-early IES (US3) promoter from human cytomegalovirus. J. Virol. 70:5312-5328[Abstract/Free Full Text].
12. Chee, M. S., A. T. Bankier, S. Beck, R. Bohni, C. M. Brown, R. Cerny, T. Horsnell, C. A. Hutchison III, T. Kouzarides, J. A. Martignetti, E. Preddie, S. C. Satchwell, P. Tomlinson, K. M. Weston, and B. G. Barrell. 1990. Analysis of the protein-coding content of the sequence of human cytomegalovirus strain AD169. Curr. Top. Microbiol. Immunol. 154:125-170[Medline].
13. Cherrington, J. M., E. L. Khoury, and E. S. Mocarski. 1991. Human cytomegalovirus IE2 negatively regulates alpha  gene expression via a short target sequence near the transcription start site. J. Virol. 65:887-896[Abstract/Free Full Text].
14. Colberg-Poley, A. M. 1996. Functional roles of immediate early proteins encoded by the human cytomegalovirus UL36-38, UL115-119, TRS1/IRS1 and US3 loci. Intervirology 39:350-360[Medline].
15. Colberg-Poley, A. M., L. Huang, V. E. Soltero, A. C. Iskenderian, R. F. Schumacher, and D. G. Anders. 1998. The acidic domain of pUL37×1 and gpUL37 plays a key role in transactivation of HCMV DNA replication gene promoters. Virology 246:400-408[CrossRef][Medline].
16. Colberg-Poley, A. M., L. D. Santomenna, P. P. Harlow, P. A. Benfield, and D. J. Tenney. 1992. Human cytomegalovirus US3 and UL36-38 immediate-early proteins regulate gene expression. J. Virol. 66:95-105[Abstract/Free Full Text].
17. Dignam, J. D., R. M. Lebovits, and R. G. Roeder. 1983. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11:1475-1489[Abstract/Free Full Text].
18. Fields, S., and O. Song. 1989. A novel genetic system to detect protein-protein interactions. Nature 340:245-246[CrossRef][Medline].
19. Furnari, B. A., E. Poma, T. F. Kowalik, S. M. Huong, and E. S. Huang. 1993. Human cytomegalovirus immediate-early gene 2 protein interacts with itself and with several novel cellular proteins. J. Virol. 67:4981-4991[Abstract/Free Full Text].
20. Gartenberg, M. R., C. Ampe, T. Steitz, and D. M. Crothers. 1990. Molecular characterization of the GCN4-DNA complex. Proc. Nat. Acad. Sci. USA 87:6034-6038[Abstract/Free Full Text].
21. Gebert, S., S. Schmolke, G. Sorg, S. Flöss, B. Plachter, and T. Stamminger. 1997. The UL84 protein of human cytomegalovirus acts as a transdominant inhibitor of immediate-early-mediated transactivation that is able to prevent viral replication. J. Virol. 71:7048-7060[Abstract].
22. Grondin, B., and N. DeLuca. 2000. Herpes simplex virus type 1 ICP4 promotes transcription preinitiation complex formation by enhancing the binding of TFIID to DNA. J. Virol. 74:11504-11510[Abstract/Free Full Text].
23. Gu, B., R. Kuddus, and N. A. Deluca. 1995. Repression of activator-mediated transcription by herpes simplex virus ICP4 via a mechanism involving interactions with the basal transcription factors TATA-binding protein and TFIIB. Mol. Cell. Biol. 15:3618-3626[Abstract].
24. Hagemeier, C., S. Walker, R. Caswell, T. Kouzarides, and J. Sinclair. 1992. The human cytomegalovirus 80-kilodalton but not the 72-kilodalton immediate-early protein transactivates heterologous promoters in a TATA box-dependent mechanism and interacts directly with TFIID. J. Virol. 66:4452-4456[Abstract/Free Full Text].
25. Hamzeh, R. M., P. S. Lietman, W. Gibson, and G. Hayward. 1990. Identification of the lytic origin of DNA replication in human cytomegalovirus by a novel approach utilizing ganciclovir-induced chain termination. J. Virol. 64:6184-6195[Abstract/Free Full Text].
26. Heinemeyer, T., E. Wingender, I. Reuter, H. Hermjakob, A. E. Kel, O. V. Kel, E. V. Ignatieva, E. A. Ananko, O. A. Podkolodnaya, F. A. Kolpakov, N. L. Podkolodny, and N. A. Kolchanov. 1998. Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL. Nucleic Acids Res. 26:362-367[Abstract/Free Full Text].
27. Hengel, H., W. Brune, and U. H. Koszinowski. 1998. Immune evasion by cytomegalovirus---survival strategies of a highly adapted opportunist. Trends Microbiol. 6:190-197[CrossRef][Medline].
28. Hermiston, T. W., C. L. Malone, and M. F. Stinski. 1990. Human cytomegalovirus immediate-early two protein region involved in negative regulation of the major immediate-early promoter. J. Virol. 64:3532-3536[Abstract/Free Full Text].
29. Hicks, G. R., and N. V. Raikhel. 1995. Protein import into the nucleus: an integrated view. Annu. Rev. Cell Dev. Biol. 11:155-188[CrossRef][Medline].
30. Jones, T. R., E. J. H. J. Wiertz, L. Sun, K. N. Fish, J. A. Nelson, and H. L. Ploegh. 1996. Human cytomegalovirus US3 impairs transport and maturation of major histocompatibility complex class I heavy chains. Proc. Natl. Acad. Sci. USA 93:11327-11333[Abstract/Free Full Text].
31. Jupp, R., S. Hoffman, R. M. Stenberg, J. A. Nelson, and P. Ghazal. 1993. Human cytomegalovirus IE86 protein interacts with the promoter-bound TATA-binding protein via a specific region distrinct from the autorepression domain. J. Virol. 67:7539-7546[Abstract/Free Full Text].
32. Kay, B. K., M. P. Williamson, and M. Sudol. 2000. The importance of being proline: the intearctin of proline-rich motifs in signaling proteins with their cognate domains. FASEB J. 14:231-241[Abstract/Free Full Text].
33. Lang, D., S. Gebert, H. Arlt, and T. Stamminger. 1995. Functional interaction between the human cytomegalovirus 86-kilodalton IE2 protein and the cellular transcription factor CREB. J. Virol. 69:6030-6037[Abstract].
34. Lang, D., and T. Stamminger. 1993. The 86-kilodalton IE-2 protein of human cytomegalovirus is a sequence-specific DNA-binding protein that interacts directly with the negative autoregulatory response element located near the cap site of the IE-1/2 enhancer-promoter. J. Virol. 67:323-331[Abstract/Free Full Text].
35. Lashmit, P. E., M. F. Stinski, E. A. Murphy, and G. C. Bullock. 1998. A cis-repression sequence adjacent to the transcription start site of the human cytomegalovirus US3 gene is required to down regulate gene expression at early and late times after infection. J. Virol. 72:9575-9584[Abstract/Free Full Text].
36. Lee, G., J. Wu, P. Luu, P. Ghazal, and O. Flores. 1998. Inhibition of the association of RNA polymerase II with the preinitiation complex by a viral transcriptional repressor. Proc. Natl. Acad. Sci. USA 93:2570-2575[Abstract/Free Full Text].
37. Leopardi, R., N. Michael, and B. Roizman. 1995. Repression of the herpes simplex virus 1 alpha 4 gene by its gene product (ICP4) within the context of the viral genome is conditioned by the distance and stereoaxial alignment of the ICP4 DNA binding site relative to the TATA box. J. Virol. 69:3042-3048[Abstract].
38. Liu, B., T. W. Hermiston, and M. F. Stinski. 1991. A cis-acting element in the major immediate-early (IE) promoter of human cytomegalovirus is required for negative regulation by IE2. J. Virol. 65:897-903[Abstract/Free Full Text].
39. Liu, B., and M. F. Stinski. 1992. Human cytomegalovirus contains a tegument protein that enhances transcription from promoters with upstream ATF and Ap-1 cis-acting elements. J. Virol. 66:4434-4444[Abstract/Free Full Text].
40. Lukac, D. M., N. Y. Harel, N. Tanese, and J. C. Alwine. 1997. TAF-like functions of human cytomegalovirus immediate-early proteins. J. Virol. 71:7227-7239[Abstract].
41. Lukac, D. M., J. R. Manuppello, and J. C. Alwine. 1994. Transcriptional activation by the human cytomegalovirus immediate-early proteins: requirements for simple promoter structures and interactions with multiple components of the transcription complex. J. Virol. 68:5184-5193[Abstract/Free Full Text].
42. Macias, M. P., L. Huang, P. E. Lashnit, and M. F. Stinski. 1996. Cellular or viral protein binding to a cytomegalovirus promoter transcription initiation site: effects on transcription. J. Virol. 70:3628-3635[Abstract].
43. Macias, M. P., and M. F. Stinski. 1993. An in vitro system for human cytomegalovirus immediate early 2 protein (IE2)-mediated site-dependent repression of transcription and direct binding of IE2 to the major immediate early promoter. Proc. Natl. Acad. Sci. USA 90:707-711[Abstract/Free Full Text].
44. Masse, M. J. O., S. Karlin, G. A. Schachtel, and E. S. Mocarski. 1992. Human cytomegalovirus origin of DNA replication (oriLyt) resides within a highly complex repetitive region. Proc. Natl. Acad. Sci. USA 89:5246-5250[Abstract/Free Full Text].
45. Michael, N., and B. Roizman. 1993. Repression of the herpes simplex virus 1 alpha4 gene by its gene product occurs within the context of the viral genome and is associated with all three identified cognate sites. Proc. Natl. Acad. Sci. USA 90:2286-2290[Abstract/Free Full Text].
46. Mocarski, E. S. 1996. Cytomegaloviruses and their replication, p. 2447-2492. In B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields Virology, 3rd ed. Lippincott-Raven Publishers, Philadephia, Pa.
47. Nakai, K., and M. Kanhisa. 1992. A knowledge base for predicting protein localization sites in eukaryotic cells. Genomics 14:897-911[CrossRef][Medline].
48. Pizzorno, M. C., and G. S. Hayward. 1990. The IE2 gene products of human cytomegalovirus specifically down-regulate expression from the major immediate-early promoter through a target sequence located near the cap site. J. Virol. 64:6154-6165[Abstract/Free Full Text].
49. Rawlinson, W. D., H. E. Farrell, and B. G. Barrell. 1996. Analysis of the complete DNA sequence of murine cytomegalovirus. J. Virol. 70:8833-8849[Abstract].
50. Rivera-Gonzalez, R., A. N. Imbalzano, B. Gu, and N. A. Deluca. 1994. The role of ICP4 repressor activity in temporal expression of the IE-3 and latency-associated transcript promoters during HSV-1 infection. Virology 202:550-564[CrossRef][Medline].
51. Robbins, J., S. M. Dilworth, R. A. Laskey, and C. Dingwall. 1991. Two interdependent basic domains in nucleoplasmin nuclear targeting sequence: identification of a class of bipartite nuclear targeting sequence. Cell 64:615-623[CrossRef][Medline].
52. Romanowski, M. J., E. Garrido-Guerrero, and T. Shenk. 1997. pIRS1 and pTRS1 are present in human cytomegalovirus virions. J. Virol. 71:5703-5705[Abstract].
53. Schwartz, R., B. Helmich, and D. H. Spector. 1996. CREB and CREB-binding proteins play an important role in the IE2 86-kilodalton protein-mediated transactivation of the human cytomegalovirus 2.2-kilobase RNA promoter. J. Virol. 70:6955-6966[Abstract/Free Full Text].
54. Smith, C. A., P. Bates, R. Rivera-Gonzalez, B. Gu, and N. DeLuca. 1993. ICP4, the major transcriptional regulatory protein of herpes simplex virus type 1, forms a tripartite complex with TATA-binding protein and TFIIB. J. Virol. 67:4676-4687[Abstract/Free Full Text].
55. Sommer, M. H., A. L. Scully, and D. H. Spector. 1994. Transactivation by the human cytomegalovirus IE2 86-kilodalton protein requires a domain that binds to both the TATA box-binding protein and the retinoblastoma protein. J. Virol. 68:6223-6231[Abstract/Free Full Text].
56. Speir, E., R. Modali, E.-S. Huang, M. B. Leon, F. Shawl, T. Finkel, and S. E. Epstein. 1994. Potential role of human cytomegalovirus and p53 interaction in coronary restenosis. Science 265:391-394[Abstract/Free Full Text].
57. Stenberg, R. M. 1996. The human cytomegalovirus major immediate-early gene. Intervirology 39:343-349[Medline].
58. Tenney, D. J., L. D. Santomenna, K. B. Goudie, and A. M. Colberg-Poley. 1993. The human cytomegalovirus US3 immediate-early protein lacking the putative transmembrane domain regulates gene expression. Nucleic Acids Res. 21:2931-2937[Abstract/Free Full Text].
59. Thrower, A. R., G. C. Bullock, J. E. Bissell, and M. F. Stinski. 1996. Regulation of a human cytomegalovirus immediate-early gene (US3) by a silencer-enhancer combination. J. Virol. 70:91-100[Abstract].
60. Vink, C., E. Beuken, and C. A. Bruggeman. 2000. Complete DNA sequence of the rat cytomegalovirus genome. J. Virol. 74:7656-7665[Abstract/Free Full Text].
61. Welch, R. W., L. M. McGregor, and W. Gibson. 1991. Cytomegalovirus homologs of cellular G protein-coupled receptor genes are transcribed. J. Virol. 65:3915-3918[Abstract/Free Full Text].
62. Weston, K. 1988. An enhancer element in the short unique region of human cytomegalovirus regulates the production of a group of abundant immediate-early transcripts. Virology 162:406-416[CrossRef][Medline].
63. Wu, J., R. Jupp, R. M. Stenberg, J. A. Nelson, and P. Ghazal. 1993. Site-specific inhibition of RNA polymerase II preinitiation complex assembly by human cytomegalovirus IE86 protein. J. Virol. 67:7547-7555[Abstract/Free Full Text].

Journal of Virology, July 2001, p. 6062-6069, Vol. 75, No. 13
0022-538X/01/$04.00+0   DOI: 10.1128/JVI.75.13.6062-6069.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.


This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by LaPierre, L. A.
Right arrow Articles by Biegalke, B. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by LaPierre, L. A.
Right arrow Articles by Biegalke, B. J.

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. Mol. Cell. Biol. Microbiol. Mol. Biol. Rev.
Clin. Vaccine Immunol. ALL ASM JOURNALS