Previous Article | Next Article ![]()
Journal of Virology, June 2001, p. 5197-5204, Vol. 75, No. 11
Department of
Pathology1 and The Fearing Laboratory
and The Division of Reproductive Endocrinology and Fertility,
Department of Obstetrics, Gynecology, and Reproductive Biology, Brigham
and Women's Hospital,2 Harvard Medical
School, Boston, Massachusetts 02115
Received 24 January 2001/Accepted 12 March 2001
The human cytomegalovirus-encoded US2 glycoprotein targets
endoplasmic reticulum-resident major histocompatibility complex (MHC)
class I heavy chains for rapid degradation by the proteasome. We
demonstrate that the endoplasmic reticulum-lumenal domain of US2 allows
tight interaction with class I molecules encoded by the HLA-A locus.
Recombinant soluble US2 binds properly folded, peptide-containing
recombinant HLA-A2 molecules in a peptide sequence-independent manner,
consistent with US2's ability to broadly downregulate class I
molecules. The physicochemical properties of the US2/MHC class I
complex suggest a 1:1 stoichiometry. These results demonstrate that US2
does not require additional cellular proteins to specifically interact
with soluble class I molecules. Binding of US2 does not significantly
alter the conformation of class I molecules, as a soluble T-cell
receptor can simultaneously recognize class I molecules associated with
US2. The lumenal domain of US2 can differentiate between the products
of distinct class I loci, as US2 binds several HLA-A locus products
while being unable to bind recombinant HLA-B7, HLA-B27, HLA-Cw4, or
HLA-E. We did not observe interaction between soluble US2 and either
recombinant HLA-DR1 or recombinant HLA-DM. The substrate specificity of
US2 may help explain the presence in human cytomegalovirus of multiple
strategies for downregulation of MHC class I molecules.
The human cytomegalovirus (HCMV) is
a ubiquitous betaherpesvirus that causes persistent infection following
primary exposure. Infectious HCMV is secreted for extended periods from
numerous sites upon primary infection, and in common with other known
human herpesviruses, HCMV establishes latency (4). HCMV
can reactivate from latent infection of myeloid lineage cells years
after acute infection, even in a fully primed immunocompetent host
(28). This lifestyle requires HCMV to disarm several
components of the immune response, in particular the major
histocompatibility complex (MHC) class I antigen presentation pathway.
MHC class I molecules are heterotrimeric complexes composed of a
polymorphic heavy chain, the invariant
Although CD8+ cytotoxic T lymphocytes respond to
peptides derived from several HCMV immediate-early virus gene products,
it has been difficult to find cytotoxic T lymphocytes specific for the
more abundant and diverse set of proteins expressed later in the virus
life cycle (3, 26). The concerted action of a series of
glycoproteins encoded by HCMV unique short (US) genes disrupts surface
expression of class I molecules and likely contributes to this absence
of CD8+ T-cell recognition (17).
Indeed, HCMV prevents the production and display of antigenic peptides
by several seemingly independent mechanisms (32). The US3
glycoprotein, whose ER-lumenal domain shares approximately 20%
sequence identity with US2, retains class I molecules in the ER during
the immediate-early period of virus infection (1, 18). The
US3 ER-lumenal and transmembrane domains are each required for
association with class I molecules (20). During the early
period of virus infection, the ER-resident glycoproteins US2 and US11
independently bind to newly synthesized MHC class I molecules in the ER
and redirect the class I heavy chains to the cytosol, via the Sec61
translocon. Within the cytosol, the class I heavy chains are rapidly
deglycosylated and degraded by the proteasome (35, 36).
The dislocation reaction is sensitive to changes in redox conditions,
and the cytoplasmic tail of the class I heavy chain is required for
degradation (30, 33). However, the molecular details of
how either US2 or US11 targets class I for destruction remain obscure.
A growing number of viruses are known to encode factors that
downregulate the surface expression of class I molecules
posttranslationally, including human immunodeficiency virus (HIV),
Kaposi's sarcoma-associated herpesvirus (KSHV), adenovirus, murine
cytomegalovirus, and murine gammaherpesvirus 68 (29, 32).
Several of these virus gene products selectively target HLA-A and HLA-B
locus products, including US2 and US11, KSHV K5, and HIV Nef. The locus
specificity of the KSHV K5 product derives largely from interactions
within the membrane (15), while HIV Nef relies on
polymorphisms in the cytoplasmic tail of class I molecules to
selectively interfere with class I presentation (5).
While HCMV interferes with transcription of MHC class II molecules
(24), it has further been suggested that US2 might target MHC class II HLA-DR and HLA-DM for degradation (31).
HLA-DM facilitates peptide loading of class II molecules, which present peptides derived from extracellular proteins to
CD4+ T cells (16). Notwithstanding
their similar folding patterns, the considerable sequence disparity
between class I molecules and the DR or DM MHC class II complexes
raises the question of how US2 can engage this rather divergent set of glycoproteins.
US2 is a 199-amino-acid membrane protein, with an ER-lumenal portion, a
predicted single transmembrane domain, and a short cytoplasmic tail.
The absence of a cleavable signal sequence at the N terminus is unusual
for a glycoprotein that otherwise resembles a typical type I membrane
protein. The regions of US2 that are responsible for class I
degradation are not characterized, and we have so far failed to detect
significant homologies between US2 and non-HCMV-encoded polypeptides.
To better understand US2 function, we have reconstituted the
interaction between recombinant forms of US2 and MHC class I. We show
that the US2 ER-lumenal domain specifically interacts with class I
molecules and enables a delineation of its class I binding preferences.
Bacterial strains and constructs.
US2 amino-terminal and
carboxy-terminal deletion mutants were constructed by PCR with
Pfu DNA polymerase (Stratagene) using a US2 cDNA template.
The 5' oligonucleotide primer GGGAATTCCATATGGGTCCCTTGATCCGCCTGCC and the 3' primer CCGCTCGAGTTAATCCACTCGCAGTTCGGGGACGC
were used to amplify US215-140. PCR
products were doubly digested using NdeI and XhoI
(New England Biolabs) and ligated into the pET27 expression vector
(Novagen). Full-length and additional deletion mutant constructs of US2
were also cloned into pET27 following PCR from a cDNA template.
0022-538X/01/$04.00+0 DOI: 10.1128/JVI.75.11.5197-5204.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Human Cytomegalovirus US2 Endoplasmic
Reticulum-Lumenal Domain Dictates Association with Major
Histocompatibility Complex Class I in a Locus-Specific Manner
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
2-microglobulin light chain
(
2m), and an antigenic peptide
(34). Proteasomal cleavage of cellular and microbial
cytosolic proteins yields peptides, some of which are delivered to the
endoplasmic reticulum (ER) by the transporter associated with antigen
processing and presentation (37). Within the ER,
chaperones facilitate peptide loading of empty class I molecules
(6). Upon receipt of peptide, class I molecules travel to
the cell surface to present the cargo to CD8+ T
cells (13).
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
2m were obtained from the laboratory of
Don C. Wiley, Harvard University, Cambridge, Mass. Inclusion bodies of
US2 constructs, HLA-A2, and HLA-E were produced in BL21(DE3).
Protein expression and inclusion body purification.
Single
bacterial colonies containing either US2, HLA-A2, or HLA-E heavy chain
constructs were grown at 37°C in Luria-Bertani medium containing 30 µg of kanamycin sulfate/ml. One hundred micrograms of ampicillin per
milliliter was added to cultures expressing HLA-A68, HLA-B7, HLA-B27,
HLA-B51, or HLA-Cw4 heavy chains or
2-microglobulin. Cultures were induced at an
optical density at 600 nm of 0.6 with 1 mM
isopropyl-
-D-thiogalactopyranoside (IPTG). Inclusion
bodies were purified as described previously (9).
Inclusion bodies were dissolved in 8 M urea-25 mM
2-(N-morpholino)ethanesulfonic acid (MES; pH 6.0)-10 mM
EDTA-1 mM dithiothreitol (DTT) (20 mM DTT was added to US2 inclusion
body resuspensions). HLA-A2-ELAGIGILTV and HLA-A2-ALGIGILTV peptide
complexes were generous gifts from Olivier Michielin, Strasbourg,
France. HLA-DM and HLA-DR1 were generous gifts from Don Wiley.
Renaturation by dilution. A 7.15-mg quantity of US2 denatured in 8 M urea-25 mM MES (pH 6.5)-10 mM sodium EDTA-20 mM DTT was added to 7.5 ml of injection buffer (3 M guanidine HCl, 10 mM sodium acetate, pH 4.2). The US2 mixture was then injected through a 27-gauge needle into 500 ml of rapidly stirred 10°C refolding buffer (100 mM Tris HCl [pH 8.3], 2 mM EDTA, 400 mM L-arginine HCl, 5 mM reduced glutathione, 0.5 mM oxidized glutathione) at a final protein concentration of 1 mM. Phenylmethylsulfonyl fluoride (0.1 mM) in isopropanol was added immediately prior to addition of US2. Refolding reaction mixtures were incubated at >10°C. US2 (7.15 mg/liter) was added twice more at 6- to 12-h intervals to the refolding mixture, and the refolding reaction mixture was incubated for an additional 24 h.
Class I molecules were refolded as described previously (7, 9). HLA-A2 was refolded with either the human T-cell leukemia virus (HTLV) Tax peptide LLFGYPVYV, the HIV reverse transcriptase (polymerase [Pol]) peptide ILKEPVHGV, or the hepatitis B virus peptide FLPSDFFPSV; HLA-A*6801 was refolded with the influenza A virus matrix protein epitope KTGGPIYKR; HLA-B*0702 was refolded with nonamer peptide APRTVALTA; HLA-B27 was refolded with peptide GRIDKPILK; HLA-Cw4 was refolded using QYDDAVYKL; and HLA-E was refolded with the HLA-B8 leader epitope VMAPRTVLL.Protein purification. US2 refolding reaction mixtures were concentrated with a pressurized stirred cell (Amicon) across membranes with a 10,000-molecular-weight cutoff and further concentrated to a volume of 200 to 500 µl using a Centricon 10 concentrator (Amicon). The resultant protein was separated by fast protein liquid chromatography on Superdex 200 or Superdex 75 gel filtration columns (Pharmacia) in 10 mM Tris (pH 8.0)-150 mM NaCl. Typical refolding yields for US215-140 ranged from 2 to 5%, although the yield could be increased somewhat by refolding US2 in the presence of purified HLA-A2. Soluble US215-140 aggregates at room temperature in the absence of class I molecules and was kept at 4 to 10°C at all times.
Class I refolding reaction mixtures were dialyzed twice for 12 h against 10 mM Tris (pH 8.0)-1 mM EDTA (molecular weight cutoff = 6,000 to 8,000). The dialyzed protein was concentrated with a DEAE cellulose (DE-52) anion-exchange column packed with 20 g of refold per liter. The partially purified class I molecules were further concentrated by a Centricon 10 concentrator and separated from the remaining contaminants by Superdex 200 fast protein liquid chromatography gel filtration in 10 mM Tris (pH 8.0)-150 mM NaCl.Native gel band shift assay. Samples were incubated in a native gel loading buffer (final concentrations, 250 mM Tris [pH 8.8], 10% glycerol) to a final volume of 40 µl. Gels of 1.5 mm in thickness and containing either 8 or 12% polyacrylamide, without a stacking gel, were run at 4°C using 25 mM Tris-190 mM glycine running buffer. Proteins were visualized with Coomassie brilliant blue R-250.
Superdex gel filtration elution assay. HLA-A2 (300 µg), US215-140 (190 µg), or HLA-A2 and US2 (300 and 190 µg, respectively) were incubated for 15 min and loaded onto an analytical Superdex 75 gel filtration column in a 100-µl volume. HLA-B7 (360 µg), US215-140 (580 µg), or HLA-B7 and US215-140 (360 and 580 µg, respectively) were incubated for 15 min and loaded onto Superdex 75 in a 200-µl volume. HLA-B27 (360 µg), US215-140 (580 µg), or HLA-B27 and US215-140 (360 and 580 µg, respectively) were likewise incubated for 15 min and loaded onto Superdex 75 in a 200-µl volume. All columns were run in 10 mM Tris (pH 8.0)-150 mM NaCl at 4°C.
| |
RESULTS |
|---|
|
|
|---|
Production of soluble US2.
US2 expression constructs that
included the predicted transmembrane coding region (residues 162 to
185) failed to yield significant levels of protein in Escherichia
coli (Fig. 1). Since preliminary studies suggested that US2 mutants comprising residues 1 to 150 retain
the ability to bind to class I in vivo, efforts to produce recombinant
US2 therefore focused on the ER-lumenal segment. The US2 amino terminus
is significantly less hydrophobic than are canonical signal sequences
(22) and fails to be cleaved upon insertion into the ER
(unpublished data). Initial attempts to produce soluble US2 were
therefore carried out with mutants possessing a native amino terminus
(Fig. 1). E. coli transformants containing expression
constructs for US21-150 and
US21-140 produced high levels of inclusion body
protein. However, attempts to refold the urea-denatured inclusion
bodies resulted in insoluble protein aggregates, which consistently
eluted in the void volume upon size exclusion chromatography.
|
|
US215-140 associates with class I molecules in
vitro
To examine whether soluble
US215-140 retains the ability to interact with soluble MHC
class I, the HLA-A2 heavy chain lacking its transmembrane and
cytoplasmic tail segments (G1 to E275) and
2m (Met1 to
Met99) were refolded in the presence of the HTLV-1 Tax peptide
LLFGYPVYV. Incubation of soluble US215-140 with
purified HLA-A2 results in the formation of a complex of a Stokes'
radius distinct from either HLA-A2 or US215-140 alone
(Fig. 2B). The magnitude of the shift in elution position of the peak
suggests a 1:1 stoichiometry of the US2/HLA-A2 complex (Fig. 2B).
Preliminary analytical ultracentrifugation studies were also most
consistent with a 1:1 stoichiometry (unpublished data). Further
increasing the concentration of soluble US2 did not appear to alter the
stoichiometry of the complex.
US2 recognizes class I molecules independently of peptide
sequence.
The ability of HLA-A2 to engage in complex
formation with US2 is conveniently monitored by native gel
electrophoresis. The binding characteristics and hence
electrophoretic mobilities for several receptors that interact with
class I molecules are influenced by the sequence of the MHC peptide
cargo. We examined the ability of US2 to bind to HLA-A2 complexes
containing different peptides of defined sequence, produced from
recombinant subunits and synthetic peptides. As determined by native
gel shift, US215-140 associates with five
distinct HLA-A2-peptide complexes containing either HTLV Tax residues
11 to 19, HIV type 1 reverse transcriptase residues 309 to 317, hepatitis B virus nucleocapsid residues 18 to 27, melanoma peptide
variant MART-1 27 to 35 (A2L), and variant MART-1 27 to 35 (A3L) (Fig.
3). The presence of
US215-140 produced a complex of lower mobility
with several additional HLA-A2-peptide complexes (unpublished data).
Differences in electrophoretic mobilities among the US2/HLA-A2/peptide
complexes result from peptide sequence variation (Fig. 3). Thus, US2
binds peptide-loaded class I molecules in a peptide
sequence-independent fashion. Peptide remains associated with class I
molecules upon US2 binding, as shown by incubation of the complex at
37°C, which allowed recovery of properly folded class I molecules
(unpublished data). Empty class I molecules are not stable at 37°C
and would have dissociated upon heating (2).
|
2m and
peptide to refold in vitro (9). We examined whether the
presence of US215-140 facilitated the refolding
of class I heavy chains in the absence of other class I components.
Folding of class I heavy chains or association between free heavy
chains and US2 was not evident in the presence of Tax peptide and
refolded US215-140 (unpublished data). In the
absence of peptide and ER chaperones, soluble class I heavy chains have
a short half-life in solution, despite high concentrations of
US215-140 and
2m. All in all, our
data suggest that US2 prefers to interact with a properly folded class I molecule in a 1:1 stoichiometry.
US215-140 maintains locus-specific binding.
US2
demonstrates locus specificity in its ability to downregulate class I
heavy chains in mammalian cells. While both HLA-A and HLA-B locus
products are susceptible to attack in cells expressing US2, HLA-C,
HLA-E, and HLA-G complexes resist US2-mediated degradation (8,
27). To examine the binding characteristics of
US215-140, a series of class I complexes were
refolded from bacterial inclusion bodies in the presence of the
appropriate peptide ligands. Purified US215-140
was incubated with either HLA-A2, HLA-Aw68, HLA-B7, or HLA-B27.
Association between class I molecules and US2 was assessed by native
gel electrophoresis. US215-140 forms complexes
with both HLA-A locus products (Fig. 4A),
but an interaction with either HLA-B7 or HLA-B27 could not be detected
at US2 concentrations that readily gel shift HLA-A2 (Fig. 4B). Further
elevation of the US2 concentration by a factor of 10 did not result in
either HLA-B7 or HLA-B27 gel shifts (unpublished data). Furthermore, neither HLA-Cw4 nor HLA-E showed any signs of interaction with soluble
US2 under conditions where the HLA-A locus products readily bind (Fig.
4B). Elevating the US2 concentration by 10-fold over the minimal
requirement to effectuate a quantitative gel shift for HLA-A2 did not
produce a class I gel shift. US2 does not target H-2
Kb for degradation (21), and
US215-140 likewise does not alter the mobility
of soluble Kb in native gel electrophoresis
(unpublished data).
|
US215-140 and TCR can simultaneously interact with MHC
class I.
It is not known whether the conformation of class I
molecules changes upon association with US2, nor is it clear exactly
where US2 interacts with MHC class I products. To examine this question in vitro, we asked whether US215-140 and T-cell
receptor (TCR) can recognize the same class I complex. Purified A6 TCR, which is specific for the HLA-A2/Tax complex (10), was
incubated with HLA-A2/Tax and US215-140. Complex
assembly was monitored by band shift in native gel electrophoresis. A
protein complex of distinct mobility is generated when HLA-A2,
US215-140, and A6 TCR are incubated together
(Fig. 5). The
HLA-A2/US215-140/TCR complex formed regardless of the
order of addition. Thus, the binding of
US215-140 to class I molecules does not
apparently induce major conformational changes in the class I complex
in solution, as the A6 TCR maintains the ability to associate with US2/class I complexes. The formation of this novel complex further suggests that US2 and TCR interact with class I molecules at distinct and nonoverlapping binding sites.
|
US215-140 does not interact with HLA-DR or
HLA-DM.
Although US2 was originally shown to downregulate
expression of class I products, US2 has been suggested to also target
for destruction components of the MHC class II antigen presentation pathway, HLA-DR
and HLA-DM
. To determine whether
US215-140 can associate with complexes in the
class II pathway, recombinant soluble HLA-DR1 and HLA-DM were incubated
with US215-140 and complex formation was
monitored by native gel electrophoresis. As shown in Fig.
6, US215-140
does not alter the mobility of either DR1 or DM complexes in native gel
electrophoresis. No gel shift was observed for DR1 or DM even in the
presence of US2 concentrations 10-fold higher than the amount required
to quantitatively bind HLA-A2 complexes. The mobility of a second DR
allele was likewise not altered in the presence of
US215-140. The preparation of DR used is known
to produce a gel shift upon complexation with the TCR under conditions
essentially identical to those used here (unpublished data). The batch
of DR used in this study was shown to catalyze peptide exchange in MHC
class II molecules.
|
| |
DISCUSSION |
|---|
|
|
|---|
Many viruses that cause persistent infections have evolved strategies to interfere with MHC class I antigen presentation (32). This report provides the first evidence for an exclusive, direct interaction between a virus protein and class I MHC products in vitro.
The ability of US215-140 to form a stable
complex with properly folded class I complexes is consistent with
biochemical data from US2-expressing cells. US2 can be recovered by
coimmunoprecipitation with a conformation-specific monoclonal antibody,
W6/32, which recognizes properly folded class I complexes.
W6/32-reactive material recovered from US2+
transfectants does not contain radiolabeled
2m
(32). However, immunoblot analysis of W6/32
immunoprecipitates from US2+ cells reveals the
presence of unlabeled
2m (unpublished data). Thus, initial complex formation, as assayed by an anti-class I antibody, involves preexisting (nonradioactive)
2m. In contrast, ER-resident glycosylated US2
cannot be recovered by polyclonal antibodies that recognize epitopes
present in unfolded heavy chains (36). The distinct
mobility of five US2/HLA-A2/peptide complexes (Fig. 3) and the ability
of the A6 TCR to recognize the US2/HLA-A2 complex (Fig. 5) indicate
that US2 can bind peptide-loaded class I molecules. It is unclear
whether US2 interacts exclusively with peptide-loaded class I heavy
chains or whether it can also recognize class I molecules prior to
peptide loading. We conclude that US2 recognizes via its lumenal domain
a fully assembled, peptide-loaded class I molecule, a conformation that
apparently arises relatively late in biosynthesis. It is noteworthy
that US2 nonetheless efficiently downregulates class I molecules, in
spite of this late stage of recognition, just prior to exit of class I
molecules from the ER.
The association between US215-140 and HLA-A2 is saturable. Upon native electrophoresis and size exclusion chromatography in the presence of excess US2, both free US2 and US2/HLA-A2 complexes are evident (Fig. 3 to 5 and unpublished data). US2 binding does not significantly alter the conformation of class I MHC molecules, as judged from the ability of soluble TCR to interact with the US2/class I complex. In contrast to many proteins that bind class I, including TCRs and several types of NK cell receptors, US2 recognizes class I molecules regardless of the sequence of the peptide cargo, consistent with the ability of US2 to bind class I molecules at a site distinct from that seen by the TCR. US215-140 interacts with apparently similar affinities with a series of HLA-A2 complexes that possess distinct peptides. While most immune system receptors for class I, including the TCR, several NK receptors, and CD8, are able to form homodimers or heterodimers, recombinant US2 is a monomer in solution and binds to class I molecules with a 1:1 stoichiometry. Studies with cell-permeable chemical cross-linkers have likewise failed to reveal dimerization of US2 in cellular transfectants (unpublished data).
In transfectants that express either US2 or US11, all HLA-A and HLA-B class I molecules appear susceptible to degradation, as judged from the reduction in their surface expression and from the accelerated degradation of the bulk of newly synthesized class I molecules (references 35 and 36 and unpublished observations). In other words, there is no evidence to suggest the selective resistance of the HLA-A or HLA-B locus products to the activity of US2 or US11. Surprisingly, our data show that the luminal domain of US2 is sufficient to allow stable complex formation with HLA-A2 and HLA-A68, whereas neither HLA-B7 nor HLA-B27 appears capable of doing so. If the luminal domain of US2 were the sole region of the molecule responsible for recognition of class I heavy chains, we would predict resistance of these HLA-B locus alleles to US2-mediated degradation, and this is not the case. Interestingly, the association between US3 and class I in vivo requires both the US3 ER-lumenal and transmembrane domains (20), and the recombinant US3 ER-lumenal domain does gel shift MHC class I in vitro (unpublished data). These observations suggest that perhaps the US2 and class I transmembrane segments may also interact to account for US2's ability to target HLA-B locus products for degradation in living cells.
The downregulation of class I molecules is a precarious act for viruses, as NK cells lyse cells that lose MHC class I expression (25). However, the known human NK receptors for class I focus primarily on the HLA-C and HLA-E locus products. By selectively downregulating HLA-A and HLA-B class I molecules, viruses can diminish antigen presentation to CD8+ T lymphocytes while limiting NK cell activation (27). The data presented in this paper suggest that the US2 ER-lumenal domain plays an important role in allowing US2 to distinguish between MHC class I locus products. In contrast, HIV Nef and KHSV K5 focus on the class I transmembrane and tail regions for distinguishing between class I locus products (5, 15). These segments contain an abundance of locus-specific residues (11). Most of the polymorphic residues in class I are concentrated in regions that contact peptide or TCR, and US2 does not compete with TCR for class I association. It is all the more unusual that US2 can use the polymorphisms in the class I lumenal domain to distinguish between class I molecules. Unlike US2 and US11, HCMV US3 does not demonstrate locus-specific interaction with class I (19).
It seems paradoxical that HCMV should encode two proteins, US2 and US11, with apparently redundant functions. As strong selection pressures constantly maintain compact virus genomes, it is a fair assumption that expression of both US2 and US11 benefits HCMV. Murine cytomegalovirus likewise encodes multiple proteins dedicated to class I downregulation, although without apparent homology to their HCMV paralogues and availing themselves of cell biologically distinct mechanisms to accomplish their goal (14). We have suggested that the presence of both US2 and US11 may ensure that HCMV will be able to counter the high degree of class I polymorphism (21). US11 associates with free class I heavy chains in coimmunoprecipitation experiments in cellular transfectants, which indicates recognition by US11 of a motif that arises earlier in class I assembly. Perhaps US2 and US11 safeguard against the escape of class I molecules from the ER by focusing on different stages of the class I biosynthetic pathway. Further structural and mechanistic analyses should provide an explanation for why HCMV employs both proteins.
US215-140 does not bind HLA-DR and HLA-DM with
sufficient affinity to produce a shift on native gel electrophoresis. In contrast, it has previously been reported that US2 associates with
HLA-DR and HLA-DM complexes and subsequently targets the DR
and
DM
subunits for degradation (31). Several explanations could explain the discrepancy between these findings. It is possible that distinct regions of US2 mediate interaction with MHC class I and
class II molecules. Should this be the case, we predict that the US2
transmembrane and/or cytoplasmic tail would contribute significantly to
association with HLA-DM and HLA-DR complexes, as we suggest to be the
case for the interaction of US2 with HLA-B locus products.
Alternatively, it remains possible that another factor is required to
stabilize the interaction between US2 and DR or DM. Finally, US2 may
bind with higher affinity to class I molecules than to either DR or DM
molecules. Consequently, it is plausible that US2 can be induced to
associate with HLA-DR and HLA-DM when overexpressed in the ER.
The mechanism by which US2 targets class I heavy chains for dislocation remains unclear. We have hypothesized that US2 subverts a poorly understood homeostatic "quality control" process. The quality control machinery in the ER recognizes and removes misfolded proteins from the ER. We now suggest that association between the ER-luminal domains of US2 and class I initiates dislocation of class I heavy chains. However, interaction between US2 and class I does not appear to significantly alter the conformation of class I molecules. The details of the events that connect formation of a tight complex between US2 and class I in the ER and the appearance of class I heavy chains in the cytosol remain uncertain. Further, the stability of the US2/HLA-A2 complex and the absence of obvious conformational alterations raise important questions about the details of MHC I dislocation. Is the complex disassembled prior to discharge into the cytosol, and if so, which proteins assist in this unfolding? Alternatively, it is conceivable that the entire US2-class I complex is dislocated via the Sec61 channel, whose diameter is reported to range from 20 to 60 Å (12, 23). The data reported here conclusively demonstrate the lumenal domain's importance for binding and call attention to the proposed transmembrane segment and cytoplasmic tail as essential for the dislocation reaction.
| |
ACKNOWLEDGMENTS |
|---|
We thank Rachelle Gaudet, Joydeep Mitra, and members of the Ploegh lab for assistance.
This work was supported by a grant from the National Institutes of Health (5R37-AI33456). B.E.G. is a predoctoral fellow of the Howard Hughes Medical Institute. E.W.W. is supported by a National Cancer Institute Fellowship in Cancer Biology. D.T. is a Charles A. King Trust postdoctoral fellow. D.J.S. is supported by a Women's Reproductive Health Research Training Grant from the National Institutes of Health (K12-HD01255).
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Pathology, Harvard Medical School, Building D2, Room 137, 200 Longwood Ave., Boston, MA 02115. Phone: (617) 432-4776. Fax: (617) 432-4775. E-mail: ploegh{at}hms.harvard.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Ahn, K.,
A. Angulo,
P. Ghazal,
P. A. Peterson,
Y. Yang, and K. Fruh.
1996.
Human cytomegalovirus inhibits antigen presentation by a sequential multistep process.
Proc. Natl. Acad. Sci. USA
93:10990-10995 |
| 2. |
Baas, E. J.,
H. M. van Santen,
M. J. Kleijmeer,
H. J. Geuze,
P. J. Peters, and H. L. Ploegh.
1992.
Peptide-induced stabilization and intracellular localization of empty HLA class I complexes.
J. Exp. Med.
176:147-156 |
| 3. | Boppana, S. B., and W. J. Britt. 1996. Recognition of human cytomegalovirus gene products by HCMV-specific cytotoxic T cells. Virology 222:293-296[CrossRef][Medline]. |
| 4. | Britt, W. J., and C. A. Alford (ed.). 1996. Cytomegalovirus, 3rd ed., vol. 2. Lippincott-Raven Publishers, Philadelphia, Pa. |
| 5. | Cohen, G. B., R. T. Gandhi, D. M. Davis, O. Mandelboim, B. K. Chen, J. L. Strominger, and D. Baltimore. 1999. The selective downregulation of class I major histocompatibility complex proteins by HIV-1 protects HIV-infected cells from NK cells. Immunity 10:661-671[CrossRef][Medline]. |
| 6. | Cresswell, P., N. Bangia, T. Dick, and G. Diedrich. 1999. The nature of the MHC class I peptide loading complex. Immunol. Rev. 172:21-28[CrossRef][Medline]. |
| 7. |
Fan, Q. R.,
D. N. Garboczi,
C. C. Winter,
N. Wagtmann,
E. O. Long, and D. C. Wiley.
1996.
Direct binding of a soluble natural killer cell inhibitory receptor to a soluble human leukocyte antigen-Cw4 class I major histocompatibility complex molecule.
Proc. Natl. Acad. Sci. USA
93:7178-7183 |
| 8. | Furman, H. M., H. L. Ploegh, and D. J. Schust. 2000. Can viruses help us to understand and classify the MHC class I molecules at the maternal-fetal interface? Hum. Immunol. 61:1169-1176[CrossRef][Medline]. |
| 9. |
Garboczi, D. N.,
D. T. Hung, and D. C. Wiley.
1992.
HLA-A2-peptide complexes: refolding and crystallization of molecules expressed in Escherichia coli and complexed with single antigenic peptides.
Proc. Natl. Acad. Sci. USA
89:3429-3433 |
| 10. | Garboczi, D. N., U. Utz, P. Ghosh, A. Seth, J. Kim, E. A. VanTienhoven, W. E. Biddison, and D. C. Wiley. 1996. Assembly, specific binding, and crystallization of a human TCR-alphabeta with an antigenic Tax peptide from human T lymphotropic virus type 1 and the class I MHC molecule HLA-A2. J. Immunol. 157:5403-5410[Abstract]. |
| 11. | Gussow, D., R. S. Rein, I. Meijer, W. de Hoog, G. H. Seemann, F. M. Hochstenbach, and H. L. Ploegh. 1987. Isolation, expression, and the primary structure of HLA-Cw1 and HLA-Cw2 genes: evolutionary aspects. Immunogenetics 25:313-322[CrossRef][Medline]. |
| 12. | Hamman, B. D., J. C. Chen, E. E. Johnson, and A. E. Johnson. 1997. The aqueous pore through the translocon has a diameter of 40-60 A during cotranslational protein translocation at the ER membrane. Cell 89:535-544[CrossRef][Medline]. |
| 13. | Heemels, T. M., and H. Ploegh. 1995. Generation, translocation, and presentation of MHC class I-restricted peptides. Annu. Rev. Biochem. 64:463-491[CrossRef][Medline]. |
| 14. | Hengel, H., U. Reusch, A. Gutermann, H. Ziegler, S. Jonjic, P. Lucin, and U. H. Koszinowski. 1999. Cytomegaloviral control of MHC class I function in the mouse. Immunol. Rev. 168:167-176[CrossRef][Medline]. |
| 15. |
Ishido, S.,
C. Wang,
B. S. Lee,
G. B. Cohen, and J. U. Jung.
2000.
Downregulation of major histocompatibility complex class I molecules by Kaposi's sarcoma-associated herpesvirus K3 and K5 proteins.
J. Virol.
74:5300-5309 |
| 16. | Jensen, P. E., D. A. Weber, W. P. Thayer, X. Chen, and C. T. Dao. 1999. HLA-DM and the MHC class II antigen presentation pathway. Immunol. Res. 20:195-205[Medline]. |
| 17. | Jones, T. R., L. K. Hanson, L. Sun, J. S. Slater, R. M. Stenberg, and A. E. Campbell. 1995. Multiple independent loci within the human cytomegalovirus unique short region down-regulate expression of major histocompatibility complex class I heavy chains. J. Virol. 69:4830-4841[Abstract]. |
| 18. |
Jones, T. R.,
E. J. Wiertz,
L. Sun,
K. N. Fish,
J. A. Nelson, and H. L. Ploegh.
1996.
Human cytomegalovirus US3 impairs transport and maturation of major histocompatibility complex class I heavy chains.
Proc. Natl. Acad. Sci. USA
93:11327-11333 |
| 19. |
Jun, Y.,
E. Kim,
M. Jin,
H. C. Sung,
H. Han,
D. E. Geraghty, and K. Ahn.
2000.
Human cytomegalovirus gene products US3 and US6 down-regulate trophoblast class I MHC molecules.
J. Immunol.
164:805-811 |
| 20. |
Lee, S.,
J. Yoon,
B. Park,
Y. Jun,
M. Jin,
H. C. Sung,
I. H. Kim,
S. Kang,
E. J. Choi,
B. Y. Ahn, and K. Ahn.
2000.
Structural and functional dissection of human cytomegalovirus US3 in binding major histocompatibility complex class I molecules.
J. Virol.
74:11262-11269 |
| 21. |
Machold, R. P.,
E. J. Wiertz,
T. R. Jones, and H. L. Ploegh.
1997.
The HCMV gene products US11 and US2 differ in their ability to attack allelic forms of murine major histocompatibility complex (MHC) class I heavy chains.
J. Exp. Med.
185:363-366 |
| 22. | Martoglio, B., and B. Dobberstein. 1998. Signal sequences: more than just greasy peptides. Trends Cell Biol. 8:410-415[CrossRef][Medline]. |
| 23. | Menetret, J., A. Neuhof, D. G. Morgan, K. Plath, M. Radermacher, T. A. Rapoport, and C. W. Akey. 2000. The structure of ribosome-channel complexes engaged in protein translocation. Mol. Cell 6:1219-1232[CrossRef][Medline]. |
| 24. |
Miller, D. M.,
B. M. Rahill,
J. M. Boss,
M. D. Lairmore,
J. E. Durbin,
J. W. Waldman, and D. D. Sedmak.
1998.
Human cytomegalovirus inhibits major histocompatibility complex class II expression by disruption of the Jak/Stat pathway.
J. Exp. Med.
187:675-683 |
| 25. |
Ravetch, J. V., and L. L. Lanier.
2000.
Immune inhibitory receptors.
Science
290:84-89 |
| 26. | Reddehase, M. J. 2000. The immunogenicity of human and murine cytomegaloviruses. Curr. Opin. Immunol. 12:390-396[CrossRef][Medline]. |
| 27. |
Schust, D. J.,
D. Tortorella,
J. Seebach,
C. Phan, and H. L. Ploegh.
1998.
Trophoblast class I major histocompatibility complex (MHC) products are resistant to rapid degradation imposed by the human cytomegalovirus (HCMV) gene products US2 and US11.
J. Exp. Med.
188:497-503 |
| 28. | Soderberg-Naucler, C., K. N. Fish, and J. A. Nelson. 1997. Reactivation of latent human cytomegalovirus by allogeneic stimulation of blood cells from healthy donors. Cell 91:119-126[CrossRef][Medline]. |
| 29. |
Stevenson, P. G.,
S. Efstathiou,
P. C. Doherty, and P. J. Lehner.
2000.
Inhibition of MHC class I-restricted antigen presentation by gamma 2-herpesviruses.
Proc. Natl. Acad. Sci. USA
97:8455-8460 |
| 30. |
Story, C. M.,
M. H. Furman, and H. L. Ploegh.
1999.
The cytosolic tail of class I MHC heavy chain is required for its dislocation by the human cytomegalovirus US2 and US11 gene products.
Proc. Natl. Acad. Sci. USA
96:8516-8521 |
| 31. | Tomazin, R., J. Boname, N. R. Hegde, D. M. Lewinsohn, Y. Altschuler, T. R. Jones, P. Cresswell, J. A. Nelson, S. R. Riddell, and D. C. Johnson. 1999. Cytomegalovirus US2 destroys two components of the MHC class II pathway, preventing recognition by CD4+ T cells. Nat. Med. 5:1039-1043[CrossRef][Medline]. |
| 32. | Tortorella, D., B. E. Gewurz, M. H. Furman, D. J. Schust, and H. L. Ploegh. 2000. Viral subversion of the immune system. Annu. Rev. Immunol. 18:861-926[CrossRef][Medline]. |
| 33. |
Tortorella, D.,
C. M. Story,
J. B. Huppa,
E. J. Wiertz,
T. R. Jones,
I. Bacik,
J. R. Bennink,
J. W. Yewdell, and H. L. Ploegh.
1998.
Dislocation of type I membrane proteins from the ER to the cytosol is sensitive to changes in redox potential.
J. Cell Biol.
142:365-376 |
| 34. | Townsend, A., C. Ohlen, J. Bastin, H. G. Ljunggren, L. Foster, and K. Karre. 1989. Association of class I major histocompatibility heavy and light chains induced by viral peptides. Nature 340:443-448[CrossRef][Medline]. |
| 35. | Wiertz, E. J., T. R. Jones, L. Sun, M. Bogyo, H. J. Geuze, and H. L. Ploegh. 1996. The human cytomegalovirus US11 gene product dislocates MHC class I heavy chains from the endoplasmic reticulum to the cytosol. Cell 84:769-779[CrossRef][Medline]. |
| 36. | Wiertz, E. J., D. Tortorella, M. Bogyo, J. Yu, W. Mothes, T. R. Jones, T. A. Rapoport, and H. L. Ploegh. 1996. Sec61-mediated transfer of a membrane protein from the endoplasmic reticulum to the proteasome for destruction. Nature 384:432-438[CrossRef][Medline]. |
| 37. | Yewdell, J. W., and J. R. Bennink. 2001. Cut and trim: generating MHC class I peptide ligands. Curr. Opin. Immunol. 13:13-18[CrossRef][Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»