Department of Pathobiological Sciences,
School of Veterinary Medicine, University of Wisconsin-Madison,
Madison, Wisconsin 53706,1 and
Department of Disease Control, Graduate School of Veterinary
Medicine, Hokkaido University, Sapporo
060-0818,2 and Institute of Medical
Science, University of Tokyo, Minato-ku, Tokyo
108-8639,3 Japan
Ion channel proteins are common constituents of cells and have even
been identified in some viruses. For example, the M2 protein of
influenza A virus has proton ion channel activity that is thought to
play an important role in viral replication. Because direct support for
this function is lacking, we attempted to generate viruses with
defective M2 ion channel activity. Unexpectedly, mutants with apparent
loss of M2 ion channel activity by an in vitro assay replicated as
efficiently as the wild-type virus in cell culture. We also generated a
chimeric mutant containing an M2 protein whose transmembrane domain was
replaced with that from the hemagglutinin glycoprotein. This virus
replicated reasonably well in cell culture but showed no growth in
mice. Finally, a mutant lacking both the transmembrane and cytoplasmic
domains of M2 protein grew poorly in cell culture and showed no growth in mice. Thus, influenza A virus can undergo multiple cycles of replication without the M2 transmembrane domain responsible for ion
channel activity, although this activity promotes efficient viral replication.
 |
INTRODUCTION |
Cell membranes consist of a double
layer of lipid molecules in which various proteins are embedded.
Because of its hydrophobic interior, the lipid bilayer of a cell
membrane serves as a barrier to the passage of most polar molecules and
therefore is crucial to cell viability. To facilitate the transport of
small water-soluble molecules into and out of cells and intracellular
compartments, such membranes possess carrier and channel proteins. Ion
channels are essential for many cellular functions, including the
electrical excitability of muscle cells and electrical signaling in the
nervous system (1). They are present not only in all
animal and plant cells and microorganisms, but have also been
identified in viruses (12, 31, 32, 33, 37, 43, 44, 45), in
which they are thought to play an important role in replication.
The influenza A virus is an enveloped negative-strand virus with eight
RNA segments encapsidated with nucleoprotein (NP) (24). Spanning the viral membrane are three proteins: hemagglutinin (HA),
neuraminidase (NA), and M2. The life cycle of viruses generally involves attachment to cell surface receptors, entry into the cell, and
uncoating of the viral nucleic acid, followed by replication of the
viral genes inside the cell. After the synthesis of new copies of viral
proteins and genes, these components assemble into progeny virus
particles, which then exit the cell (34). Different viral
proteins participate in each of these steps. In influenza A viruses,
the M2 protein, which possesses ion channel activity (32, 43,
44), is thought to function at an early stage in the viral life
cycle, between host cell penetration and uncoating of viral RNA
(16, 26, 44). Once virions have undergone endocytosis, the
virion-associated M2 ion channel is believed to permit protons to flow
from the endosome into the virion interior to disrupt acid-labile M1
protein-ribonucleoprotein complex (RNP) interactions, thereby promoting
RNP release into the cytoplasm (16). In addition, among
some influenza virus strains whose HAs are cleaved intracellularly
(e.g., A/fowl plague/Rostock/34 [FPV Rostock]), M2 ion channel
activity is thought to raise the pH of the trans-Golgi
network, preventing conformational changes in the HA due to conditions
of low pH in this compartment (15, 29, 46).
Evidence that the M2 protein has ion channel activity was acquired by
expressing the protein in oocytes of Xenopus laevis and
measuring membrane currents (18, 32, 49). Specific changes in the M2 protein transmembrane (TM) domain altered the kinetics and
ion selectivity of the channel, providing strong evidence that the M2
TM domain constitutes the pore of the ion channel (18). In
fact, the M2 TM domain itself can function as an ion channel
(10). Because a requirement for M2 ion channel activity in
the replication of influenza A viruses has not been directly established, we generated a series of viruses with defective M2 ion
channel activity using a recently established reverse-genetics system
(13, 27) and tested their replication in cell culture and mice.
 |
MATERIALS AND METHODS |
Cells and viruses.
293T human embryonic kidney cells and
Madin-Darby canine kidney (MDCK) cells were maintained in Dulbecco's
modified Eagle's medium supplemented with 10% fetal calf serum (FCS)
and in minimal essential medium (MEM) containing 5% newborn calf
serum, respectively. The 293T cell line is a derivative of the 293 line
into which the gene for the simian virus 40 T antigen was inserted
(9). All cells were maintained at 37°C in 5%
CO2. A/Udorn/307/72 (H3N2) virus was propagated in
10-day-old embryonated chicken eggs.
Construction of plasmids.
The cDNA of Udorn virus was
synthesized by reverse transcription of viral RNA with an
oligonucleotide complementary to the conserved 3' end of viral RNA, as
described by Katz et al. (21). The cDNA was amplified by
PCR with M gene-specific oligonucleotide primers containing
BsmBI sites, and PCR products were cloned into the
pT7Blueblunt vector (Novagen, Madison, Wis.). The resulting construct
was designated pTPolIUdM. After digestion with BsmBI, the
fragment was cloned into the BsmBI sites of the pHH21
vector, which contains the human RNA polymerase I promoter and the
mouse RNA polymerase I terminator separated by BsmBI sites,
resulting in pPolIUdM. Plasmids derived from pHH21 for the expression
of viral RNA (vRNA) are referred to as PolI constructs in this report.
The M mutants were constructed as follows. pTPolIUdM was first
amplified by inverse PCR (28) using the back-to-back
primers M2104R (5'-AAGAGGGTCACTTGAATCG-3') and
M2V27T (5'-ACTGTTGCTGCGAGTATC-3'), M2A30P
(5'-GTTGTTGCTCCAAGTATC-3'), M2S31N (5'-GTTGTTGCTGCGAACA TC-3'), or M2del29-31 (5'-GTTGTTATCATTGGGATCTTGC-3');
the back-to-back primers M2HATMR
(5'-CACCAGTGAACTGGCGACAGTTGAGTAGATCGCCAGAATGTCACTTGAATCGTTGCATCTGC-3') and M2HATM
(5'-CTTTTGGTCTCCCTGGGGGCAATCAGTTTCTGGATGGATCGTCTTTTTTTCAAATGC-3') or M2NATMR
(5'-GCTTAGTATCAATTG TATTCCATTTATGATTGATATCCAAATGCTGTCACTTGAATCGTTGC ATCTGC-3')
or M2NATM
(5'-ATTATAGGAGTCGTAATGTGTATCTCAGGGATTACCATAATAGATCGTCTTTTTTTCAAATGC-3'); and the back-to-back primers UM772R
(5'-TTGCATCTGCACCCCCATTCG-3') and UMstop773
(5'-CGATTCAAGTGACTGATGAGTTGTTGC-3').
The PCR products were phosphorylated, self-ligated, propagated in
Escherichia coli strain DH5
, digested with
BsmBI, and cloned into the BsmBI sites of the
pHH21 vector. The resulting constructs were designated pPolIM2V27T,
pPolIM2A30P, pPolIM2S31N, pPolIM2del29-31, pPolIM2HATM,
pPolIM2NATM, and pPolI
M2TMCYT. All of the constructs were
sequenced to ensure that unwanted mutations were not present. The
plasmids for the expression of the HA (pEWSN-HA), NP
(pCAGGS-WSN-NP0/14), NA (pCAGGS-WNA15), and M1 (pCAGGS-WSN-M1-2/1)
proteins of A/WSN/33 (H1N1) (WSN) virus and the M2 (pEP24c), NS2
(pCANS2), PB1 (pcDNA774), PB2 (pcDNA762), and PA (pcDNA787) of A/Puerto
Rico/8/34 (H1N1) virus were described in a previous report
(27).
Plasmid-driven reverse genetics.
Transfectant viruses were
generated as reported earlier (27). Briefly, 17 plasmids
(eight PolI constructs for eight RNA segments and nine protein
expression constructs for nine structural proteins) were mixed with
transfection reagent (2 µl of Trans IT LT-1 [Panvera, Madison,
Wis.] per µg of DNA), incubated at room temperature for 15 min, and
added to 106 293T cells. Six hours later, the
DNA-transfection reagent mixture was replaced with Opti-MEM (Gibco-BRL)
containing 0.3% bovine serum albumin and 0.01% FCS. Forty-eight hours
later, viruses in the supernatant were plaque purified in MDCK cells
once and then inoculated into MDCK cells for the production of stock
virus. The M genes of transfectant viruses were sequenced to confirm the origin of the gene and the presence of the intended mutations and
to ensure that no unwanted mutations were present. In all experiments,
the transfectant viruses contained only the M gene from Udorn virus and
the remaining genes from WSN virus.
Replicative properties of transfectant viruses.
MDCK cells
in duplicate wells of 24-well plates were infected with wild-type and
mutant viruses, overlaid with MEM containing 0.5 µg of trypsin per
ml, and incubated at 37°C. At different times, supernatants were
assayed for infectious virus in plaque assays on MDCK cells.
To investigate the amantadine sensitivity of mutant viruses, we
titrated them in MDCK cells in the presence of different concentrations of the drug.
M2 incorporation into virions.
Transfectant viruses were
grown in MDCK cells containing 0.5 µg of trypsin per ml and purified
by centrifugation through six-step sucrose gradients (20, 30, 35, 40, 45, and 50%) for 2.5 h at 50,000 × g at 4°C.
Fractions (0.3 ml each) were then collected through a hole pierced in
the bottom of the tube and assayed by hemagglutination for the presence
of virus. The fractions that contained virus were pooled and spun down
at 50,000 × g for 1 h at 4°C, resuspended in
phosphate-buffered saline (PBS), and stored in aliquots at
80°C.
Purified virus was resuspended in lysis buffer (0.6 M KCl, 50 mM
Tris-HCl [pH 7.5], 0.5% Triton X-100). The viral lysates were placed
on sodium dodecyl sulfate (SDS)-15% polyacrylamide gels, which were
then electrotransferred to a polyvinylidene difluoride membrane, which
was blocked overnight at 4°C with 5% skim milk in PBS and incubated
with the 14C2 anti-M2 monoclonal antibody (kindly provided by R. Lamb)
and anti-WSN-NP monoclonal antibody for 1 h at room temperature.
The membrane was washed three times with PBS containing 0.05% Tween
20. Bound antibodies were detected with a Vectastain ABC kit (Vector)
and the Western immunoblot ECL system (Amersham). Signal intensities
were quantified with an Alpha Imager 2000 (Alpha Innotech Corporation).
Kinetics of viral protein synthesis.
MDCK cells were
infected with wild-type or mutant viruses at a multiplicity of
infection (MOI) of 1 PFU per cell. At different times, the infected
cells were pulse labeled for 20 min with 50 µCi of
[35S]methionine (ICN, Irvine, Calif.) per ml.
Approximately 105 cells were lysed in 0.3 ml of
radioimmunoprecipitation assay buffer (50 mM Tris-HCl [pH 7.6], 0.6 M
KCl, 0.5% Triton X-100, 1 mM phenylmethylsulfonyl fluoride). The cell
lysates were electrophoresed on SDS-15% polyacrylamide gels.
Experimental infection.
Five-week-old female BALB/c mice,
anesthetized with isoflurane, were infected intranasally with 50 µl
(5.0 × 103 PFU) of virus. Virus titers in organs were
determined 3 days after infection with MDCK cells, as described
(3).
 |
RESULTS |
Generation of influenza A viruses containing mutations in M2
protein.
The TM domain of the M2 protein possesses an
-helical
structure (10, 35, 44). Mutations at residues V-27, A-30,
S-31, G-34, and L-38, all of which are located on the same face of the
-helix, alter the properties of the M2 ion channel (14, 32, 49). To determine the role of the ion channel activity of M2 in
viral replication, we initially constructed four plasmids and used them
to generate mutant viruses with changes in the M2 TM domain (Fig.
1). The whole-cell currents of the mutant
proteins, expressed in oocytes of Xenopus laevis, were
measured by Holsinger et al. (18), using a two-electrode
voltage clamp procedure. Two mutants, M2A30P and M2del29-31, had no
functional ion channel activity at either neutral or low pH. M2V27T and
M2S31N, which showed ion channel activity at low pH (18),
were used as positive controls.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic diagram of mutant influenza virus M2 proteins
and their properties. The amino acid sequence of the TM domain
(residues 25 to 43) is shown in single-letter code in the expanded
section of the diagram. Ion channel activity was determined by
Holsinger et al. (18) using a two-electrode voltage clamp
procedure. +, detectable ion channel activity; , no detectable ion
channel activity.
|
|
To generate mutant viruses by plasmid-driven reverse genetics
(27), we transfected 293T cells with nine protein
expression plasmids and eight that directed the production of rRNA
segments encoding all WSN viral genes except the M gene, which was
derived from Udorn virus (wild type). The corresponding transfectant
viruses were designated M2V27T, M2A30P, M2S31N, M2del29-31, and WSN-UdM (for the virus containing the parental Udorn M gene).
To determine the efficiency of virus generation, we titrated viruses in
the culture supernatant of 293T cells at 48 h posttransfection with MDCK cells. As shown in Table 1,
more than 105 transfectant viruses with the wild-type or
mutant M gene were present. Thus, all viruses bearing M2 mutations and
the virus possessing the wild-type Udorn M gene were generated with
similar efficiencies. The transfectant viruses were plaque purified
once in MDCK cells and then inoculated into MDCK cells to make virus stocks. The stability of the introduced mutations was analyzed by
sequencing the M gene segments of the transfectant viruses after 10 passages in MDCK cells. No revertants were found (data not shown).
Growth properties of M2 mutant viruses in tissue culture.
We
next compared the growth properties of M2 ion channel mutants and
wild-type WSN-UdM virus in MDCK cells (Fig.
2). Cells were infected at an MOI of
0.001, and yields of virus in the culture supernatant were determined
at different times postinfection at 37°C. The mutant viruses did not
differ appreciably from the wild-type WSN-UdM virus in either growth
rate (Fig. 2) or the size of plaques after 48 h of growth (1.5 mm
in diameter).

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 2.
Growth curves of M2 mutant and wild-type WSN-UdM
viruses. MDCK cells were infected with virus at an MOI of 0.001. At the
indicated times after infection, the virus titer in the supernatant was
determined. The values are means of triplicate experiments. The
standard deviation (SD) is less than 0.59 for each sample. , M2V27T;
, M2A30P; +, M2S31N; , M2del29-31; , wild type.
|
|
To assess the amantadine sensitivity of these viruses, the M2 mutant
and wild-type WSN-UdM viruses were grown in MDCK cells in the presence
of different concentrations of amantadine. In cell culture, amantadine
produces two discrete concentration-dependent inhibitory actions
against viral replication. A nonspecific action at concentrations of
>50 µM, resulting from an increase in the pH of endosomes, inhibits
activation of HA membrane fusion activity involved in endocytosis
(7), whereas at lower concentrations, 0.1 to 5 µM, the
drug selectively inhibits viral replication (2). As shown
in Fig. 3, amantadine markedly reduced
the yield of wild-type WSN-UdM virus as well as the size of plaques
(data not shown) at each of the three test concentrations. By contrast,
at 5 µM amantadine, the replication of M2 mutant viruses was either
not affected or inhibited only slightly. Substantial inhibition due to
the drug's nonspecific activity was seen at 50 µM. Thus, all of our
M2 mutants were more resistant to amantadine than the wild-type virus.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 3.
Amantadine sensitivity of M2 ion channel mutants. The
mutant and wild-type WSN-UdM viruses were tested for plaque-forming
capacity in MDCK cells in the presence of different concentrations of
amantadine. Experiments were performed three times, with the results
reported as means ± SD. , M2V27T; , M2A30P; , M2S31N;
, M2del29-31; , wild type.
|
|
Generation of transfectant viruses in which M2 TM domain was
replaced with that from HA or NA.
Although the M2A30P and
M2del29-31 mutants do not have functional ion channel activity (which
was shown by Holsinger et al. [18] using a two-electrode
voltage clamp procedure), they both replicated as well as the wild-type
virus in MDCK cells (Fig. 2). However, we could not rule out the
possibility of low-level ion channel activity below the sensitivity
range of the assay. For this reason, we attempted to generate chimeric
mutant viruses in which the M2 TM domain was replaced with that from
the HA or NA of the A/WSN/33 virus (Fig.
4). When we assayed the supernatant of
293T cells transfected with plasmids for virus production, the chimeric
mutants M2HATM and M2NATM were each viable, but their titers were more
than 10-fold lower than that of the wild-type WSN-UdM titer (Table 1).
The mutants also produced small plaques (1.0 mm in diameter) after
48 h of growth. Thus, influenza A virus can replicate without the
M2 TM domain in cell culture.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 4.
Schematic diagram of the chimeric M2 mutants and the M2
mutant lacking the TM and cytoplasmic domains. Each chimeric mutant was
constructed by replacing the TM domain of M2 with that of the HA or NA,
while M2TMCYT was constructed by introducing two stop codons at the
3' end of the M1 ORF, resulting in a mutant lacking both the TM and
cytoplasmic domains.
|
|
Generation of transfectant
M2TMCYT virus lacking M2 TM and
cytoplasmic domains.
Although the M2HATM and M2NATM viruses lack
the M2 TM domain, their M2 proteins are membrane anchored. Thus, we
conducted a more rigorous test of the requirement for M2 ion channel
activity in influenza A virus replication. By constructing a mutant M
gene possessing two stop codons at the 3' end of the M1 open reading frame (ORF), we attempted to produce a mutant virus with an M gene that
encodes intact M1 protein and a truncated M2 corresponding to the
ectodomain (23 amino acids), but lacking both a TM domain and a
cytoplasmic tail (Fig. 4). The resultant virus,
M2TMCYT, was viable
(titer of 1.4 × 104 PFU per ml of supernatant from
293T cell cultures transfected with plasmids for virus production
[Table 1]) and produced pinpoint plaques (~0.5 mm in diameter). The
titer of the stock virus was 1 × 104 PFU per ml.
Growth properties of M2HATM and
M2TMCYT viruses in cell
culture.
MDCK cells were infected with M2HATM at an MOI of 0.001 PFU per cell and with
M2TMCYT at an MOI of 0.01 PFU per cell and incubated at 37°C. Although M2HATM produced a lower titer than the
wild-type WSN-UdM virus at 12 and 24 h postinfection, its maximum
titer at 36 h was almost the same as that of the wild-type virus
(Fig. 5). By contrast,
M2TMCYT grew
very slowly, reaching its maximum titer at 108 h postinfection
(Fig. 6A). Interestingly, at 33°C, this
mutant attained a titer of nearly 106 PFU per ml,
equivalent to that of the wild-type virus (Fig. 6B), although its
growth was substantially slower. These results indicate that influenza
A virus can undergo multiple cycles of replication without the M2 TM
and cytoplasmic domains, although these domains are both important for
efficient viral replication.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 5.
Growth curves of M2HATM ( ) and wild-type ( )
WSN-UdM viruses. MDCK cells were infected with virus at an MOI of
0.001. At the indicated times after infection, the virus titer in the
supernatant was determined. The values are means of triplicate
experiments. The SD is less than 0.42 for each sample.
|
|

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 6.
Growth curves of M2TMCYT ( ) and wild-type ( )
WSN-UdM viruses. MDCK cells were infected with virus at an MOI of 0.01 and incubated at 37°C (A) or 33°C (B). At the indicated times after
infection, the virus titer in the supernatant was determined. The
values are means of triplicate experiments. The SD is less than 0.40 for each sample.
|
|
Incorporation of mutant M2 molecules into virions.
Conceivably, the M2 point and chimeric mutants possessed some residual
ion channel activity, so that increased incorporation of the M2 protein
into virions could compensate for any defect in this function. We
therefore compared the efficiency of incorporation of the wild-type and
mutant M2s into influenza virions by Western blot analysis after
standardization based on the intensity of NP expression (Fig.
7). Virion incorporation of M2del29-31
and M2HATM M2 proteins was slightly reduced compared with the wild-type protein. The band detected slightly below the M2 protein of the wild-type virus is probably a proteolytically cleaved form of M2, as
reported by others (51). An additional band below the NP
protein, which was reactive with anti-NP but not anti-M2 antibody, is a
cleavage product of NP (53). Together, these results
demonstrate that increased incorporation of M2 protein into virions
probably does not compensate for defective M2 ion channel activity.

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 7.
Incorporation of M2 mutants into influenza virions.
Purified viruses were lysed in sample buffer. Viral proteins were
treated with 2-mercaptoethanol, separated by SDS-15% PAGE,
transferred to a polyvinylidene difluoride membrane, and detected with
the 14C2 anti-M2 monoclonal antibody and anti-WSN NP monoclonal
antibody. Molecular masses of the marker proteins are shown on the left
(in kilodaltons [K]).
|
|
Kinetics of viral protein synthesis in mutant and wild-type
virus-infected cells.
To determine whether the lack of M2 ion
channel activity, as detected with the in vitro assay, affects the
kinetics of viral replication, we examined the kinetics of viral
protein production in MDCK cells that were infected with mutant or
wild-type viruses. Similar results were obtained for the A30P,
del29-31, HATM, and wild-type WSN-UdM viruses at 2, 4, 6, and 8 h
postinfection (data not shown).
Replication of M2 mutant viruses in mice.
To validate our in
vitro test results in an animal model, we infected mice with each of
our six mutant viruses (Table 2). M2A30P
virus replicated in the lungs as well as the wild-type WSN-UdM and
control M2V27T and M2S31N mutants, while replication of M2del29-31
virus in this organ was more than 10-fold lower. By contrast, neither
the M2A30P nor the M2del29-31 virus was found in nasal turbinates from
any of the infected mice. M2HATM and
M2TMCYT viruses were not
recovered from either the lungs or the nasal turbinates. These results
establish that M2 ion channel activity is necessary for efficient
influenza A virus replication in vivo.
 |
DISCUSSION |
We used a new reverse-genetics system (27)
to generate transfectant influenza A viruses with changes in the M2 TM
domain sufficient to block ion channel activity according to in vitro assays (18). Despite this functional defect, all of the
mutant viruses replicated as efficiently as the wild-type WSN-UdM virus in cell culture, although we could not rule out the possibility of
residual ion channel activity adequate to support viral replication. Experiments in which the TM domain of the M2 protein was replaced with
that from the HA (M2HATM) or NA (M2NATM) or was completely deleted
together with the cytoplasmic domain (
M2TMCYT) demonstrated that
influenza A virus can undergo multiple cycles of replication in cell
culture without M2 ion channel activity. However, the M2HATM and
M2TMCYT viruses did not replicate in mice. Since these mutant
viruses grow substantially more slowly than the wild-type virus, they
may be rapidly eliminated from the organs by host defense mechanisms,
including the immune system. Thus, these results indicate that ion
channel activity promotes efficient viral replication.
The M2 ectodomain is thought to be involved in the incorporation of M2
protein into virions (30). Moreover, deletion of 5 or 10 amino acids from the M2 cytoplasmic tail abrogates viral replication
(4), possibly through adverse effects on ion channel activity (48) or perhaps by abolishing the protein's
interaction with other viral components, including M1 protein
(52). Thus, the greater attenuation in cell culture of
M2TMCYT than of M2HATM suggests a requirement for both the TM and
cytoplasmic domains of M2, and perhaps the ectodomain
(30), to achieve maximally efficient viral replication.
M2 ion channel activity is believed to function at an early stage in
the viral life cycle, between the steps of host cell penetration and
uncoating of viral RNA. Zhirnov (54) reported that low pH
induces the dissociation of M1 protein from viral RNPs in vitro. This
observation led others to suggest that the introduction of protons into
the interior of virions through M2 ion channel activity in the
endosomes is responsible for M1 dissociation from RNP
(16). If so, how could mutants with defects in ion channel
activity replicate at all? Immunoelectron microscopy of the HA protein
in virosomes exposed to low pH demonstrated that, in the absence of
target membranes, the N-terminal fusion peptide of the HA2 subunit is
inserted into the same membrane site where HA is anchored
(50). Therefore, the fusion peptide of the HA might be
inserted into the viral envelope, forming pores in the viral membrane
that permit the flow of protons from the endosome into the virus's
interior, leading to disruption of RNP-M1 interaction and hence to
appreciable viral replication.
What is the origin of the M2 ion channel in influenza A virus? M2 ion
channel activity was originally discovered in studies of the FPV
Rostock strain (43), which has an intracellularly cleavable HA (29, 43, 46). In this strain, the HA
undergoes a low-pH-induced conformational change in the
trans-Golgi network in the absence of M2 ion channel
activity, which raises the pH in this compartment. Hence, in the past,
influenza A viruses may have harbored an M2 protein that promoted an
increase in the pH of the trans-Golgi network, to a level
that prevents conformational changes in the intracellularly cleavable
HA. As influenza A viruses without intracellularly cleavable HAs began
to appear, there was less selective pressure to maintain high ion
channel activity associated with the M2 protein. Although decreased,
this ion channel activity may have been sufficient to permit M1 to
dissociate from RNP. In fact, ion channel activity differs markedly
among the M2 proteins of currently recognized viruses. For example, to
display the same ion channel activity as FPV Rostock virus (containing intracellularly cleavable HA), fivefold more M2 protein from human Udorn virus (containing intracellularly uncleavable HA) is needed (46). Conversely, the HAs of some influenza A viruses have
changed from intracellularly uncleavable to cleavable during
replication in chickens (19, 20, 22), suggesting that M2
protein with limited ion channel activity can acquire greater activity
once a switch to intracellularly cleavable HA has occurred.
The M2HATM virus, although replicating reasonably well in cell culture,
was highly attenuated in mice, raising the possibility of its use in
the production of live vaccines. Cold-adapted live vaccines, now in
clinical trials (25), hold considerable promise for use in
the general population (38, 39, 40). The major concern is
that the limited number of attenuating mutations in such vaccines
(6, 17) could permit the generation of revertant viruses.
Abolishing M2 ion channel activity, for example, by replacing the M2 TM
domain with that from the HA, would greatly reduce the likelihood of
the emergence of revertant viruses. Thus, by using the reverse-genetics
system described in this report, one could generate influenza viruses
with modified viral genes, as a first step in the production of safe
live influenza vaccines.
To date, five viral proteins have been reported to act as ion channels:
M2 of influenza A virus, NB of influenza B virus, Vpu and Vpr of human
immunodeficiency virus type 1 (HIV-1), and Kcv of chlorella virus
(12, 31, 32, 33, 37, 43, 44, 45). Since the replication
strategies of influenza type A and B viruses are very similar, NB ion
channel activity is also thought to play a role at an early stage of
the viral life cycle, although this protein still lacks a demonstrated
function in viral replication. Although the Vpu gene of HIV-1 can be
deleted without completely abrogating HIV-1 replication in vitro
(5, 23, 41, 42), the Vpu protein enhances the release of
virus particles from cells (36, 41, 47). Vpr, another
auxiliary HIV-1 protein, plays an important role in viral replication
(8). Chlorella virus PBCV-1 encodes a functional
K+ channel protein, Kcv, which is important in the virus
life cycle (33). On balance, the available data indicate
that viral protein ion channel activities are integral parts of the
viral life cycle and promote efficient viral replication.
We thank Krisna Wells and Martha McGregor for excellent technical
assistance, John Gilbert for editing the manuscript, and Robert Lamb
for providing anti-M2 monoclonal antibody 14C2. We also thank John
Skehel for helpful discussions. Automated sequencing was performed at
the University of Wisconsin-Madison Biotechnology Center.
Support for this work was provided by NIAID Public Health Service
research grants. T.W. is the recipient of a research fellowship from
the Japan Society for the Promotion of Science for Young Scientists.
S.W. is the recipient of a Japan Society for Promotion of Science
postdoctoral fellowship for research abroad.
| 1.
|
Alberts, B.,
D. Bray,
J. Lewis,
M. Raff,
K. Roberts, and J. D. Watson (ed.).
1994.
Molecular biology of the cell.
Garland Publishing, Inc., New York, N.Y.
|
| 2.
|
Appleyard, G.
1977.
Amantadine-resistance as a genetic marker for influenza viruses.
J. Gen. Virol.
36:249-255[Abstract/Free Full Text].
|
| 3.
|
Bilsel, P.,
M. R. Castrucci, and Y. Kawaoka.
1993.
Mutations in the cytoplasmic tail of influenza A virus neuraminidase affect incorporation into virions.
J. Virol.
67:6762-6767[Abstract/Free Full Text].
|
| 4.
|
Castrucci, M. R., and Y. Kawaoka.
1995.
Reverse genetics system for generation of an influenza A virus mutant containing a deletion of the carboxyl-terminal residue of M2 protein.
J. Virol.
69:2725-2728[Abstract].
|
| 5.
|
Cohen, E. A.,
E. F. Terwilliger,
J. G. Sodroski, and W. A. Haseltine.
1988.
Identification of a protein encoded by the vpu gene of HIV-1.
Nature
334:532-534[CrossRef][Medline].
|
| 6.
|
Cox, N. J.,
F. Kitame,
A. P. Kendal,
H. F. Maassab, and C. Naeve.
1988.
Identification of sequence changes in the cold-adapted, live attenuated influenza vaccine strain, A/Ann Arbor/6/60 (H2N2).
Virology
167:554-567[Medline].
|
| 7.
|
Daniels, R. S.,
J. C. Downie,
A. J. Hay,
M. Knossow,
J. J. Skehel,
M. L. Wang, and D. C. Wiley.
1985.
Fusion mutants of the influenza virus hemagglutinin glycoprotein.
Cell
40:431-439[CrossRef][Medline].
|
| 8.
|
Dedera, D.,
W. Hu,
H. Vander Heyden, and L. Ratner.
1989.
Viral protein R of human immunodeficiency virus types 1 and 2 is dispensable for replication and cytopathogenicity in lymphoid cells.
J. Virol.
63:3205-3208[Abstract/Free Full Text].
|
| 9.
|
DuBridge, R. B.,
P. Tang,
H. C. Hsia,
P. M. Leong,
J. H. Miller, and M. P. Calos.
1987.
Analysis of mutation in human cells by using an Epstein-Barr virus shuttle system.
Mol. Cell. Biol.
7:379-387[Abstract/Free Full Text].
|
| 10.
|
Duff, K. C., and R. H. Ashley.
1992.
The transmembrane domain of influenza A M2 protein forms amantadine-sensitive proton channels in planar lipid bilayers.
Virology
190:485-489[CrossRef][Medline].
|
| 11.
|
Duff, K. C.,
S. M. Kelly,
N. C. Price, and J. P. Bradshaw.
1992.
The secondary structure of influenza A M2 transmembrane domain.
FEBS Lett.
311:256-258[CrossRef][Medline].
|
| 12.
|
Ewart, G. D.,
T. Sutherland,
P. W. Gage, and G. B. Cox.
1996.
The Vpu protein of human immunodeficiency virus type 1 forms cation-selective ion channels.
J. Virol.
70:7108-7115[Abstract/Free Full Text].
|
| 13.
|
Fodor, E.,
L. Devenish,
O. G. Engelhardt,
P. Palese,
G. G. Brownlee, and A. Garcia-Sastre.
1999.
Rescue of influenza A virus from recombinant DNA.
J. Virol.
73:9679-9682[Abstract/Free Full Text].
|
| 14.
|
Grambas, S.,
M. S. Bennett, and A. J. Hay.
1992.
Influence of amantadine resistance mutations on the pH regulatory function of the M2 protein of influenza A viruses.
Virology
190:541-549.
|
| 15.
|
Hay, A. J.,
A. J. Wolstenholme,
J. J. Skehel, and M. H. Smith.
1985.
The molecular basis of the specific anti-influenza action of amantadine.
EMBO J.
4:3021-3024[Medline].
|
| 16.
|
Helenius, A.
1992.
Unpacking the incoming influenza virus.
Cell
69:577-578[CrossRef][Medline].
|
| 17.
|
Herlocher, M. L.,
H. F. Maassab, and R. G. Webster.
1993.
Molecular and biological changes in the cold-adapted "master strain" A/AA/6/60 (H2N2) influenza virus.
Proc. Natl. Acad. Sci. USA
90:6032-6036[Abstract/Free Full Text].
|
| 18.
|
Holsinger, L. J.,
D. Nichani,
L. H. Pinto, and R. A. Lamb.
1994.
Influenza A virus M2 ion channel protein: a structure-function analysis.
J. Virol.
68:1551-1563[Abstract/Free Full Text].
|
| 19.
|
Horimoto, T., and Y. Kawaoka.
1995.
Molecular changes in virulent mutants arising from avirulent avian influenza viruses during replication in 14-day-old embryonated eggs.
Virology
206:755-759[CrossRef][Medline].
|
| 20.
|
Horimoto, T.,
E. Rivera,
J. Pearson,
D. Sanne,
S. Krauss,
Y. Kawaoka, and R. G. Webster.
1995.
Origin and molecular changes associated with emergence of a highly pathogenic H5N2 influenza virus in Mexico.
Virology
213:223-230[CrossRef][Medline].
|
| 21.
|
Katz, J. M.,
M. Wang, and R. G. Webster.
1990.
Direct sequencing of the hemagglutinin gene of influenza (H3N2) virus in original clinical samples reveals sequence identity with mammalian-cell-grown virus.
J. Virol.
64:1808-1811[Abstract/Free Full Text].
|
| 22.
|
Kawaoka, Y.,
C. W. Naeve, and R. G. Webster.
1984.
Is virulence of H5N2 influenza viruses in chickens associated with loss of carbohydrate from the hemagglutinin?
Virology
139:303-316[CrossRef][Medline].
|
| 23.
|
Klimkait, T.,
K. Strebel,
M. D. Hoggan,
M. A. Martin, and J. M. Orenstein.
1990.
The human immunodeficiency virus type 1-specific protein Vpu is required for efficient virus maturation and release.
J. Virol.
64:621-629[Abstract/Free Full Text].
|
| 24.
|
Lamb, R. A., and R. A. Krug.
1996.
Orthomyxoviridae: the viruses and their replication, p. 1353-1395.
In
B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology, 3rd ed. Lippincott-Raven Publishers, Philadelphia, Pa.
|
| 25.
|
Maassab, H. F., and M. L. Bryant.
1999.
The development of live attenuated cold-adapted influenza virus vaccine for humans.
Rev. Med. Virol.
9:237-244[CrossRef][Medline].
|
| 26.
|
Martin, K., and A. Helenius.
1991.
Nuclear transport of influenza virus ribonucleoproteins: The viral matrix protein (M1) promotes export and inhibits import.
Cell
67:117-130[CrossRef][Medline].
|
| 27.
|
Neumann, G.,
T. Watanabe,
H. Ito,
S. Watanabe,
H. Goto,
P. Gao,
M. Hughes,
D. R. Perez,
R. Donis,
E. Hoffmann,
G. Hobom, and Y. Kawaoka.
1999.
Generation of influenza A viruses entirely from cloned cDNAs.
Proc. Natl. Acad. Sci. USA
96:9345-9350[Abstract/Free Full Text].
|
| 28.
|
Ochman, H.,
A. S. Gerber, and D. L. Hartl.
1988.
Genetics applications of an inverse polymerase chain reaction.
Genetics
120:621-623[Abstract/Free Full Text].
|
| 29.
|
Ohuchi, M.,
A. Cramer,
M. Vey,
R. Ohuchi,
W. Garten, and H.-D. Klenk.
1994.
Rescue of vector-expressed fowl plague virus hemagglutinin in biologically active form by acid-tropic agents and coexpressed M2 protein.
J. Virol.
68:920-926[Abstract/Free Full Text].
|
| 30.
|
Park, E. K.,
M. R. Castrucci,
A. Portner, and Y. Kawaoka.
1998.
The M2 ectodomain is important for its incorporation into influenza A virions.
J. Virol.
72:2449-2455[Abstract/Free Full Text].
|
| 31.
|
Piller, S. C.,
G. D. Ewart,
A. Premkumar,
G. B. Cox, and P. W. Gage.
1996.
Vpr protein of human immunodeficiency virus type 1 forms cation-selective channels in planar lipid bilayers.
Proc. Natl. Acad. Sci. USA
93:111-115[Abstract/Free Full Text].
|
| 32.
|
Pinto, L. H.,
L. J. Holsinger, and R. A. Lamb.
1992.
Influenza A virus M2 protein has ion channel activity.
Cell
69:517-528[CrossRef][Medline].
|
| 33.
|
Plugge, B.,
S. Gazzarrini,
M. Nelson,
R. Cerana,
J. L. Van Etten,
C. Derst,
D. DiFrancesco,
A. Moroni, and G. Thiel.
2000.
A potassium channel protein encoded by chlorella virus PBCV-1.
Science
287:1641-1644[Abstract/Free Full Text].
|
| 34.
|
Roizman, B., and P. Palese.
1996.
Multiplication of viruses: an overview, p. 101-111.
In
B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology, 3rd ed. Lippincott-Raven Publishers, Philadelphia, Pa.
|
| 35.
|
Sansom, M. S. P., and I. D. Kerr.
1993.
Influenza virus M2 protein: A molecular modeling study of the ion channel.
Protein Eng.
6:65-74[Abstract/Free Full Text].
|
| 36.
|
Schubert, U.,
K. A. Clouse, and K. Strebel.
1995.
Augmentation of virus secretion by the human immunodeficiency virus type 1 Vpu protein is cell type independent and occurs in cultured human primary macrophages and lymphocytes.
J. Virol.
69:7699-7711[Abstract].
|
| 37.
|
Schubert, U.,
A. V. Ferrer-Montiel,
M. Oblatt-Montal,
P. Henklein,
K. Strebel, and M. Montal.
1996.
Identification of an ion channel activity of the Vpu transmembrane domain and its involvement in the regulation of virus release from HIV-1 infected cells.
FEBS Lett.
398:12-18[CrossRef][Medline].
|
| 38.
|
Sears, S. D.,
M. L. Clements,
R. F. Betts,
H. F. Maassab,
B. R. Murphy, and M. H. Snyder.
1988.
Comparision of live, attenuated H1N1 and H3N2 cold-adapted and avian-human influenza A reassortant viruses and inactivated virus vaccine in adults.
J. Infect. Dis.
158:1209-1219[Medline].
|
| 39.
|
Steinhoff, M. C.,
N. A. Halsey,
M. H. Wilson,
B. A. Burns,
R. K. Samorodin,
L. F. Fries,
B. R. Murphy, and M. L. Clements.
1990.
Comparison of live attenuated cold-adapted and avian-human influenza A/Bethesda/85 (H3N2) reassortant virus vaccines in infants and children.
J. Infect. Dis.
162:394-401[Medline].
|
| 40.
|
Steinhoff, M. C.,
N. A. Halsey,
L. F. Fries,
M. H. Wilson,
J. King,
B. A. Burns,
R. K. Samorodin,
V. Perkis,
B. R. Murphy, and M. L. Clements.
1991.
The A/Mallard/6750/78 avian-human, but not the A/Ann Arbor/6/60 cold-adapted, influenza A/Kawasaki/86 (H1N1) reassortant virus vaccine retains partial virulence for infants and children.
J. Infect. Dis.
163:1023-1028[Medline].
|
| 41.
|
Strebel, K.,
T. Klimkait, and M. A. Martin.
1988.
A novel gene of HIV-1, VPU, and its 16-kilodalton product.
Science
241:1221-1223[Abstract/Free Full Text].
|
| 42.
|
Strebel, K.,
T. Klimkait,
F. Maldarelli, and M. A. Martin.
1989.
Molecular and biochemical analyses of human immunodeficiency virus type 1 Vpu protein.
J. Virol.
63:3784-3791[Abstract/Free Full Text].
|
| 43.
|
Sugrue, R. J.,
G. Bahadur,
M. C. Zambom,
M. Hall-Smith,
A. R. Douglas, and A. J. Hay.
1990.
Specific structure alteration of the influenza haemagglutinin by amantadine.
EMBO J.
9:3469-3476[Medline].
|
| 44.
|
Sugrue, R. J., and A. J. Hay.
1991.
Structural characteristics of the M2 protein of the influenza A viruses: evidence that it forms a tetrameric channel.
Virology
180:617-624[CrossRef][Medline].
|
| 45.
|
Sunstrom, N. A.,
L. S. Premkumar,
A. Premkumar,
G. Ewart,
G. B. Cox, and P. W. Gage.
1996.
Ion channels formed by NB, an influenza B virus protein.
J. Membr. Biol.
150:127-132[CrossRef][Medline].
|
| 46.
|
Takeuchi, K., and R. A. Lamb.
1994.
Influenza virus M2 protein ion channel activity stabilizes the native form of fowl plague virus hemagglutinin during intracellular transport.
J. Virol.
68:911-919[Abstract/Free Full Text].
|
| 47.
|
Terwilliger, E. F.,
E. A. Cohen,
Y. C. Lu,
J. G. Sodroski, and W. A. Haseltine.
1989.
Functional role of human immunodeficiency virus type 1 vpu.
Proc. Natl. Acad. Sci. USA
86:5163-5167[Abstract/Free Full Text].
|
| 48.
|
Tobler, K.,
M. L. Kelly,
L. H. Pinto, and R. A. Lamb.
1999.
Effect of cytoplasmic tail truncations on the activity of the M2 ion channel of influenza A virus.
J. Virol.
73:9695-9701[Abstract/Free Full Text].
|
| 49.
|
Wang, C.,
K. Takeuchi,
L. H. Pinto, and R. A. Lamb.
1993.
The ion channel activity of influenza A virus protein: characterization of the amantadine block.
J. Virol.
67:5585-5594[Abstract/Free Full Text].
|
| 50.
|
Wharton, S. A.,
L. J. Calder,
R. W. H. Ruigrok,
J. J. Skehel,
D. A. Steinhauer, and D. C. Wiley.
1995.
Electron microscopy of antibody complexes of influenza virus heamagglutinin in the fusion pH conformation.
EMBO J.
14:240-246[Medline].
|
| 51.
|
Zebedee, S. L., and R. A. Lamb.
1988.
Influenza virus M2 protein: monoclonal antibody restriction of virus growth and detection of M2 in virions.
J. Virol.
62:2762-2772[Abstract/Free Full Text].
|
| 52.
|
Zebedee, S. L., and R. A. Lamb.
1989.
Growth restriction of influenza A virus by M2 protein antibody is genetically linked to the M1 protein.
Proc. Natl. Acad. Sci. USA
86:1061-1065[Abstract/Free Full Text].
|
| 53.
|
Zhirnov, O., and A. G. Bukrinskaya.
1984.
Nucleoproteins of animal influenza viruses, in contrast to those of human strains, are not cleaved in infected cells.
J. Gen. Virol.
65:1127-1134[Abstract/Free Full Text].
|
| 54.
|
Zhirnov, O. P.
1990.
Solubilization of matrix protein M1/M from virions occurs at different pH for orthomyxo- and paramyxoviruses.
Virology
176:274-279[CrossRef][Medline].
|