JVI Figure table search 04
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bültmann, A.
Right arrow Articles by Haas, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bültmann, A.
Right arrow Articles by Haas, J.

 Previous Article  |  Next Article 

Journal of Virology, June 2001, p. 5263-5276, Vol. 75, No. 11
0022-538X/01/$04.00+0   DOI: 10.1128/JVI.75.11.5263-5276.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.

Identification of Two Sequences in the Cytoplasmic Tail of the Human Immunodeficiency Virus Type 1 Envelope Glycoprotein That Inhibit Cell Surface Expression

Andreas Bültmann,1 Walter Muranyi,1 Brian Seed,2 and Jürgen Haas1,*

Max von Pettenkofer-Institut, Genzentrum, Ludwig Maximilians Universität München, Munich, Germany,1 and Department of Molecular Biology, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts 021142

Received 28 April 2000/Accepted 3 March 2001


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

During synthesis and export of protein, the majority of the human immunodeficiency virus type 1 (HIV-1) Env glycoprotein gp160 is retained in the endoplasmic reticulum (ER) and subsequently ubiquitinated and degraded by proteasomes. Only a small fraction of gp160 appears to be correctly folded and processed and is transported to the cell surface, which makes it difficult to identify negative sequence elements regulating steady-state surface expression of Env at the post-ER level. Moreover, poorly localized mRNA retention sequences inhibiting the nucleocytoplasmic transport of viral transcripts interfere with the identification of these sequence elements. Using two heterologous systems with CD4 or immunoglobulin extracellular/transmembrane domains in combination with the gp160 cytoplasmic domain, we were able to identify two membrane-distal, neighboring motifs, is1 (amino acids 750 to 763) and is2 (amino acids 764 to 785), which inhibited surface expression and induced Golgi localization of the chimeric proteins. To prove that these two elements act similarly in the homologous context of the Env glycoprotein, we generated a synthetic gp160 gene with synonymous codons, the transcripts of which are not retained within the nucleus. In accordance with the results in heterologous systems, an internal deletion of both elements considerably increased surface expression of gp160.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The human immunodeficiency virus type 1 (HIV-1) glycoprotein gp160 is processed into the transmembrane subunit (TM) gp41 and the nonconvalently linked gp120 glycoprotein, which binds to the CD4 receptor and chemokine coreceptor molecules. Cleavage mediated by a cellular furin protease during the protein transport through the cis or medial Golgi appears to be mandatory for membrane fusion (18, 29, 42, 57, 66). Nascent gp160 molecules are bound to GRP78-BiP, calnexin, and calreticulin chaperones and are highly glycosylated, sulfated, and palmitoylated (5, 18, 24, 36, 49, 71). Correct folding, as well as glycosylation and oligomerization, was found to be necessary for efficient protein transport (6, 14, 17, 18, 24, 30, 35, 48, 50). Previous studies demonstrated that the majority of the Env glycoprotein is intracellularly retained and remains endoglycosidase H (Endo H) sensitive (31, 32, 53, 69). Only a minor fraction leaves the endoplasmic reticulum (ER) and is transported to the cell surface. Recently we showed that the ER-retained Env glycoprotein is ubiquitinated and degraded by the proteasome (9; A. Bültmann and J. Haas, unpublished data). Glycoprotein surface expression, however, not only depends on ER-mediated quality control and the retention of misfolded or disassembled Env in the ER but also involves subsequent steps, including Golgi export and internalization of surface-expressed Env (58). A tyrosine-based, membrane-proximal YXXPhi motif (amino acids [aa] 713 to 716) in the cytoplasmic gp41 domain was previously reported to be responsible for endocytosis, but additional, more distal elements were expected (4, 58).

There are several lines of evidence suggesting that the cytoplasmic domain of the TM glycoprotein modulates surface expression. Deletion of the carboxy terminus, which has been observed after long-term culture of chronically HIV-1-infected cells, increases both protein transport and processing of gp160 but leads to a decreased incorporation of glycoproteins into virions, probably because of a direct interaction between Env and viral matrix proteins (13, 15, 18, 22, 25, 28, 39, 72, 73). Moreover, deletion of the cytoplasmic domain appears to reduce infectivity of virions due to postentry events (26, 72). Similar to the case with HIV-1, protein synthesis and processing of the TM protein in simian immunodeficiency virus (SIV) is modulated by the cytoplasmic domain. Most SIVs isolated by culturing in human cells possess a premature stop codon truncating the cytoplasmic tail of gp41 (10, 67; V. M. Hirsch, P. Edmondson, C. M. Murphey, B. Arbeille, P. R. Johnson, and J. I. Mullins, Letter, Nature 341:573-574, 1989). This truncation of the cytoplasmic domain of gp160 increases surface expression, fusogenicity, and, in contrast to the case with HIV-1, infectivity (10, 54, 63, 64, 74). Regarding HIV-2, which is highly related to SIV, similar observations have been made (43).

In HIV-1 infection, unspliced and singly spliced viral mRNA is not transported into the cytoplasm unless the posttranscriptional regulator Rev is present (21, 23, 38). This nuclear retention of HIV-1 mRNA is caused by multiple poorly localized negative sequence elements present throughout the viral genome (2, 7, 12, 21, 45, 56, 60, 61). In the env gene, inhibitory sequence elements were found in the region containing the Rev-responsive element, but also in other regions, including both gp120 and gp41 (7, 21, 45, 56). Thus, sequences suppressing the nucleocytoplasmic mRNA transport colocalize with peptide motifs acting at the protein level and make it difficult to dissect both phenomenons.

To identify sequence elements influencing the steady-state surface expression of Env, we used two different approaches. First, we investigated the gp41 cytoplasmic domain in two heterologous systems using chimeras with CD4 and immunoglobulin extracellular/transmembrane domains, thus rendering the protein independent of the complex folding and processing which causes ER retention and degradation of the majority of the Env glycoprotein. Second, we investigated the sequence elements identified with the first approach using a synthetic env sequence with synonymous codons, which proved to be refractory to mRNA retention. We identified two membrane-distal sequence elements which suppress Env surface expression and cause Golgi localization. Deletion of the two elements led to a significant increase in surface expression of the chimeric reporter constructs and of the homologous Env glycoprotein.


    MATERIAL AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Cell culture and transfection. 293T, an adenovirus transformed human kidney cell line, and HeLa cervix carcinoma cells were maintained in Dulbecco modified Eagle medium supplemented with 10% (vol/vol) heat-inactivated fetal calf serum and 100 IU of penicillin/ml, 100 µg of streptomycin/ml, and 2 mM L-glutamine. For RNA analysis, 293T cells were transfected by calcium phosphate coprecipitation according to standard protocols. For intracellular localization experiments, HeLa cells were transfected by microinjection.

Plasmid constructs. To generate an MluI restriction site 3' of the transmembrane region, human CD4 was amplified by PCR using a cDNA clone as a template and subsequently cloned into HindIII and NotI restriction sites of vector pCR3. Similarly, the extracellular domain of human immunoglobulin G1 (IgG1) hooked up to the CD7 transmembrane region followed by an MluI restriction site was cloned into the HindIII and NotI restriction sites of plasmid pRK (33). The gp41 cytoplasmic domain and mutants thereof were generated by PCR amplification using the synthetic gp160 sequence as a template to avoid nuclear mRNA retention. After the PCR, they were cloned into the MluI and NotI sites of both the CD4 and the surface immunoglobulin constructs. The syngp160 mutant constructs were generated by PCR using an EspI site in the transmembrane region and a NotI site in the 5' untranslated region. For generation of stably transfected cell lines, the syngp160 constructs were subcloned in the plasmid pBRep. The HIV-1 gag construct contained a Rev-independently expressed, synthetic, codon-optimized gag sequence (MN isolate) cloned in pND14. All constructs were confirmed by sequencing. The following oligonucleotides were used for PCR amplification: CD4 for, CGCGGGAAGCTTGCCGCCACCATGAACCGGGGAGTCCC; CD4 rev, CGCGGGGCGGCCGCTTAAATGGGGCTACATGTCTTC; CD4Delta cyt MluI rev, CGCGGGGCGGCCGCTTATTACCTTCGGTGCCGGCAACGCGTACAGAAGAAGATGCC; CD4gp41 MluI for, CGCGGGACGCGTGTGCGCCAGGGCTAC; cdm7 rev, CCACAGAAGTAAGGTTCC; gp41Delta 833 rev, CGCGGGGCGGCCGCTTATTAGAGCACCTCGATCACGC; gp41Delta 805 rev, CGCGGGGCGGCCGCTTATTACTGGCTCCAATACTGGAG; gp41Delta 785 rev, CGCGGGGCGGCCGCTTATTATAGGAGTTCCACGATGCG; gp41Delta 763 rev, CGCGGGGCGGCCGCTTATTAGCTGCGGAGGTCGAC; gp41Delta 749 rev, CGCGGGGCGGCCGCTTATTACCTGCCGCTG; gp41Delta 738 rev, CGCGGGGCGGCCGCTTATTAGCCCTCCTCCTCGATGC; gp41Delta 728 rev, CGCGGGGCGGCCGCTTATTAGGGCCCGCGCGGCAC; CD4gp41:749 for, CGCGGGACGCGTCTCGTGCACGGCTTCCTGG; gp41Delta 768 rev, CGCGGGGCGGCCGCTTATTAGCTGAACAGGAACAGGC; CD4gp41:750-763 for, CGCGTGTGCACGGCTTCCTGGCGATCATCTGGGTCGACCTCCGCAGCTAATAAGC; CD4gp41:750-763 rev, GGCCGCTTATTAGCTGCGGAGGTCGACCCAGATGATCGCCAGGAAGCCGTGCACA; CD4gp41:763-785 for, CGCGGGACGCGTCTGTTCCTGTTCAGCTACCACCACCGCGACCTGCTGCTGATCGCC; CD4gp41:763-785 rev, CGCGG GGCG GCCGCT TAT TATAG GAGT TCCACGATGCG GGCG GCGATCAGCAGCAGGTCGCG; gp41Delta is1 for, GAACAGGAACAGGAGCCTGCCGCTGGTGTCG; gp41Delta is1 rev, GCGGCAGGCTCCTGTTCCTGTTCAGCTAC; gp41Delta is1+2 for, GCGGCAGGGGCCGCCGCGGCTGGG; gp41Delta is1+2 rev, CCCAGCCGCGGCGGCCCCTGCCGCTGGTGTCGC; gp41Delta is12 for, GACCTCCGCAGCGGCCGCCGCGGCTGG; gp41IDelta is2 rev, CCCAGCCGCGGCGGCCGCTGCGGAGGTCGA; gp41L776/7A for, CTGGCCGCCATCGCCGCCCGCATCGTG; gp41L776/7A rev, CCACGATGCGGGCGGCGATGGCGGCCAGGTCGCGGTGGTGGTAGC; gp41L784/5A for, GAAGCCGCCGGCCGCCGCGGCTGG; gp41L784/5A rev, CCCAGCCGCGGCGGCCGGCGGCTTCCACGATGCGGGCGGCG; gp41L776/7/784/5A for, GCCGCCATCGCCGCCCGCATCGTGGAAGCCGCCGGCCGCCGCGGCTGGG; gp41L776/7/784/5A rev, G GCG GCT TCCACGATGCG GGCG GCGATG GCG GCCAG GTCGCGGTGGTGGTAGC; syngp160Delta cyt for, TGAGCATCGTGAACCGCTAGC; syngp160Delta cyt rev, GGCCGCTAGCGGTTCACGATGC; gp41 EspI for, CGCGGGGCTGAGCATCGTGAACCGCGTGCGCCAGGGCTA; pCR3 rev, ATTTAGGTGACACTATAG; beta -actin for, CGCGGGGAATTCAGCTGTGCTACGTCGC; beta -actin rev, CGCGGGGGATCCTCGTGGATGCCACAGG; syngp160 for, GTGCTGAAGTACTGGTGG; wtgp160 for, ATTGGTGGAATCTCCTAC; pcdm7 rev, CCACAGAAGTAAGGTTCC.

Generation of a synthetic gp160 sequence. The synthetic gp160 sequence was generated by 15 oligonucleotides used as templates for PCR as described previously (27). PCR primers of adjacent fragments were overlapping with primers and included unique restrictions sites at the 5' end. PCR products were either used for overlapping PCR with adjacent fragments or directly cloned after phenol extraction, precipitation, and restriction. Subfragments of gp120 and gp41 were cloned into modified pCdm7 and pUC plasmids containing NheI/PstI/MluI/EcoRI/BamHI/NotI and BamHI/DraIII/KpnI/EarI/EspI/SalI/BstXI/NotI polylinkers, respectively. Subsequently, both fragments were added together using a short oligonucleotide adapter. Finally, the synthetic gp160 sequence was subcloned into a pCDM7-derived plasmid under the control of a human cytomegalovirus immediate-early promotor and a CD5 signal peptide (62). The correct gp160 sequence was confirmed by double-stranded DNA sequencing.

RNA isolation and cDNA synthesis. Transfected 293T cells were harvested, washed with cold phosphate-buffered saline (PBS), and lysed with 2 ml of lysis buffer (10 mM Tris-HCl [pH 7.5], 5 mM MgCl2, 10 mM NaCl, 0.5% NP-40) for 5 min on ice. Subsequently, nuclei and cytoplasms were separated by centrifugation at 3,000 × g for 10 min at 4°C, 8 ml of 4 M guanidine thiocyanate solution (4 M guanidine thiocyanate, 25 mM sodium citrate [pH 7.0], 0.5% lauryl sarcosyl, 0.7% beta -mercaptoethanol) was added to the nuclear fraction, and 6 ml of 6 M guanidine thiocyanate solution (6 M guanidine thiocyanate, 37.5 mM sodium citrate [pH 7.0], 0.75% lauryl sarcosyl, 0.7% beta -mercaptoethanol) was added to the cytoplasmic fraction. After shearing of the genomic DNA, 5.7 M CsCl was overlayed with the guanidine thiocyanate solution in ultracentrifugation tubes. Centrifugation was performed in an SW40 rotor at 35,000 rpm for 18 h at 20°C. The RNA pellet was dissolved in diethyl pyrocarbonate (DEPC)-treated H2O, phenol-chloroform extracted once, and ethanol precipitated.

Prior to cDNA synthesis, the RNA was treated with RQ1 RNase-free DNase (Promega, Madison, Wis.) for 30 min at 37°C. After inactivation of the DNase by incubation at 65°C for 10 min, 2 µg of RNA was heat denaturated, and 2 µl 10-fold reverse transcriptase (RT) buffer, 1 µl of deoxynucleoside triphosphate (25 mM each), 1 µl of RNasin (Roche, Mannheim, Germany), 1 µl of oligo(dT) primer (250 ng/µl), 1 µl of Moloney murine leukemia virus reverse transcriptase (New England Biolabs, Beverly, Mass.), and H2O was added to a final volume of 20 µl. After incubation at 37°C for 90 min, the reaction was stopped by heat inactivation at 67°C for 15 min.

Southern blot analysis. After electrophoresis, the agarose gel was incubated in denaturation solution (0.5 M NaOH, 1.5 M NaCl) for 30 min, rinsed with H2O, and submerged in neutralization solution (0.5 M Tris-HCl [pH 7.5], 3 M NaCl) for a further 30 min. DNA was blotted overnight by capillary transfer onto a polyvinylidene difluoride nylon membrane using 20× SSC buffer (3 M NaCl, 300 mM sodium citrate [pH 7.0]). The DNA was subsequently fixed to the membrane by UV cross-linking. Prehybridization was performed in hybridization buffer (5× SSC, 1% blocking reagent, 0.1% N-lauryl sarcosine, 0.02% sodium dodecyl sulfate [SDS]) at 68°C for 1 h, followed by hybridization with the digoxigenin-labeled probe in hybridization buffer at 68°C overnight. After two washes with wash solution I (2× SSC, 0.1% SDS) at room temperature for 5 min and wash solution II (0.1× SSC, 0.1% SDS) at 68°C for 15 min, the membrane was equilibrated in Tris-buffered saline (TBS) buffer (10 mM Tris-HCl [pH 8], 150 mM NaCl). Subsequently the membrane was blocked with 5% milk powder-TBS for 1 h, incubated with a peroxidase-conjugated anti-digoxigenin antibody (Roche, Mannheim, Germany) for 1 h, and washed with TBST (10 mM Tris-HCl [pH 8], 150 mM NaCl, 0.05% Tween 20). For chemiluminescence substrate detection, the ECL Western blot detection reagents (Amersham Pharmacia Biotech, Uppsala, Sweden) were used.

Microinjection and immunofluorescence. HeLa cells grown on glass coverslips were microinjected with 0.05 µg of plasmid DNA/µl with an injection time of 0.5 s and a pressure of 60 hPa using the Eppendorf 5242/5170 microinjector system (Eppendorf, Hamburg, Germany). After further growth overnight, cells were washed with PBS and fixed with 3% paraformaldehyde-PBS for 20 min followed by incubation with 50 mM NH4Cl-20 mM glycine-PBS for 10 min. Cells were permeabilized with 0.2% Triton X-100-PBS for 10 min. Subsequently, cells were blocked with 0.2% gelatin-PBS for 10 min and incubated with the primary antibody for 30 min in the same buffer. HIV-1 Env was detected using the human polyclonal antiserum 95-1, human CD4 by mouse antibody Q4120 (Sigma, St. Louis, Mo.). After being washed three times with PBS, cells were incubated with the secondary, fluorescein isothiocyanate (FITC)-conjugated antibodies (Dianova, Hamburg, Germany) for a further 30 min. After three final washes, the coverslips were mounted on glass slides and viewed with a Leica TCS NT confocal laser scanning microscope (Leica, Bensheim, Germany).

Flow cytometry. For immunofluorescence analysis, transfected cells were detached from culture dishes by treatment with 1 mM EDTA-PBS. Cells were washed with FACS buffer (PBS-0.5% fetal calf serum-0.03% NaN3) and incubated for 30 min at 4°C with the human antiserum 95-1 at a dilution of 1:50. Subsequently, cells were washed again and incubated for 30 min at 4°C with a secondary anti-human IgG FITC-conjugated antibody at a dilution of 1:100. Finally, cells were washed, resuspended in FACS buffer, and analyzed using a FACSCalibur flow cytometer (Becton Dickinson, San Jose, Calif.).


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Identification of two sequence elements in the gp41 cytoplasmic domain responsible for suppressed surface expression. The analysis of post-ER events regulating Env surface expression is difficult, since the majority of the glycoprotein is retained in the ER due to incorrect processing and interferes with subsequent events (see Fig. 4). We thus decided to generate chimeric constructs using a CD4 extracellular/transmembrane domain and the gp41 cytoplasmic domain (56). Surface expression was tested by immunofluorescence analysis of microinjected HeLa cells using confocal laser scanning microscopy (Fig. 1). This approach was chosen since microinjection of single cells with defined amounts of plasmid DNA proved to be more reliable than analysis of bulk-transfected cultures. As anticipated, addition of the gp41 cytoplasmic domain drastically reduced surface expression of the chimeric molecule, which was even better illustrated if the immunofluorescence staining of microinjected cells was analyzed by cross-section (Fig. 1b). Intriguingly, the constructs with carboxy-terminal deletions between aa 856 (CD4gp41cyt) and 763 (CD4gp41Delta 763) were localized in the Golgi compartment, but the shorter deletion mutants, CD4gp41Delta 749, CD4gp41Delta 738, CD4gp41Delta 728, and CD4Delta cyt, all showed significant surface expression (Fig. 1). Thus, the sequence motif between aa 749 and 763 appears to be responsible for predominant Golgi localization. To analyze whether this element, termed is1 (inhibitory sequence), is sufficient to prevent surface expression, we cloned it directly 3' to the transmembrane region (Fig. 2). The chimeric molecule CD4gp41:749-763 was expressed at the cell surface, indicating that is1 is not sufficient for Golgi localization if not expressed in the correct sequence context. However, if the complete region between aa 749 and the carboxy-terminal end was expressed 3' to the transmembrane region (CD4gp41:749-856), surface expression was inhibited. Carboxy-terminal deletions of this construct identified a second element, is2, which, in combination with is1, appeared to be sufficient for Golgi localization without further sequence context and the correct distance from the plasma membrane (Fig. 2). Subsequently, is1 and is2, separately or together, were deleted in the context of the complete gp41 cytoplasmic domain (Fig. 3). Either of the two elements alone was able to inhibit surface expression, and the chimeric protein was detected on the plasma membrane only if both elements is1 and is2 together were deleted. To test whether the two dileucine motifs present in is2 are responsible for suppressed surface expression and Golgi retention or retrieval, we mutated either of the two separately or both of them together (Fig. 3). However, there was no surface expression with either of these chimeric constructs, similar to the construct in which the is2 region has been deleted.


View larger version (40K):
[in this window]
[in a new window]
 
FIG. 1.   The peptide motif is1 in the cytoplasmic gp41 domain is responsible for suppressed surface expression and Golgi localization. (a) Schematic diagram of the chimeric constructs with the CD4 extracellular/transmembrane and gp41 cytoplasmic domains used to identify the retention elements. (b) HeLa cells were microinjected with the constructs indicated in panel a, stained with the CD4-specific monoclonal antibody Q4120 and a FITC-conjugated secondary antibody, and subsequently analyzed by confocal laser scanning microscopy. The cross-section levels are indicated by white bars. The cells shown are representative of all cells microinjected with the respective constructs. Similar results were obtained in at least three independent experiments.


View larger version (49K):
[in this window]
[in a new window]
 
FIG. 2.   A second peptide motif, is2, in the cytoplasmic gp41 domain is necessary for suppressed surface expression and Golgi localization. (a) Schematic diagram of the chimeric constructs with the CD4 extracellular/transmembrane and gp41 cytoplasmic domains used to identify the retention elements. (b) HeLa cells were microinjected with the constructs indicated in panel a, stained with the CD4-specific monoclonal antibody Q4120 and a FITC-conjugated secondary antibody, and subsequently analyzed by confocal laser scanning microscopy. The cross-section levels are indicated by white bars. The cells shown are representative of all cells microinjected with the respective constructs. Similar results were obtained in at least three independent experiments.


View larger version (39K):
[in this window]
[in a new window]
 
FIG. 3.   Either is1 or is2 is sufficient for Golgi localization in the sequence context of the gp41 cytoplasmic domain. (a) Schematic diagram of the chimeric constructs with the CD4 extracellular/transmembrane and gp41 cytoplasmic domains used to identify the retention elements. (b) HeLa cells were microinjected with the constructs indicated in panel a, stained with the CD4-specific monoclonal antibody Q4120 and a FITC-conjugated secondary antibody, and subsequently analyzed by confocal laser scanning microscopy. The cross-section levels are indicated by white bars. The cells shown are representative of all cells microinjected with the respective constructs. Similar results were obtained in at least three independent experiments.

To test that the identified sequence motifs is1 and is2 in fact cause Golgi localization, we performed colocalization experiments with ER and Golgi marker proteins. Whereas HIV-1 gp160 colocalized predominantly with the ER marker calnexin, the chimeric CD4gp41cyt fusion protein was detected mainly in the Golgi and was thus found to costain with mannosidase II (Fig. 4a). In contrast to CD4gp41cyt, a considerable portion of CD4Delta cyt and CD4gp41Delta is1+2 was detected at the cell surface, and only a minor amount of the protein colocalized with mannosidase II. To confirm biochemically that the chimeric CD4 fusion proteins had left the ER and were not subjected to ER retention and degradation due to incorrect folding, we performed Endo H digests of lysates from cells transfected with the key mutants in pulse-chase experiments. In accordance with the colocalization experiments, we found that CD4Delta cyt, CD4gp41cyt, and CD4gp41Delta is1+2 were completely Endo H resistant after a 6-h chase, indicating that all these fusion proteins had reached the medial Golgi and that the cytoplasmic gp41 domain thus did not influence the ER exit (Fig. 4b). In contrast, the gp160 glycoprotein was still almost completely Endo H sensitive after both 6 and 10 h of chase, indicating that it was retained within the ER.



View larger version (83K):
[in this window]
[in a new window]
 
FIG. 4.   is1 and is2 are responsible for Golgi localization. (a) The cytoplasmic gp41 domain induces Golgi localization. HeLa cells microinjected with either gp160, CD4Delta cyt, CD4gp41cyt, or CD4gp41Delta is1+2 were costained with antibodies against gp160 or CD4 (green fluorescence) and either the ER marker calnexin or the Golgi marker mannosidase II (red fluorescence). (b) Chimeric CD4 fusion constructs exit the ER. 293 cells transfected with either gp160, CD4Delta cyt, CD4gp41cyt, or CD4gp41Delta is1+2 were pulsed with [35S]Cys-[35S]Met for 1 h and subsequently chased as indicated for 0, 6, or 10 h. Cell lysates were precipitated, digested with endoglycosidase H (Endo H), and subjected to electrophoresis on a 10% polyacrylamide gel.

Subsequently, we tested whether the gp41 cytoplasmic domain-induced Golgi localization would be influenced by HIV-1 Gag. A plasmid carrying gag was coinjected into HeLa cells at a DNA ratio of 1:1 (Fig. 5). Since the DNA was coinjected rather than cotransfected, all cells expressing the chimeric CD4 proteins also expressed HIV-1 Gag. Correct expression of the HIV-1 gag construct used was tested by staining with an anti-Gag monoclonal antibody. HIV-1 Gag had no effect on the localization of either of the chimeric CD4 proteins, and CD4gp41cyt was found in the Golgi independent of HIV-1 Gag expression.


View larger version (46K):
[in this window]
[in a new window]
 
FIG. 5.   The is1- and is2-induced Golgi localization is not influenced by HIV-1 Gag. HeLa cells were microinjected with either CD4Delta cyt, CD4gp41cyt, or CD4gp41Delta is1+2 alone or in combination with HIV-1 gag at a DNA ratio of 1:1. Subsequently, cells were stained with the CD4-specific monoclonal antibody Q4120 and a FITC-conjugated secondary antibody and analyzed by confocal laser scanning microscopy. To control expression of the HIV-1 gag plasmid, HeLa cells microinjected with HIV-1 gag were stained with monoclonal antibody EH12E1 against Gag.

To control that this effect was not artifically caused by the CD4 extracellular/transmembrane region, we generated a second set of chimeric constructs using surface-anchored IgG1 in combination with the gp41 cytoplasmic domain (Fig. 6). Similarly to the CD4 chimeras, surface expression was considerably reduced if the gp41 cytoplasmic domain was added 3' to the transmembrane region and could be restored by deletion of both is1 and is2. Moreover, surface expression was suppressed if both elements were added directly 3' to the immunoglobulin transmembrane region. In conclusion, in both heterologous systems the elements is1 and is2 behaved similarly and induced localization to the Golgi. Either of the two elements is sufficient to inhibit surface expression if deleted separately, and only deletion of both of them restores surface expression.


View larger version (45K):
[in this window]
[in a new window]
 
FIG. 6.   Either is1 or is2 is sufficient for Golgi localization in a second heterologous system using an immunoglobulin extracellular domain. (a) Schematic diagram of the chimeric constructs with the immunoglobulin (IG) extracellular domain, CD7 transmembrane stock, and gp41 cytoplasmic domain used to identify the retention elements. (b) HeLa cells were microinjected with the constructs indicated in panel a, stained with a FITC-conjugated antibody against human immunoglobulin G, and subsequently analyzed by confocal laser scanning microscopy. The cross-section levels are indicated by white bars. The cells shown are representative of all cells microinjected with the respective constructs. Similar results were obtained in at least three independent experiments.

is1 and is2 inhibit surface expression of gp160. In contrast to most cellular transcripts, the majority of HIV-1 Env mRNA is retained in the nucleus (Fig. 7b). RT-PCR analysis of nuclear and cytosolic mRNA isolated from 293T cells expressing HIV-1 gp160 indicated that only 18% of the viral mRNA can be found in the cytosol, whereas more than 80% was retained in the nucleus. In contrast to the case with gp160, approximately 50% of the cellular actin mRNA was detected in the cytosol. Thus, we confirmed previous data indicating that gp160 contains inhibitory sequence motifs retaining the viral mRNA in the nucleus (2, 7, 12, 21, 45, 56, 60, 61). To identify peptide motif(s) responsible for inhibition of protein export, we thus had to choose strategies which eliminated the interfering mRNA retention.


View larger version (32K):
[in this window]
[in a new window]
 
FIG. 7.   The nucleocytoplasmic mRNA export of a synthetic gp160 sequence is not inhibited. (a) Generation of a synthetic Env sequence (scheme). The synthetic gp160 sequence (syngp160) was generated by 15 long oligonucleotides which were PCR-amplified using primers with the indicated restriction sites. Amplification products were sequentially cloned into plasmids containing adapted multicloning sites and subcloned into a pCDM7-derived expression plasmid. sp, signal peptide; v1 to v5, variable regions; fp, fusion peptide; tm, transmembrane region; up-arrow , cleavage site. (b) RT-PCR analysis of nuclear and cytoplasmic RNA isolated from 293T cells transiently transfected with wild-type gp160. RNA was isolated by CsC1 gradient isolation to avoid contamination with plasmid DNA and, after DNase treatment, transcribed into cDNA using an oligo(dT) primer. Subsequently, the cDNA was used as a PCR template with either gp160 or actin primers. PCR products were separated on an agarose gel, blotted onto a polyvinylidene difluoride membrane, and subsequently hybridized with a gp160-specific probe. Quantitative analysis was performed using Image Master ID Elite software (Amersham Pharmacia Biotech). (c) RT-PCR analysis of nuclear and cytoplasmic RNA isolated from 293T cells transiently transfected with syngp160.

To test whether the identified sequence elements are also responsible for inhibited surface expression in the homologous context, we decided to generate a synthetic gp160 gene in which the primary sequence codons have been replaced by synonymous codons. In the HIV-1 env gene, codons with either adenine or thymine at the third codon position are preferentially used (11; P. Grantham and P. Perrin, Letter, Nature 319:727-728, 1986). We substituted codons with guanine or cytosine for most codons with adenine or thymine at the third position. The synthetic gp160 sequence (syngp160) was generated by long 150- to 200-mer oligonucleotides, which were amplified by PCR and sequentially cloned into two plasmids containing suitable polylinkers. Finally, the two sequences coding for gp120 and gp41 were subcloned into a pCDM7-based expression plasmid containing the immediate-early promoter of human cytomegalovirus and tested by Western blot analysis of cell lysates from transiently transfected cells for the correct length (Fig. 7a). RT-PCR analysis of nuclear and cytoplasmic mRNA indicated that in contrast to the wild-type env sequence, the syngp160 mRNA is not retained in the nucleus (Fig. 7c). More than 40% of the syngp160 mRNA was found in the cytoplasmic fraction, similarly to actin mRNA (48% in the cytoplasmic fraction). Since we were unable to detect intron-containing transcripts in the cytoplasmic fractions by RT-PCR using primers annealing in the intron (the vector used contains a small intron in the 3' untranslated region), we conclude that the cytosolic fractions were properly isolated and not contaminated by nuclear RNA (data not shown).

Deletion of the gp41 cytoplasmic domain considerably increased surface expression in 293T cells stably or transiently transfected (Fig. 8). Quantitative flow-cytometric analysis of 293T cells transiently transfected with either syngp160 or syngp160Delta cyt indicated that surface expression was reduced to less than 20% by the cytoplasmic domain (Fig. 8c). In contrast, the total cellular glycoprotein amount was similar in the Western blot analysis, indicating that reduced surface expression was not due to decreased production rates (Fig. 8d). Similarly to the results in the two heterologous systems, elimination of both is1 and is2 (syngp160Delta is1+2) resulted in an almost fourfold increase of surface expression compared to syngp160 containing the complete cytoplasmic domain, suggesting that the two elements is1 and is2 act similarly in the context of homologous Env.


View larger version (25K):
[in this window]
[in a new window]
 
FIG. 8.   Deletion of is1 and is2 restores surface expression of Env. (a) Schematic diagram of the syngp160 constructs used to evaluate surface expression. (b) The cytoplasmic domain of gp41 is responsible for suppressed surface expression. HeLa cells were stably transfected with syngp160 and syngp160Delta cyt using a bovine papillomavirus-based, replicating vector. Nonpermeabilized bulk cultures were stained with the Env-specific human antiserum 95-1 and a FITC-conjugated secondary antibody and subsequently analyzed by flow cytometry. As a negative control (dashed line), cells were treated only with the secondary antibody. (c) Quantitative analysis of Env surface expression. 293T cells transiently transfected with either syngp160, syngp160Delta cyt, or syngp160Delta is1+2 were stained with the Env-specific human antiserum 95-1 and a FITC-conjugated secondary antibody without prior permeabilization and subsequently analyzed by flow cytometry. Surface expression (mean ± standard error of the mean of seven independent experiments) was calculated by subtracting the mean of the negative control from the mean of the cells stained with both the primary and the secondary antibody. (d) Western blot analysis of 293T cells transiently transfected with either syngp160, syngp160Delta cyt, or syngp160Delta is1+2. Cells from one experiment were split into two groups and used for either immunofluorescence or Western blotting. The Western blot was reacted with the Env-specific human antiserum 95-1.


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

In this study, we were able to identify sequence elements in the cytoplasmic tail of the HIV-1 Env glycoprotein which inhibit cell surface expression. To investigate post-ER events without interference of ER-retained, misfolded glycoprotein, we used two heterologous systems. We found that two elements, is1 and is2, inhibit surface expression and induce localization to the Golgi. Generally, Golgi localization can be caused by either retrieval or retention signals. Retention signals of resident Golgi transmembrane proteins are located mainly in the transmembrane domain (44, 46). Two models have been proposed for transmembrane Golgi retention motifs: the first is based on retention through oligomerization to large aggregates, and the second postulates retention through a different length of membrane-spanning domains regarding the differences in membrane thickness along the exocytic pathway. Retrieval signals have been found in several trans-Golgi proteins that recycle between the plasma membrane and the Golgi complex and are composed of either tyrosine-based or dileucine motifs (8, 51, 59).

The gp41 cytoplasmic domain is a strong inducer of endocytosis, and is1 and is2 appear to act predominantly as retrieval motifs (data not shown). In time course analyses, approximately 40% of a chimeric CD4 molecule with the cytoplasmic gp41 domain was endocytosed after 15 min, and 60% was endocytosed after 60 min (data not shown). In contrast, only approximately 5% of the CD4 control molecule without the cytoplasmic gp41 domain was internalized after 15 min, and 10% after 60 min. Similar results were presented in a recent study with recombinant vaccinia virus expressing gp160 with or without the cytoplasmic domain (58). In this study, it was found that >50% of the gp160 was internalized after 60 min, but only approximately 15% was internalized if the cytoplasmic domain was absent. A membrane-proximal, tyrosine-based YXXPhi motif (aa 713 to 716) was recently found to mediate endocytosis of gp160 (4, 58). This motif appears to be bound by clathrin-associated m1 and m2 subunits of AP adaptor complexes, and its function is suppressed in the presence of the HIV-1 Gag precursor polyprotein (4, 19). However, both groups report that additional determinants distal to the YXXPhi motif may be involved (4, 58). Intriguingly, we observed only little or no effect of the gp160 amino acids 707 to 749 including the YXXPhi motif (Fig. 1) (CD4Delta 749, CD4Delta 738, and CD4Delta 728) on steady-state surface expression (in comparison to results with CD4Delta cyt) in this study. We conclude that in terms of steady-state surface expression, the two membrane-distal elements is1 and is2 determined in this study are even more important than the proximal tyrosine-based YXXPhi motif.

The gp41 cytoplasmic domain (148 aa) contains several dileucine motifs known to mediate Golgi retrieval in a variety of other molecules (1). The dileucine motifs present in is2 appear to be rather conserved between different isolates (Fig. 9). The aa 784/5 dileucine motif was found to be completely conserved between all consensus subtype A to D sequences, and in the aa 776/7 dileucine motif the first leucine was found to be replaced by an isoleucine in the subtype A, C, and D consensus sequences. Previous reports have shown that isoleucine-leucine motifs act similarly as a dileucine motif in Golgi retrieval (47). In this study, the two dileucine motifs present in is2 were not sufficient to inhibit surface expression and needed additional sequence context to inhibit surface expression.


View larger version (49K):
[in this window]
[in a new window]
 
FIG. 9.   is1 and is2 are conserved between different HIV-1 isolates. The gp41 cytoplasmic domain (aa 707 to 856) of the HIV-1 MN isolate and the consensus sequences of subtype A, B, C, and D isolates (according to the Los Alamos National Library Database) were compared using standard software of the University of Wisconsin Genetics Computer Group (CLUSTAL program). The Golgi retention or retrieval motifs is1 and is2 are marked below the sequence, and identical amino acids are indicated by grey boxes.

Intriguingly, the inhibitory element is1 does not contain any known retrieval or retention signal. Beyond its rather hydrophobic structure and three leucine residues in an equal distance of seven amino acids, there are no other apparent features of this motif. The inhibitory element is2 is nearly identical to the previously identified lentivirus lytic peptide LLP2 (aa 768 to 788), which was described (together with the lentivirus lytic peptide LLP1 (aa 828 to 855) as an amphipathic structure that associates with membranes and was reported to alter membrane permeability by channel formation (20, 40, 41, 65, 68). Furthermore, LLPs possess calmodulin-binding capacity, modulate intracellular signaling, and contribute to the cytopathogenic effect of Env (3, 34, 41).

In HIV-1 and other retroviruses, glycoprotein surface expression is strictly regulated. Willey and colleagues reported that in HIV-1-infected peripheral blood mononuclear cells, less than 15% of the total gp160 amount is cleaved to gp120 within 24 h, indicating that the majority of the protein is not transported to the plasma membrane (69). In this study, we show that the cytoplasmic domain is responsible for restricted expression, which is in accordance with previous reports indicating its involvement in intracellular trafficking, surface expression, and incorporation into virus particles (52, 55, 70). There are several lines of evidence suggesting that restricted surface expression of glycoproteins is crucial for the virus in vivo. Whereas in vitro culture of SIV and HIV-2 selects for TM truncations, revertants which express full-length Env again can be detected after administration of SIV mutants with truncated cytoplasmic TM domains into rhesus macaques (37). Second, the virus has obviously developed several independent strategies on different levels to suppress glycoprotein expression: inhibition of mRNA transport and glycoprotein Golgi retention or retrieval, both of which appear to be highly coordinated (19, 21, 23, 38). Stressing their importance, both strategies appear to be conserved in all HIV-1 viruses independently of subtype or isolate, despite the high mutation rate. In accordance with this observation, the main features of the two elements, is1 and is2, presented in this report appear to be conserved between different isolates (Fig. 9). Currently, we have no hints for an alternative function of Golgi retention or retrieval of the Env glycoprotein. The elimination of the YXXPhi motif, for example, had no effect on major histocompatibility complex class II-restricted presentation of Env-derived peptides (58).

The transcripts of the synthetic sequence with synonymous codons generated in this study were not retained within the nucleus, indicating that the approach to eliminating inherent, poorly localized negative elements by synonymous codons might represent a novel strategy to increase viral glycoprotein expression (Fig. 7). Due to a direct interaction between Env and viral matrix proteins, the carboxy-terminal end of the gp41 cytoplasmic domain appears to influence the incorporation of glycoproteins into virions (13, 15, 16, 22, 25, 28, 39, 72, 73). Thus, the gp160 mutant with the short internal deletion of is1 and is2, syngp160Delta is1-2, which is considerably more highly expressed at the cell surface in comparison to wild-type Env, should still be incorporated into virus particles. In consequence, this construct might prove to be useful for further studies on HIV-1 Env-pseudotyped viruses and for gene therapeutical applications, since elements necessary for virion incorporation are still present.


    ACKNOWLEDGMENTS

We acknowledge the expert technical assistance of Anja Weiss. Monoclonal antibody EH12E1 was provided through the courtesy of R. B. Ferns by the NIBSC Centralised Facility for AIDS Reagents.

This work was supported by grants of the Deutsche Forschungsgemeinschaft (HA 1754/2-1 and SFB464 B6).


    FOOTNOTES

* Corresponding author. Mailing address: Max von Pettenkofer-Institut, Genzentrum, LMU München, Feodor-Lynen-Str. 25, 81377 Munich, Germany. Phone: 49 89 2180 6852. Fax: 49 89 2180 6899. E-mail: haas{at}lmb.uni-muenchen.de.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Aiken, C., J. Konner, N. R. Landau, M. E. Lenburg, and D. Trono. 1994. Nef induces CD4 endocytosis: requirement for a critical dileucine motif in the membrane-proximal CD4 cytoplasmic domain. Cell 76:853-864[CrossRef][Medline].
2. Amendt, B. A., D. Hesslein, L. J. Chang, and C. M. Stoltzfus. 1994. Presence of negative and positive cis-acting RNA splicing elements within and flanking the first tat coding exon of human immunodeficiency virus type 1. Mol. Cell. Biol. 14:3960-3970[Abstract/Free Full Text].
3. Beary, T. P., S. B. Tencza, T. A. Mietzner, and R. C. Montelaro. 1998. Interruption of T-cell signal transduction by lentivirus lytic peptides from HIV-1 transmembrane protein. J. Pept. Res. 51:75-79[Medline].
4. Berlioz-Torrent, C., B. L. Shacklett, L. Erdtmann, L. Delamarre, I. Bouchaert, P. Sonigo, M. C. Dokhelar, and R. Benarous. 1999. Interactions of the cytoplasmic domains of human and simian retroviral transmembrane proteins with components of the clathrin adaptor complexes modulate intracellular and cell surface expression of envelope glycoproteins. J. Virol. 73:1350-1361[Abstract/Free Full Text].
5. Bernstein, H. B., and R. W. Compans. 1992. Sulfation of the human immunodeficiency virus envelope glycoprotein. J. Virol. 66:6953-6959[Abstract/Free Full Text].
6. Bird, C., J. Burke, P. A. Gleeson, and J. McCluskey. 1990. Expression of human immunodeficiency virus 1 (HIV-1) envelope gene products transcribed from a heterologous promoter. Kinetics of HIV-1 envelope processing in transfected cells. J. Biol. Chem. 265:19151-19157[Abstract/Free Full Text].
7. Brighty, D. W., and M. Rosenberg. 1994. A cis-acting repressive sequence that overlaps the Rev-responsive element of human immunodeficiency virus type 1 regulates nuclear retention of env mRNAs independently of known splice signals. Proc. Natl. Acad. Sci. USA 91:8314-8318[Abstract/Free Full Text].
8. Bryant, N. J., and T. H. Stevens. 1997. Two separate signals act independently to localize a yeast late Golgi membrane protein through a combination of retrieval and retention. J. Cell Biol. 136:287-297[Abstract/Free Full Text].
9. Bültmann, A., J. Eberle, and J. Haas. 2000. Ubiquitination of the human immunodeficiency virus type 1 (HIV-1) Env glycoprotein. J. Virol. 74:5373-5376[Abstract/Free Full Text].
10. Chakrabarti, L., M. Emerman, P. Tiollais, and P. Sonigo. 1989. The cytoplasmic domain of simian immunodeficiency virus transmembrane protein modulates infectivity. J. Virol. 63:4395-4403[Abstract/Free Full Text].
11. Chou, K. C., and C. T. Zhang. 1992. Diagrammatization of codon usage in 339 human immunodeficiency virus proteins and its biological implication. AIDS Res. Hum. Retrovir. 8:1967-1976[Medline].
12. Cochrane, A. W., K. S. Jones, S. Beidas, P. J. Dillon, A. M. Skalka, and C. A. Rosen. 1991. Identification and characterization of intragenic sequences which repress human immunodeficiency virus structural gene expression. J. Virol. 65:5305-5313[Abstract/Free Full Text].
13. Cosson, P. 1996. Direct interaction between the envelope and matrix proteins of HIV-1. EMBO J. 15:5783-5788[Medline].
14. Dewar, R. L., M. B. Vasudevachari, V. Natarajan, and N. P. Salzman. 1989. Biosynthesis and processing of human immunodeficiency virus type 1 envelope glycoproteins: effects of monensin on glycosylation and transport. J. Virol. 63:2452-2456[Abstract/Free Full Text].
15. Dorfman, T., F. Mammano, W. A. Haseltine, and H. G. Gottlinger. 1994. Role of the matrix protein in the virion association of the human immunodeficiency virus type 1 envelope glycoprotein. J. Virol. 68:1689-1696[Abstract/Free Full Text].
16. Dubay, J. W., S. J. Roberts, B. H. Hahn, and E. Hunter. 1992. Truncation of the human immunodeficiency virus type 1 transmembrane glycoprotein cytoplasmic domain blocks virus infectivity. J. Virol. 66:6616-6625[Abstract/Free Full Text].
17. Earl, P. L., R. W. Doms, and B. Moss. 1990. Oligomeric structure of the human immunodeficiency virus type 1 envelope glycoprotein. Proc. Natl. Acad. Sci. USA 87:648-652[Abstract/Free Full Text].
18. Earl, P. L., B. Moss, and R. W. Doms. 1991. Folding, interaction with GRP78-BiP, assembly, and transport of the human immunodeficiency virus type 1 envelope protein. J. Virol. 65:2047-2055[Abstract/Free Full Text].
19. Egan, M. A., L. M. Carruth, J. F. Rowell, X. Yu, and R. F. Siliciano. 1996. Human immunodeficiency virus type 1 envelope protein endocytosis mediated by a highly conserved intrinsic internalization signal in the cytoplasmic domain of gp41 is suppressed in the presence of the Pr55gag precursor protein. J. Virol. 70:6547-6556[Abstract/Free Full Text].
20. Eisenberg, D., and M. Wesson. 1990. The most highly amphiphilic alpha-helices include two amino acid segments in human immunodeficiency virus glycoprotein 41. Biopolymers 29:171-177[CrossRef][Medline].
21. Emerman, M., R. Vazeux, and K. Peden. 1989. The rev gene product of the human immunodeficiency virus affects envelope-specific RNA localization. Cell 57:1155-1165[CrossRef][Medline].
22. Facke, M., A. Janetzko, R. L. Shoeman, and H. G. Krausslich. 1993. A large deletion in the matrix domain of the human immunodeficiency virus gag gene redirects virus particle assembly from the plasma membrane to the endoplasmic reticulum. J. Virol. 67:4972-4980[Abstract/Free Full Text].
23. Felber, B. K., C. M. Hadzopoulou, C. Cladaras, T. Copeland, and G. N. Pavlakis. 1989. rev protein of human immunodeficiency virus type 1 affects the stability and transport of the viral mRNA. Proc. Natl. Acad. Sci. USA 86:1495-1499[Abstract/Free Full Text].
24. Fenouillet, E., and I. M. Jones. 1995. The glycosylation of human immunodeficiency virus type 1 transmembrane glycoprotein (gp41) is important for the efficient intracellular transport of the envelope precursor gp160. J. Gen. Virol. 76:1509-1514[Abstract/Free Full Text].
25. Freed, E. O., and M. A. Martin. 1995. Virion incorporation of envelope glycoproteins with long but not short cytoplasmic tails is blocked by specific, single amino acid substitutions, in the human immunodeficiency virus type 1 matrix. J. Virol. 69:1984-1989[Abstract].
26. Gabuzda, D. H., A. Lever, E. Terwilliger, and J. Sodroski. 1992. Effects of deletions in the cytoplasmic domain on biological functions of human immunodeficiency virus type 1 envelope glycoproteins. J. Virol. 66:3306-3315[Abstract/Free Full Text].
27. Haas, J., E. C. Park, and B. Seed. 1996. Codon usage limitation in the expression of HIV-1 envelope glycoprotein. Curr. Biol. 6:315-324[CrossRef][Medline].
28. Haffar, O. K., G. R. Nakamura, and P. W. Berman. 1990. The carboxy terminus of human immunodeficiency virus type 1 gp160 limits its proteolytic processing and transport in transfected cell lines. J. Virol. 64:3100-3103[Abstract/Free Full Text].
29. Hallenberger, S., V. Bosch, H. Angliker, E. Shaw, H. D. Klenk, and W. Garten. 1992. Inhibition of furin-mediated cleavage activation of HIV-1 glycoprotein gp160. Nature 360:358-361[CrossRef][Medline].
30. Hallenberger, S., S. P. Tucker, R. J. Owens, H. B. Bernstein, and R. W. Compans. 1993. Secretion of a truncated form of the human immunodeficiency virus type 1 envelope glycoprotein. Virology 193:510-514[CrossRef][Medline].
31. Jabbar, M. A., and D. P. Nayak. 1990. Intracellular interaction of human immunodeficiency virus type 1 (ARV-2) envelope glycoprotein gp160 with CD4 blocks the movement and maturation of CD4 to the plasma membrane. J. Virol. 64:6297-6304[Abstract/Free Full Text].
32. Kimura, T., M. Nishikawa, and J. Fujisawa. 1996. Uncleaved env gp160 of human immunodeficiency virus type 1 is degraded within the Golgi apparatus but not lysosomes in COS-1 cells. FEBS Lett. 390:15-20[CrossRef][Medline].
33. Kolanus, W., W. Nagel, B. Schiller, L. Zeitlmann, S. Godar, H. Stockinger, and B. Seed. 1996. Alpha L beta 2 integrin/LFA-1 binding to ICAM-1 induced by cytohesin-1, a cytoplasmic regulatory molecule. Cell 86:233-242[CrossRef][Medline].
34. Kort, J. J. 1998. Impairment of excitatory amino acid transport in astroglial cells infected with the human immunodeficiency virus type 1. AIDS Res. Hum. Retrovir. 14:1329-1339[Medline].
35. Leonard, C. K., M. W. Spellman, L. Riddle, R. J. Harris, J. N. Thomas, and T. J. Gregory. 1990. Assignment of intrachain disulfide bonds and characterization of potential glycosylation sites of the type 1 recombinant human immunodeficiency virus envelope glycoprotein (gp120) expressed in Chinese hamster ovary cells. J. Biol. Chem. 265:10373-10382[Abstract/Free Full Text].
36. Li, Y., J. J. Bergeron, L. Luo, W. J. Ou, D. Y. Thomas, and C. Y. Kang. 1996. Effects of inefficient cleavage of the signal sequence of HIV-1 gp 120 on its association with calnexin, folding, and intracellular transport. Proc. Natl. Acad. Sci. USA 93:9606-9611[Abstract/Free Full Text].
37. Luciw, P. A., K. E. Shaw, B. L. Shacklett, and M. L. Marthas. 1998. Importance of the intracytoplasmic domain of the simian immunodeficiency virus (SIV) envelope glycoprotein for pathogenesis. Virology 252:9-16[CrossRef][Medline].
38. Malim, M. H., J. Hauber, S. Y. Le, J. V. Maizel, and B. R. Cullen. 1989. The HIV-1 rev trans-activator acts through a structured target sequence to activate nuclear export of unspliced viral mRNA. Nature 338:254-257[CrossRef][Medline].
39. Mammano, F., F. Salvatori, S. Indraccolo, R. A. De, B. L. Chieco, and H. G. Gottlinger. 1997. Truncation of the human immunodeficiency virus type 1 envelope glycoprotein allows efficient pseudotyping of Moloney murine leukemia virus particles and gene transfer into CD4+ cells. J. Virol. 71:3341-3345[Abstract].
40. Miller, M. A., R. F. Garry, J. M. Jaynes, and R. C. Montelaro. 1991. A structural correlation between lentivirus transmembrane proteins and natural cytolytic peptides. AIDS Res. Hum. Retrovir. 7:511-519[Medline].
41. Miller, M. A., T. A. Mietzner, M. W. Cloyd, W. G. Robey, and R. C. Montelaro. 1993. Identification of a calmodulin-binding and inhibitory peptide domain in the HIV-1 transmembrane glycoprotein. AIDS Res. Hum. Retrovir. 9:1057-1066[Medline].
42. Morikawa, Y., E. Barsov, and I. Jones. 1993. Legitimate and illegitimate cleavage of human immunodeficiency virus glycoproteins by furin. J. Virol. 67:3601-3604[Abstract/Free Full Text].
43. Mulligan, M. J., G. V. Yamshchikov, G. D. Ritter, F. Gao, M. J. Jin, C. D. Nail, C. P. Spies, B. H. Hahn, and R. W. Compans. 1992. Cytoplasmic domain truncation enhances fusion activity by the exterior glycoprotein complex of human immunodeficiency virus type 2 in selected cell types. J. Virol. 66:3971-3975[Abstract/Free Full Text].
44. Munro, S. 1995. An investigation of the role of transmembrane domains in Golgi protein retention. EMBO J. 14:4695-4704[Medline].
45. Nasioulas, G., A. S. Zolotukhin, C. Tabernero, L. Solomin, C. P. Cunningham, G. N. Pavlakis, and B. K. Felber. 1994. Elements distinct from human immunodeficiency virus type 1 splice sites are responsible for the Rev dependence of env mRNA. J. Virol. 68:2986-2993[Abstract/Free Full Text].
46. Nilsson, T., and G. Warren. 1994. Retention and retrieval in the endoplasmic reticulum and the Golgi apparatus. Curr. Opin. Cell Biol. 6:517-521[CrossRef][Medline].
47. Orsini, M. J., J. L. Parent, S. J. Mundell, and J. L. Benovic. 1999. Trafficking of the HIV coreceptor CXCR4. Role of arrestins and identification of residues in the c-terminal tail that mediate receptor internalization. J. Biol. Chem. 274:31076-31086[Abstract/Free Full Text].
48. Otteken, A., P. L. Earl, and B. Moss. 1996. Folding, assembly, and intracellular trafficking of the human immunodeficiency virus type 1 envelope glycoprotein analyzed with monoclonal antibodies recognizing maturational intermediates. J. Virol. 70:3407-3415[Abstract].
49. Otteken, A., and B. Moss. 1996. Calreticulin interacts with newly synthesized human immunodeficiency virus type 1 envelope glycoprotein, suggesting a chaperone function similar to that of calnexin. J. Biol. Chem. 271:97-103[Abstract/Free Full Text].
50. Pal, R., G. M. Hoke, and M. G. Sarngadharan. 1989. Role of oligosaccharides in the processing and maturation of envelope glycoproteins of human immunodeficiency virus type 1. Proc. Natl. Acad. Sci. USA 86:3384-3388[Abstract/Free Full Text].
51. Ponnambalam, S., C. Rabouille, J. P. Luzio, T. Nilsson, and G. Warren. 1994. The TGN38 glycoprotein contains two non-overlapping signals that mediate localization to the trans-Golgi network. J. Cell Biol. 125:253-268[Abstract/Free Full Text].
52. Puddington, L., C. E. Machamer, and J. K. Rose. 1986. Cytoplasmic domains of cellular and viral integral membrane proteins substitute for the cytoplasmic domain of the vesicular stomatitis virus glycoprotein in transport to the plasma membrane. J. Cell Biol. 102:2147-2157[Abstract/Free Full Text].
53. Raja, N. U., M. J. Vincent, and M. A. Jabbar. 1993. Analysis of endoproteolytic cleavage and intracellular transport of human immunodeficiency virus type 1 envelope glycoproteins using mutant CD4 molecules bearing the transmembrane endoplasmic reticulum retention signal. J. Gen. Virol. 74:2085-2097[Abstract/Free Full Text].
54. Ritter, G. D., M. J. Mulligan, S. L. Lydy, and R. W. Compans. 1993. Cell fusion activity of the simian immunodeficiency virus envelope protein is modulated by the intracytoplasmic domain. Virology 197:255-264[CrossRef][Medline].
55. Rose, J. K., and J. E. Bergmann. 1983. Altered cytoplasmic domains affect intracellular transport of the vesicular stomatitis virus glycoprotein. Cell 34:513-524[CrossRef][Medline].
56. Rosen, C. A., E. Terwilliger, A. Dayton, J. G. Sodroski, and W. A. Haseltine. 1988. Intragenic cis-acting art gene-responsive sequences of the human immunodeficiency virus. Proc. Natl. Acad. Sci. USA 85:2071-2075[Abstract/Free Full Text].
57. Rowell, J. F., A. L. Ruff, F. G. Guarnieri, O. K. Staveley, X. Lin, J. Tang, J. T. August, and R. F. Siliciano. 1995. Lysosome-associated membrane protein-1-mediated targeting of the HIV-1 envelope protein to an endosomal/lysosomal compartment enhances its presentation to MHC class II-restricted T cells. J. Immunol. 155:1818-1828[Abstract].
58. Rowell, J. F., P. E. Stanhope, and R. F. Siliciano. 1995. Endocytosis of endogenously synthesized HIV-1 envelope protein. Mechanism and role in processing for association with class II MHC. J. Immunol. 155:473-488[Abstract].
59. Schafer, W., A. Stroh, S. Berghofer, J. Seiler, M. Vey, M. L. Kruse, H. F. Kern, H. D. Klenk, and W. Garten. 1995. Two independent targeting signals in the cytoplasmic domain determine trans-Golgi network localization and endosomal trafficking of the proprotein convertase furin. EMBO J. 14:2424-2435[Medline].
60. Schwartz, S., M. Campbell, G. Nasioulas, J. Harrison, B. K. Felber, and G. N. Pavlakis. 1992. Mutational inactivation of an inhibitory sequence in human immunodeficiency virus type 1 results in Rev-independent gag expression. J. Virol. 66:7176-7182[Abstract/Free Full Text].
61. Schwartz, S., B. K. Felber, and G. N. Pavlakis. 1992. Distinct RNA sequences in the gag region of human immunodeficiency virus type 1 decrease RNA stability and inhibit expression in the absence of Rev protein. J. Virol. 66:150-159[Abstract/Free Full Text].
62. Seed, B., and A. Aruffo. 1987. Molecular cloning of the CD2 antigen, the T-cell erythrocyte receptor, by a rapid immunoselection procedure. Proc. Natl. Acad. Sci. USA 84:3365-3369[Abstract/Free Full Text].
63. Spies, C. P., and R. W. Compans. 1994. Effects of cytoplasmic domain length on cell surface expression and syncytium-forming capacity of the simian immunodeficiency virus envelope glycoprotein. Virology 203:8-19[CrossRef][Medline].
64. Spies, C. P., G. D. Ritter, M. J. Mulligan, and R. W. Compans. 1994. Truncation of the cytoplasmic domain of the simian immunodeficiency virus envelope glycoprotein alters the conformation of the external domain. J. Virol. 68:585-591[Abstract/Free Full Text].
65. Srinivas, S. K., R. V. Srinivas, G. M. Anantharamaiah, J. P. Segrest, and R. W. Compans. 1992. Membrane interactions of synthetic peptides corresponding to amphipathic helical segments of the human immunodeficiency virus type-1 envelope glycoprotein. J. Biol. Chem. 267:7121-7127[Abstract/Free Full Text].
66. Stein, B. S., and E. G. Engleman. 1990. Intracellular processing of the gp160 HIV-1 envelope precursor. Endoproteolytic cleavage occurs in a cis or medial compartment of the Golgi complex. J. Biol. Chem. 265:2640-2649[Abstract/Free Full Text].
67. Tsujimoto, H., R. W. Cooper, T. Kodama, M. Fukasawa, T. Miura, Y. Ohta, K. Ishikawa, M. Nakai, E. Frost, G. E. Roelants, et al. 1988. Isolation and characterization of simian immunodeficiency virus from mandrills in Africa and its relationship to other human and simian immunodeficiency viruses. J. Virol. 62:4044-4050[Abstract/Free Full Text].
68. Venable, R. M., R. W. Pastor, B. R. Brooks, and F. W. Carson. 1989. Theoretically determined three-dimensional structures for amphipathic segments of the HIV-1 gp41 envelope protein. AIDS Res. Hum. Retrovir. 5:7-22[Medline].
69. Willey, R. L., J. S. Bonifacino, B. J. Potts, M. A. Martin, and R. D. Klausner. 1988. Biosynthesis, cleavage, and degradation of the human immunodeficiency virus 1 envelope glycoprotein gp160. Proc. Natl. Acad. Sci. USA 85:9580-9584[Abstract/Free Full Text].
70. Wills, J. W., R. V. Srinivas, and E. Hunter. 1984. Mutations of the Rous sarcoma virus env gene that affect the transport and subcellular location of the glycoprotein products. J. Cell Biol. 99:2011-2023[Abstract/Free Full Text].
71. Yang, C., and R. W. Compans. 1996. Palmitoylation of the murine leukemia virus envelope glycoprotein transmembrane subunits. Virology 221:87-97[CrossRef][Medline].
72. Yu, X., X. Yuan, M. F. McLane, T. H. Lee, and M. Essex. 1993. Mutations in the cytoplasmic domain of human immunodeficiency virus type 1 transmembrane protein impair the incorporation of Env proteins into mature virions. J. Virol. 67:213-221[Abstract/Free Full Text].
73. Zaides, V., M. Yagello, T. Veselovskaya, D. Schmitt, L. Rykova, E. Fenouillet, and J. C. Gluckman. 1994. Extensive C-terminal deletion in human immunodeficiency virus type 1 Env glycoprotein arising after long-term culture of chronically infected cells. J. Gen. Virol. 75:2963-2975[Abstract/Free Full Text].
74. Zingler, K., and D. R. Littman. 1993. Truncation of the cytoplasmic domain of the simian immunodeficiency virus envelope glycoprotein increases Env incorporation into particles and fusogenici